ID: 954371694

View in Genome Browser
Species Human (GRCh38)
Location 3:50172368-50172390
Sequence GTGGAGAGGGGGCTTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954371679_954371694 27 Left 954371679 3:50172318-50172340 CCTCATTACAGTGTTCCCTCTTT 0: 1
1: 0
2: 2
3: 16
4: 259
Right 954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG 0: 1
1: 0
2: 3
3: 12
4: 281
954371680_954371694 12 Left 954371680 3:50172333-50172355 CCCTCTTTTGCTGAGCTAAAGAT 0: 1
1: 0
2: 1
3: 20
4: 320
Right 954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG 0: 1
1: 0
2: 3
3: 12
4: 281
954371681_954371694 11 Left 954371681 3:50172334-50172356 CCTCTTTTGCTGAGCTAAAGATA 0: 1
1: 0
2: 1
3: 11
4: 138
Right 954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG 0: 1
1: 0
2: 3
3: 12
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954371694 Original CRISPR GTGGAGAGGGGGCTTGCCAA GGG Intronic
900335337 1:2160415-2160437 GTGGAGAGGGGGGCAGGCAAGGG + Intronic
901277807 1:8006286-8006308 GTGGGGAGGGGGCTCGGGAATGG - Intronic
901814588 1:11787051-11787073 ATAGAGAGGGGGCTCTCCAAAGG - Exonic
902255567 1:15186796-15186818 GTGGAGAGAGGGCAGGCCAGGGG + Intronic
902927271 1:19704399-19704421 GAGGGGATGGGGCTTGCCCAAGG + Intronic
903164867 1:21513222-21513244 GAGGAGAAGAGGCTTGCCCAGGG + Intronic
903326007 1:22568909-22568931 GAGGTGAGGGGGCTTGCCCAGGG + Intronic
903355928 1:22747376-22747398 GTGGTGAAGTGGCTTGCCCAAGG + Intronic
903875447 1:26470681-26470703 GTGGATGGGGGCTTTGCCAAAGG - Exonic
904052075 1:27645837-27645859 GTGGAGTGGAGGTTTGCCATAGG + Intergenic
904769825 1:32874707-32874729 GAGAAGAAGGGGCTTGCCATGGG + Intergenic
906044328 1:42816766-42816788 GTGGGGAGGAGACTTGCCCAGGG - Intronic
906460458 1:46032195-46032217 GGGGACATGGGGCTGGCCAACGG - Exonic
907341150 1:53737385-53737407 AAGGAGAGGGGTCTTGCTAAAGG + Intergenic
907700145 1:56778206-56778228 CTGAAGAAGGGCCTTGCCAAAGG - Intronic
909018343 1:70403994-70404016 AGGGAGAGAGGGCTTGCCAGAGG - Intergenic
910859234 1:91727409-91727431 GAGGTTAGGGGACTTGCCAAAGG + Intronic
911849814 1:102803922-102803944 TTGGGGAAGGGGATTGCCAAGGG + Intergenic
912037591 1:105339774-105339796 GTGGAGGTGGGGATTGCCAGAGG + Intergenic
912419740 1:109535017-109535039 GTGGAAAGGGAACTTGCCCAGGG - Intergenic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
912731598 1:112111801-112111823 GTGGAAAGGGGAGTTGCAAAGGG - Intergenic
913380536 1:118205509-118205531 ATAGAGAGGTGGCTTGCCCAAGG - Intergenic
916647208 1:166797664-166797686 GTGGAGAGGGTGCTGGGAAATGG + Intergenic
916747886 1:167698306-167698328 GTGGACAGGGGGCATTCCCAGGG + Intronic
918610654 1:186486874-186486896 GTGGGGAGGGGGTTTGCTACTGG - Intergenic
919766174 1:201128559-201128581 GTGAAGAGAGGGTTTGCCCAAGG - Intergenic
920820969 1:209380370-209380392 GAGGAGAAGGGACTTCCCAATGG + Intergenic
921053486 1:211527250-211527272 GTGGAGTGGGGGATGGACAAAGG - Intergenic
922241293 1:223756938-223756960 GAGGAGAGGGGACTTGCTCAAGG + Intronic
922808742 1:228404179-228404201 GTGGGGAGGGGGTTTGCCACAGG - Intronic
922810044 1:228410298-228410320 CTGGAGAGGGGGCTTGATTACGG - Intronic
1063645732 10:7881050-7881072 GTAGAGACGGGGCTTCCCCATGG - Intronic
1067296013 10:44975495-44975517 GTGGAGAGGGGACTGGAGAAGGG - Intronic
1067511005 10:46895185-46895207 GGGGTGGGGGGGCTTGCCAGAGG - Intergenic
1067740258 10:48890178-48890200 GAGGAGAGGGAGCTTGTCCAGGG - Intronic
1067820471 10:49524379-49524401 GGGGAAAGTGGGATTGCCAAAGG - Exonic
1069247016 10:66219231-66219253 GTGGCGAGGGGCCTTGGGAAAGG + Intronic
1070436189 10:76396315-76396337 GTGGAAAGTGGCCTAGCCAAAGG + Intronic
1070705145 10:78632110-78632132 GTGCAGAAGGGGCTGGCCTAGGG - Intergenic
1070793894 10:79205789-79205811 GAGGGGAGGGGGCTTGACCAAGG + Intronic
1071481818 10:86070349-86070371 GTAGAGATGGGGCTGGGCAAGGG - Intronic
1074560302 10:114529669-114529691 GTGCACAGGAGGCATGCCAATGG - Intronic
1074845174 10:117391459-117391481 GAGGAGAGGTGACTTGCCCAGGG + Intergenic
1075710875 10:124529990-124530012 CTGGAGAGGTGCCTTGCCACAGG + Intronic
1075795451 10:125116610-125116632 TAGGAGAGGGGGCTTGCCCTGGG - Intronic
1076164650 10:128271977-128271999 GGGCAGATGGGGCTTGCCAGGGG - Intergenic
1076531393 10:131147602-131147624 GAGGGGAGGGGGCTTGCCCCAGG - Intronic
1077092844 11:787525-787547 GTGGAGGGGGTGCTGCCCAAGGG - Exonic
1077321909 11:1946567-1946589 GTGGAGAGGGGGTGAGCAAACGG + Intergenic
1077436459 11:2541759-2541781 GATGAGAGGGGGTTTTCCAAAGG - Intronic
1079322681 11:19464508-19464530 GAGGAGAAGGGACTTGCCCAAGG - Intronic
1080349764 11:31369936-31369958 GCGGAGAGGGTGCCCGCCAATGG + Intronic
1081871940 11:46386982-46387004 GTGGAGAGTGGCCCTGCCAGGGG + Intergenic
1082044654 11:47715122-47715144 GTGGTGAGGGGGTTTCCTAAGGG + Intronic
1083658816 11:64242653-64242675 GGCGAGAGGGGACTTGCCCAAGG - Intronic
1084504709 11:69558150-69558172 GGGGTGAGGGGACTTGCCCAAGG - Intergenic
1085235645 11:75013231-75013253 CTGGTGAGGGGGCTGGGCAAGGG - Intronic
1085630252 11:78109458-78109480 GTGCAGATGAGGGTTGCCAAGGG + Exonic
1090034739 11:123238965-123238987 GTCGAGTGGGGGCAGGCCAATGG - Intergenic
1090469522 11:126967811-126967833 CTGGGGAGGGGGCTTGCTACAGG + Intronic
1091348878 11:134876870-134876892 GTGGAGAGGGGGCATGTGGAGGG - Intergenic
1202804925 11_KI270721v1_random:1880-1902 GTGGAGAGGGGGTGAGCAAACGG + Intergenic
1094496492 12:30992411-30992433 GTGGAGAGTGGGCAGGTCAAAGG - Exonic
1095260889 12:40098309-40098331 GTAGAAAGGTGGGTTGCCAAGGG + Intronic
1095923639 12:47556670-47556692 GTGGAGAGGGGGCCTGAAAGAGG - Intergenic
1095984098 12:47988318-47988340 GTGGGGAGGGGGCTTGCCAGAGG - Intronic
1096828908 12:54299751-54299773 GATGAGAGGGGGCTTGCCTCAGG + Intronic
1097202350 12:57289894-57289916 GTGGAGAGGAGCCTGGCTAAAGG - Intronic
1102192335 12:110998163-110998185 GTGGACAGGGGGCTAGGGAATGG - Intergenic
1102433667 12:112903312-112903334 GTGGGGAGGGGGCTTCCAAGTGG + Intergenic
1103414732 12:120736634-120736656 GTGCAGAGGGGGCTGGACGAAGG + Intronic
1103947918 12:124537338-124537360 GTGGAGAAGGGGTTTCCCAGAGG - Intronic
1104760430 12:131294940-131294962 GTAGGGAGGGGGCTTCCCCACGG - Intergenic
1104819349 12:131665845-131665867 GTAGGGAGGGGGCTTCCCCACGG + Intergenic
1104970130 12:132527334-132527356 GGGGACAGGGAGCTAGCCAAGGG + Intronic
1106444125 13:29809236-29809258 GGGGAGAGGGAGCTTGAGAAAGG + Intronic
1107259746 13:38476178-38476200 GTGGAGATGGGGCTTAACCATGG - Intergenic
1108591991 13:51920646-51920668 GTGGGGAGGGGGATTGCCATGGG - Intergenic
1109231120 13:59758740-59758762 GTGAAGAGGGGGCTTCACAGAGG + Intronic
1118089194 14:62453883-62453905 GTGAAGAGAGGGGTTGACAAAGG + Intergenic
1118893560 14:69928106-69928128 GAGGAGAAGGGACTTGCCCAAGG + Intronic
1119438090 14:74611179-74611201 GTGGAGAGGCGCCTTGCGAAAGG + Intronic
1121246902 14:92467573-92467595 GAGGGGAGGTGGCTTGCCCAAGG + Intronic
1121570604 14:94944079-94944101 CTGGAGAGGTGACTTGCCCAAGG + Intergenic
1122300863 14:100730388-100730410 GTGGGGAGGGGACATACCAAGGG - Intronic
1122890653 14:104730734-104730756 GTGGAGATAGGGCTGGCCACAGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123987177 15:25656255-25656277 GGGGAGAGGGGGCTTGAGGAAGG + Intergenic
1124010990 15:25838460-25838482 GTGGTTAGGGAGGTTGCCAAGGG - Intronic
1124665262 15:31586818-31586840 GTGGAGAGGGGGCAAGCCAAGGG - Intronic
1127711666 15:61605001-61605023 TTGCACAGGGGGCGTGCCAATGG + Intergenic
1128157527 15:65401330-65401352 TTGGAGAAGGGATTTGCCAAAGG - Intronic
1128739405 15:70073278-70073300 GAAGAGAAGGGACTTGCCAAAGG + Intronic
1128870273 15:71149835-71149857 GTGGAGAGTGGGATTGGCCAAGG + Intronic
1129917597 15:79288083-79288105 GTGAAGAAGTGGCTTGCCCATGG - Intergenic
1132911734 16:2317244-2317266 GGGCAGAGTGGGGTTGCCAAGGG - Intronic
1133301912 16:4787758-4787780 GTGTGGAGGGGGTTGGCCAACGG - Intronic
1135732095 16:24903486-24903508 GTGGGGAGGAGGGTAGCCAAAGG - Intronic
1138756714 16:59495110-59495132 GTGGGGAGGGGGGCTGCTAATGG + Intergenic
1139268614 16:65661933-65661955 GAGGAGATGTGGCTTGCCGAAGG - Intergenic
1139675371 16:68519714-68519736 GTGGACAGGGGGTTGGCCGAGGG + Intergenic
1140332451 16:74070905-74070927 GTGGGTGGGGGTCTTGCCAAAGG + Intergenic
1140520778 16:75579590-75579612 GAGGAGGGGTGGCTTCCCAAAGG + Intergenic
1141212330 16:81993148-81993170 GGGGAGATGGGACTCGCCAAAGG - Exonic
1141323515 16:83034607-83034629 ATGGTGAGGGGGTTTGCCCATGG + Intronic
1141803012 16:86323745-86323767 GAGGAGAGGGGGCTTGCTGCTGG + Intergenic
1143108457 17:4540962-4540984 GTGGAGGGAGAGCTTGCCAAGGG - Intronic
1144092764 17:11872580-11872602 GTGGACTGGGAACTTGCCAAAGG - Intronic
1144468090 17:15512936-15512958 GAGGAGAGGGGATTTGCCTAAGG - Intronic
1144585018 17:16482550-16482572 GGGGAGACGGGGCTTCCCACAGG + Intronic
1144707520 17:17379460-17379482 GTGGAGAGAGGGCTGGCTGAGGG - Intergenic
1144836651 17:18159810-18159832 GTGGGGAGGGGGCTGGGAAAGGG + Intronic
1145816303 17:27797448-27797470 GAGGCTAGGGGACTTGCCAAAGG + Intronic
1146056405 17:29583510-29583532 GTGGCGAAGGTGCTTGACAATGG + Exonic
1147370622 17:39990151-39990173 GTGCTGAGGGGCCTTGCGAAGGG - Exonic
1148209045 17:45797139-45797161 GTGGGCAGGGGGCTGGGCAAGGG + Intronic
1148615098 17:48995967-48995989 GTGGAGCCGGGGCTTGCCCGTGG + Intergenic
1148652327 17:49259212-49259234 ATGGGGAAGGGGCTTGCCCAAGG + Intergenic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1150008934 17:61487270-61487292 GGGGAGAGAGGGCTTGCCGGGGG - Intergenic
1151311472 17:73295249-73295271 CAGGAGAGGTGACTTGCCAAAGG + Intronic
1151567160 17:74905109-74905131 GAGGGGAAGGGGCTGGCCAAAGG - Intergenic
1152440055 17:80302133-80302155 ATGGGGAGAGGGCTAGCCAAAGG + Intronic
1152694675 17:81738186-81738208 GTGGAGGGTGAGCTTGCAAAGGG + Intergenic
1155086375 18:22463264-22463286 GTGGAGACAGGGCATCCCAAGGG - Intergenic
1155940366 18:31796257-31796279 GTGAAGCGGGGGCTTGCCCCAGG + Intergenic
1157202122 18:45668304-45668326 GTGGAGCAGGGGCTTCCCCAGGG - Intronic
1160376296 18:78415072-78415094 GTAGAGAGGGGGCCAGCCAGTGG + Intergenic
1160497515 18:79383958-79383980 CTGGAGAGTGGGCCTGCCAGGGG - Intergenic
1161389546 19:4014032-4014054 TTGGAAAGGGGGCTGGCCAGTGG + Intronic
1161527452 19:4765569-4765591 GAGGGGAAGGGGCTTGCCCAAGG - Intergenic
1161576450 19:5057150-5057172 GTGCAGAGGGGGCTGGGAAAAGG - Intronic
1162191001 19:8946813-8946835 GTTGAGTGGGTCCTTGCCAAGGG + Exonic
1162582212 19:11538418-11538440 GAGGAGAAGGGGCTTACCTAAGG + Intergenic
1162876334 19:13623553-13623575 GCTGGGAGGGGGGTTGCCAAGGG + Intronic
1163450887 19:17376864-17376886 GAGGTGAGGGGGCTTGCTCAGGG + Intronic
1163520246 19:17787825-17787847 GTGAAGAGGAGGTTTGCCACAGG + Exonic
1163771113 19:19192016-19192038 GTGGAGGGGCGGCCTGACAAAGG - Intronic
1164580796 19:29433707-29433729 ATGGGGAGAGGGCTTGCCCAAGG - Intergenic
1164759563 19:30718891-30718913 GTGGAGGGAGGGCTTCCCAGTGG + Intergenic
1164985008 19:32641993-32642015 TTGGAAAGGGGACTGGCCAAGGG - Intronic
1165246457 19:34500819-34500841 TTGGGGAGGGGGCCTGCAAAGGG + Exonic
1165255545 19:34575549-34575571 TTGGAGAGGGGGCCTGCAAAGGG + Intergenic
1166225305 19:41391474-41391496 GAGGGGAAGGGGCTTGCCCAAGG - Intronic
1167020673 19:46873039-46873061 GCAGAGAGGGGACTTGCCCAAGG + Intergenic
1167108841 19:47447244-47447266 GTGGAGAGGGGGCGGGTCCAGGG - Intronic
1167642239 19:50688210-50688232 TGGGAAAGGGGGCTTGCCCAGGG - Intronic
1167667322 19:50830412-50830434 GTGGACAAGGGGCTTAACAAAGG + Intronic
925009910 2:476064-476086 TTGGAGATGGGGCTTGTCAGAGG + Intergenic
926217762 2:10915733-10915755 GTAGAGAGGGGCCTGGCCAGGGG + Intergenic
926742781 2:16126139-16126161 GTGGAGAGGGGGCTCCTCAGGGG - Intergenic
932081268 2:68717521-68717543 GTGGAGTTGAGGCTTGACAAGGG + Intronic
932574553 2:72955553-72955575 GTGGGGAGGGGCCTTGGCCAAGG + Intronic
934773362 2:96921836-96921858 GTGGAGAGTGTGCTTGTCAGAGG + Intronic
935065946 2:99647863-99647885 GTGGGGAATGGGCTTGACAAGGG + Intronic
936249791 2:110859611-110859633 ATGGAGAGGGGCTTTGCCAGTGG + Intronic
937021611 2:118662139-118662161 GAGGAGAGTGGGCAAGCCAAGGG - Intergenic
938371135 2:130768917-130768939 GTGGAAAAGGGGTTTGCCCAGGG + Intergenic
938754870 2:134370568-134370590 TTGGAGATGGCGCTTGCCAGAGG + Intronic
939423428 2:142003503-142003525 GTGCAGAGGGGGCTGGCAGAGGG - Intronic
943750046 2:191501369-191501391 AAGGAGAGGGGGCTGGCCATGGG + Intergenic
945314643 2:208359344-208359366 GGGAAGAGGGTGCTTGCAAACGG + Intergenic
946236424 2:218327184-218327206 ATGGAGAGGGGGCTTGGTCAGGG - Intronic
946880305 2:224170825-224170847 GTGGAGAGGGAGCTGGACCATGG - Intergenic
947540833 2:230976684-230976706 GCGGAGAGGGGCTTTGCCACTGG - Intergenic
947921135 2:233875338-233875360 GTGGAGAGGTAGCTTGTCCAGGG + Intergenic
948437091 2:237961177-237961199 GTGGAGCAAGGGCTGGCCAAGGG + Intergenic
1169047120 20:2542278-2542300 GTGGAGAAGAAGCTTGACAAAGG + Intronic
1169587616 20:7103836-7103858 CTGGAGAGAGGGTTTGGCAATGG + Intergenic
1169790896 20:9409564-9409586 GTGGTCAGGGTGTTTGCCAAAGG - Intronic
1170972265 20:21126554-21126576 GTGGGGAGGGGGCGTGTAAAAGG - Intronic
1173733366 20:45343450-45343472 GGGGGCAGGGGGTTTGCCAAGGG - Intronic
1174286732 20:49479413-49479435 GGGGAGAAGGGGCTGGCCAAGGG + Intronic
1175341697 20:58235058-58235080 GTGGTGAAGGGACTTGCCCAGGG - Intergenic
1175658754 20:60794091-60794113 GGGGAGAGGTGGCTTCCCAGGGG + Intergenic
1176074366 20:63241759-63241781 GTGGAGAGGGGGCTCACCCAGGG + Intronic
1176261666 20:64185088-64185110 ATGGAGAGGGGGCTGGGCAGGGG + Intronic
1178627999 21:34234219-34234241 ATGGAGAGGAGGCTAGCCAGTGG - Intergenic
1180303400 22:11054857-11054879 GTGGAGAGTGCGCTGGCCCATGG - Intergenic
1180595900 22:16973056-16973078 GTGGAGTAGGAGCTTGCCAGAGG - Intronic
1181028855 22:20140543-20140565 GTGGGCAGGGGGCTGGGCAAGGG - Intronic
1181560573 22:23697332-23697354 TAGGAGAGGAGGTTTGCCAAGGG - Intronic
1182013700 22:27021591-27021613 GAGGTGAGGGGACTTGCCAGAGG - Intergenic
1182108585 22:27706652-27706674 GTGGAGAAGGGGGTTGGGAAAGG - Intergenic
1182289405 22:29266790-29266812 GTGGAGAAGGCGCTTGGCAGGGG - Intronic
1182622112 22:31623954-31623976 ATGGAGAGGCAGCTTGCCAAGGG - Intronic
1183270368 22:36858502-36858524 GTGCAGAGGTGGCTTCCCAGTGG + Intergenic
1183299664 22:37052590-37052612 GAGGTGAGGCGACTTGCCAAAGG - Intronic
1183315745 22:37136035-37136057 GAGGGGACGGGGCTTGCCATGGG - Intronic
1183488981 22:38106790-38106812 GAGAAGAGAGGGCTTTCCAAGGG - Intronic
1183650621 22:39151628-39151650 TTGGCGAGGGGGCTCGCCTAAGG - Intronic
1184147295 22:42619177-42619199 GGGAAGAGGGGGCTGGCCATGGG - Exonic
1184166524 22:42732275-42732297 GGAGAGAGGGGGCTGGCAAAGGG - Intergenic
1184340743 22:43884573-43884595 GTGGAGAAGTGACTTGCCTAAGG + Intronic
1185019846 22:48367724-48367746 GTGGAGAAGGTGCTCCCCAAGGG - Intergenic
950502440 3:13372965-13372987 ATGGAGAGGGGGCTTCACACAGG - Intronic
952191264 3:31025752-31025774 GTGGAGAGTGGGGTTGACTAAGG - Intergenic
954238820 3:49277352-49277374 GTGGGGACGGGGCTTTCGAATGG + Exonic
954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG + Intronic
955402376 3:58601924-58601946 CGGGAGAGGGGACTTGGCAAGGG + Intronic
956460759 3:69469638-69469660 GTGGAGTAGGGGCTTGCTATGGG - Intronic
960036144 3:113104893-113104915 GAGAAGAGGGGGCTGGCCAGAGG - Intergenic
961543956 3:127619087-127619109 GAGGAGGAGGGGCTGGCCAATGG + Exonic
961904116 3:130244620-130244642 GTGGGGAGTGGGATAGCCAAAGG - Intergenic
962732715 3:138298680-138298702 GTGGAGATGGGGCATACCTAAGG - Intronic
963753919 3:149213568-149213590 GTTGTGGAGGGGCTTGCCAAAGG - Intronic
964320933 3:155496505-155496527 GTGGAGTGGGGGCTGGGCAGGGG + Intronic
964546333 3:157838597-157838619 TTGGAGGTGGGGCTTGGCAATGG - Intergenic
964853054 3:161115764-161115786 CTGGAGAGGGGGCATACCCAGGG + Intronic
967721288 3:192819295-192819317 GTGGTGAAGGGGTTTGCCCACGG + Intronic
967976884 3:195040506-195040528 GAGGGGAGGGGACTTGCCCAAGG + Intergenic
968231593 3:197007824-197007846 GTGGGGAGGGGACTGGACAATGG - Intronic
968774494 4:2532280-2532302 GGGGAGAGGGAGATAGCCAAAGG - Intronic
968919921 4:3517169-3517191 GTGGTGAGGGGTCTTGCCCAAGG + Intronic
969111360 4:4846267-4846289 GTGGAGAGGGGGCAATCCCAGGG + Intergenic
969317588 4:6391273-6391295 GAGGGGAGGTGGCTTGCCCAGGG - Intronic
969926285 4:10588903-10588925 GTGGAAGGGTGGGTTGCCAAGGG + Intronic
970348944 4:15181560-15181582 GTGGAGAGCTGCCTTGCCCAAGG - Intergenic
974136931 4:57830126-57830148 GTGGAGTGGGGTTTTGCCCATGG + Intergenic
978443964 4:108763100-108763122 GAGGAGGAGGGGCTTGGCAAAGG - Intergenic
982489143 4:156006632-156006654 GAGGAGAGGGCACATGCCAAGGG + Intergenic
985041164 4:185893257-185893279 GTGGTGAGAGGGCTTGACATGGG + Intronic
985724579 5:1509130-1509152 GTGGAGGGGAGGCTGCCCAAAGG + Intronic
992777057 5:80097798-80097820 GAGGAGAGGGGCCTTACCACTGG - Intergenic
995627743 5:114097789-114097811 GTGGACAAGGTGCTTACCAATGG - Intergenic
997588737 5:135060226-135060248 ATGGAGAGTGGGCCTGCCCAGGG + Intronic
997860264 5:137409370-137409392 GTGGAGAGGGAGGCTGCCATGGG + Intronic
997866177 5:137464760-137464782 GTGGAGAGGTCGCTGGGCAAAGG + Intronic
998025902 5:138816054-138816076 GCGGAGAGGTGGGTAGCCAAAGG - Intronic
999403440 5:151285371-151285393 GAGGAGAGGGGAATTGCCCAAGG + Intronic
1001474163 5:172037736-172037758 TTGGAGAGGAGGCTTGACTAGGG - Intergenic
1001633943 5:173196529-173196551 CTTGCAAGGGGGCTTGCCAAGGG - Intergenic
1001929638 5:175663858-175663880 GAGGGGAGGTGGCTTGCCCAGGG - Intronic
1002092283 5:176812592-176812614 CTGGAGCGGGGGGTTGCCACAGG + Intronic
1004873319 6:19929810-19929832 TTGGAGAGATGCCTTGCCAATGG - Intergenic
1005790100 6:29291082-29291104 GTAGTGAAGGGGCTTGCAAATGG - Intergenic
1007079486 6:39088870-39088892 TTGTAGAGGTGGCTTGCCCAAGG + Intergenic
1007301691 6:40872465-40872487 GTGGAGAGGGGGCTTGGGGGAGG - Intergenic
1007455666 6:41975303-41975325 GTGGAGATGGGTGTTGCCTATGG + Intronic
1007733259 6:43964853-43964875 GTGGGGATGGGGCTTGGCCAGGG - Intergenic
1009611214 6:65943773-65943795 GTGGAGTGGAGGCTTGCCAAGGG - Intergenic
1009631166 6:66202729-66202751 GTGGAGAGGGGACTTGAGAGCGG - Intergenic
1014445893 6:121526941-121526963 GTGAAGAGAGGACTTTCCAAAGG - Intergenic
1018074485 6:160199636-160199658 GTGGTGAGGGGGCTGGGTAAGGG + Intronic
1020026439 7:4903325-4903347 GTGGGCAGGGGGCTTGCACAGGG - Intergenic
1020438343 7:8189765-8189787 GTGGGGAGGGGGCTGGGCAGGGG + Intronic
1022414111 7:30163648-30163670 GTGGGGAGGGGACATGCCTAGGG - Intergenic
1024315450 7:48011950-48011972 TGGGAGAGGGGGCAGGCCAATGG + Intronic
1024690626 7:51798223-51798245 GTAGAAATGGTGCTTGCCAATGG + Intergenic
1024752412 7:52483078-52483100 ATGGGGAGGGGGTTTGCAAAGGG + Intergenic
1026147636 7:67761110-67761132 GTGGACAGGGGGCTAGGGAATGG + Intergenic
1028899088 7:96075849-96075871 GGGGAGAGGGGGCCTCTCAAGGG - Intronic
1029540512 7:101179748-101179770 GGGGAGAGGGAGATTGCAAAGGG + Intronic
1034936660 7:155204464-155204486 GTGGAGAGGCGGCGTGCACATGG - Intergenic
1036490218 8:9218219-9218241 GTGGAGAGGCGGGGTGCCATGGG + Intergenic
1036702978 8:11025448-11025470 GTGCAGGGAGGGGTTGCCAATGG + Intronic
1036813715 8:11885885-11885907 GTGGAGCGGGGGCTTGCAGGAGG - Intergenic
1037759910 8:21734984-21735006 GCGGGGAGGGGGCTTCCAAAAGG - Intronic
1037813020 8:22097882-22097904 GGGCAGAGGGGGCTTGCCCTGGG - Intronic
1037814057 8:22102686-22102708 GAGGAGAGGTGGCTGGCCACAGG + Intronic
1038394436 8:27236722-27236744 GGGGGGAGGGGGGTGGCCAAGGG - Exonic
1038538297 8:28370341-28370363 GTGGAGGAGGGGCTCGCCCAGGG + Intronic
1039790581 8:40872573-40872595 GGGGCCAGGGGGATTGCCAAGGG + Intronic
1041173889 8:55173192-55173214 CTGGAAAGGGGGCCTGCCAAGGG - Intronic
1042553520 8:70015067-70015089 GTGGAGATGGAGGTTCCCAAAGG + Intergenic
1044668628 8:94656060-94656082 GTGGAGTGGAGGGTTGCCTAAGG + Intronic
1045038460 8:98196547-98196569 GATGAGAGGGGGCTTGGCAGTGG - Intronic
1045710093 8:104973309-104973331 GGGGAAAGAGGGCTTGTCAATGG + Intronic
1048072227 8:131033729-131033751 GTGGAGAATGGGCTTTACAAAGG - Intronic
1048280308 8:133101026-133101048 GTGGAGACTTGGCTTTCCAAAGG - Intronic
1049194750 8:141308811-141308833 GGCGGGAGGGTGCTTGCCAAGGG - Intergenic
1049644343 8:143729373-143729395 GTGGAGGGGAGGCTGGACAATGG - Intronic
1049648896 8:143754203-143754225 GTGGGGAGGGGCCATGACAATGG + Intergenic
1049752899 8:144293993-144294015 GTGGAGTGGAGGCTGGCCACGGG - Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051488399 9:17633916-17633938 GTGCAGAAAGGGGTTGCCAAAGG - Intronic
1052857162 9:33414678-33414700 GTGGGCAGGGGGCATGGCAAGGG + Intergenic
1056974033 9:91234144-91234166 GTGGAGAGAGGGGTGGCCAAAGG - Intronic
1057139127 9:92716218-92716240 TTGGAGAGGGTGCTATCCAAGGG - Intronic
1057163660 9:92909169-92909191 GTGGGGAGGGGGCTGGCAGATGG - Intergenic
1059719987 9:116950629-116950651 GTGGAAGGGAAGCTTGCCAAAGG - Intronic
1060026005 9:120172097-120172119 GTGGAGGGGGAGCTTGGGAAAGG - Intergenic
1060931246 9:127490896-127490918 ATGGAGAGGGGGCTTTCCTTGGG - Intronic
1061028748 9:128067240-128067262 GTAGCGAGGGGGGTTACCAAAGG - Exonic
1061820561 9:133225337-133225359 GGGGAGAGGGACCTTGCCCACGG + Intergenic
1061969928 9:134039498-134039520 GTGGAAGGGAGGCTTCCCAAGGG - Intronic
1062218884 9:135403803-135403825 GTGGAAAGAGGGCTGGTCAAGGG + Intergenic
1062290721 9:135793246-135793268 GGGGAATGGGGGCTTGCCTATGG - Intergenic
1062428476 9:136516786-136516808 GGGGAGTGGGAGCTTGCCCAGGG - Intronic
1062665700 9:137670367-137670389 CAGGAGAGGGGACTAGCCAAGGG - Intronic
1187208703 X:17207923-17207945 GTGGGCAGGGGGCTAGGCAATGG - Intergenic
1189410543 X:40766658-40766680 ATGGAATGGTGGCTTGCCAATGG - Intergenic
1190714186 X:53090355-53090377 GAGGGAAGGGGCCTTGCCAAAGG - Intergenic
1193732315 X:85116091-85116113 GTGGAGAGGTGTCTTACCACTGG + Intergenic
1194655194 X:96564701-96564723 GTAGAGGTGGGGATTGCCAAAGG - Intergenic
1198177823 X:134173023-134173045 GTGAAGAGGGCGCCTGGCAAGGG - Intergenic