ID: 954374266

View in Genome Browser
Species Human (GRCh38)
Location 3:50185831-50185853
Sequence GCTGTTGGTGGGGCTGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954374259_954374266 -10 Left 954374259 3:50185818-50185840 CCCAGCCTAGCTGGCTGTTGGTG 0: 1
1: 0
2: 0
3: 11
4: 202
Right 954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG 0: 1
1: 0
2: 2
3: 36
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954374266 Original CRISPR GCTGTTGGTGGGGCTGGCTA TGG Intronic
900736916 1:4304927-4304949 GCTGTTGTTGGGGAGGGCTCTGG + Intergenic
900927173 1:5713007-5713029 GCTGTTGTAGGGGCTGGGGAAGG - Intergenic
900985784 1:6072183-6072205 GCTGCTGTTGGGCCTGGCTGTGG + Intronic
901680565 1:10910377-10910399 GCTGCTGGCGGGGCTTGCTGGGG - Intergenic
902095567 1:13941757-13941779 GCTGTTGGTGGTGGTGGTGATGG - Intergenic
902542730 1:17166188-17166210 GATGTTGGTGGGGATGGTGATGG - Intergenic
903014759 1:20354582-20354604 ACTGCTGCTGGGGCTGGCGAGGG + Intronic
903058230 1:20651722-20651744 GCTGTGGGTGGGGGTTGCTGTGG - Intergenic
903522260 1:23959706-23959728 CCTGTTGCTGGGGCTGGCCGGGG - Intronic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904365892 1:30010695-30010717 GCTGTTTGTAGGGCTGCCTGGGG - Intergenic
904678835 1:32214998-32215020 GCTGTTGTTGGGGATGTCCATGG + Intronic
905593261 1:39183727-39183749 GATCTTGGTGGAGCTGGGTATGG - Intronic
905883267 1:41478061-41478083 GCTGCTTGTGGGGCTGGCAATGG - Intergenic
906205085 1:43982323-43982345 GCCTTTGGTGGACCTGGCTAGGG + Intronic
907049316 1:51318833-51318855 GTAGTTGGTGGGGTTGGCTTTGG - Intronic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
907268276 1:53275832-53275854 GTTTTTGCTGGGGGTGGCTATGG - Intronic
907422643 1:54357527-54357549 GGAGGTGGTGGGGCTGGCTGGGG - Intronic
907571183 1:55485440-55485462 GCTGAAGGTTGGACTGGCTATGG + Intergenic
907834263 1:58094054-58094076 GCTGCTGGTGGTGCTGCCCAAGG - Intronic
909347162 1:74603894-74603916 GCTGATGGCTGGGGTGGCTATGG + Intronic
910187705 1:84561674-84561696 GCTGAAGGTTGGGGTGGCTATGG - Intronic
912430144 1:109624577-109624599 CCTTTTGGAGGGGCAGGCTAAGG + Intronic
913201246 1:116496613-116496635 GCTGGGGGTGGGGTTGGCAAGGG - Intergenic
915288896 1:154869816-154869838 GCTGCTGGTGGCGCTGGCGGTGG + Exonic
915299705 1:154945032-154945054 GGTGGTGGTGGTGGTGGCTATGG + Exonic
915348956 1:155212845-155212867 GCTGGGGCTGGGGCTGGCTCAGG + Intronic
915352143 1:155233471-155233493 GCTGGGGCTGGGGCTGGCTCAGG + Intergenic
915951906 1:160195245-160195267 GCTGTTGATGGTGCTGACCACGG - Intronic
916080480 1:161229102-161229124 GCTGCTGTGGGGGCTGGCTCTGG - Exonic
918793311 1:188858676-188858698 GATGTGGGTGGGGCCAGCTAAGG + Intergenic
919800880 1:201354020-201354042 GCTGTTGTTGGGGGTGGCAGAGG - Intergenic
921276069 1:213521456-213521478 GCTGATGGTTGGGGTGGCTGTGG + Intergenic
921313960 1:213873328-213873350 GCTGAAGGTGGGGGTGGCTGTGG - Intergenic
921622450 1:217340831-217340853 GCTGTGAGTGGGGTTGGATAGGG - Intergenic
923294249 1:232578029-232578051 GCTGAAGGTTGGGCTGGGTATGG - Intergenic
924037510 1:239952626-239952648 GCTGTTGATGGAGCTTGCAAAGG + Intergenic
924759435 1:246970435-246970457 ACTGGAGGTGGGGATGGCTACGG + Intronic
1063661914 10:8040275-8040297 GCTGTTGGGGGGGCGAGCTCTGG + Intergenic
1064868036 10:19904481-19904503 GCTGTTGCTGGGGGTGGGCAGGG - Intronic
1067225690 10:44374415-44374437 GCTGTTGGGTGGGCTGCCTGGGG - Intronic
1067256842 10:44649763-44649785 GCTGTGGATGGGGCTGGAGATGG + Intergenic
1067822044 10:49539063-49539085 GCTGTTGGGGGCGGTGTCTATGG - Intronic
1069613551 10:69791786-69791808 GCTGGTGGTGGTGCTGGTGATGG - Intergenic
1069784822 10:70981279-70981301 GCTGTGGCTGGGGCTGTCTAGGG + Intergenic
1069854703 10:71433660-71433682 GCTGCAGGTGGAGCTGGCTGAGG - Intronic
1070668522 10:78362160-78362182 GCTTTTGCTTGGGCTGGTTAAGG + Intergenic
1073062359 10:100740255-100740277 GCTGTTGGTGGTGGTGGTTGGGG + Intronic
1073513462 10:104057100-104057122 GGTGTTGGTGGCGCTGGCGGCGG - Exonic
1074288295 10:112119169-112119191 GCTGGGGGTGGGGCTTGCTCAGG - Intergenic
1075055047 10:119211819-119211841 GCTCTGCGTGGGGCAGGCTATGG + Intronic
1075571282 10:123548156-123548178 GATGTTGTTGGGGCTGGTCAGGG - Intergenic
1075583049 10:123636652-123636674 GATGTTGGTGGGGCTGGATGGGG + Intergenic
1076006394 10:126950995-126951017 GATGTTGGTGGGGGTGGTGAAGG + Intronic
1076149335 10:128150021-128150043 GCTGCAGGTGGGGCGGGCTGGGG - Intergenic
1076445712 10:130512465-130512487 GCTGTTGTTGGGACTGGAGAAGG + Intergenic
1077092630 11:786659-786681 CCTGCTGGTGGGCCTGGCCACGG - Intergenic
1077309114 11:1880735-1880757 GCCCTTGGTGGGGGTGGCCAAGG - Intronic
1077549296 11:3192969-3192991 ACTGCAGGTGGGGCTGGCTCCGG + Intergenic
1081261663 11:40969543-40969565 GCTGAAGGTTGGGGTGGCTAAGG - Intronic
1081380051 11:42403840-42403862 GCATTTGGTGGGGCTGGGAAGGG - Intergenic
1081546244 11:44073892-44073914 GCTGTTCGGGGAGCTGGCTGGGG + Intronic
1081778503 11:45693727-45693749 GCGGATGGTGGTGCTGGCTTGGG - Intergenic
1083039836 11:59675174-59675196 GCTGAAGGTTGGGGTGGCTATGG + Intergenic
1083640044 11:64140497-64140519 GCCCTTGGTGGGGCTGGGAACGG - Intronic
1083708040 11:64530065-64530087 GCTGTGGGCTGGGCTGGCTAAGG - Intergenic
1083756798 11:64796296-64796318 GCGGTTGGTGGGGATGGAGAGGG + Exonic
1083801262 11:65047773-65047795 CCTGTTGTTGGGGCTGGGGAGGG - Intronic
1084847899 11:71915068-71915090 GCTGAAGGTTGGGCTGGCTGTGG - Intronic
1085051242 11:73381389-73381411 GCTGGTGGTGTGGGTGGCCAAGG - Intronic
1085310198 11:75511711-75511733 GCTATTGGTGGTGGTGGCTGAGG - Intronic
1085348233 11:75781693-75781715 GCGGTAGTTGGGGCTGGATAAGG + Intronic
1087212570 11:95458704-95458726 GCTGTTGGTGTGCCTGGGTCTGG - Intergenic
1087962187 11:104366052-104366074 GATGTGGGTGGGGCTAGATAAGG - Intergenic
1088888534 11:114026702-114026724 GGTGTTGGTGTGGCTGGATGAGG - Intergenic
1089191904 11:116659752-116659774 GGTGGTGCTGGGGCAGGCTATGG - Intergenic
1089491652 11:118887762-118887784 GCTGTGAGTGGGGCTGGCCAGGG - Intronic
1089593699 11:119561216-119561238 GAGGTAGGTGGGGCTGGCTGGGG - Intergenic
1089846306 11:121461240-121461262 GCTGTTGGTGGTGGTGGTGATGG + Intronic
1090204330 11:124876318-124876340 GCTGGCGGTGCGGCTGGCGAGGG + Exonic
1090407877 11:126488216-126488238 GGTGTTGGTGGGGATGGCTTTGG + Intronic
1092241712 12:6839886-6839908 GCTGGAGGTGGGGGTGGCTCTGG + Intergenic
1095964615 12:47858531-47858553 GGTGGTGGTGGGGCTCTCTATGG - Intronic
1096589721 12:52649545-52649567 GCTGTTGGTTGTGCTGACAAAGG - Intronic
1097184939 12:57191489-57191511 GCTGTTGGTGTCGTTGGCCACGG - Exonic
1097303470 12:58043252-58043274 GGTGGTGGTGGGGGTGGCTGTGG + Intergenic
1097550366 12:61060652-61060674 GCTGAAGGTTGGGGTGGCTATGG - Intergenic
1098100241 12:67007685-67007707 GATGTTGGTGGGGATGGCATTGG - Intergenic
1101399477 12:104375198-104375220 GATGTGGGTGGGGCTGGCCTGGG + Intergenic
1101421266 12:104553238-104553260 GGTGGTGGTGGGGATGGTTATGG + Intronic
1101685263 12:107013238-107013260 GCTGATGGTTGTGGTGGCTATGG - Intronic
1101968760 12:109298134-109298156 GCTGGTGGTGGGGATGGCGATGG - Intronic
1102049983 12:109855419-109855441 GCTGTGAATGGGGCTGGCCAAGG + Intronic
1103011802 12:117463764-117463786 GCTGTAGGTGGGGATGGGAATGG + Exonic
1103706569 12:122877712-122877734 GGCGTTGGTGGGGCTGGGGAAGG - Intronic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104633799 12:130425438-130425460 GCTGTTGGTGGGGCCGGGGATGG - Intronic
1104856581 12:131905043-131905065 GCTGTGGGTGGGGTGGGCTGAGG + Intronic
1105041874 12:132967176-132967198 GCTGTGGGTGGGCCTGGAAAAGG - Intergenic
1105724021 13:23142804-23142826 GATGTGGGTGGGGCCGGATAAGG + Intergenic
1106712331 13:32351096-32351118 GCGGCTGCTGGGGCTGGCTCAGG - Intronic
1106719534 13:32424397-32424419 GCTGTTGGTGGTGAAGGCTGGGG - Intronic
1107711546 13:43155099-43155121 GGTTTTGGTGGTGCTTGCTATGG - Intergenic
1107776666 13:43851457-43851479 GCTGGTGGTGGTGTTGGCTCAGG - Intronic
1108624119 13:52210821-52210843 TCTGTTGGTGGTGGTGGGTAGGG - Intergenic
1110735646 13:78933332-78933354 GCTGAAGGTTGGGATGGCTATGG - Intergenic
1110854066 13:80278092-80278114 GATGTGGGTGGGGCCGGATAAGG - Intergenic
1113400237 13:109985809-109985831 GCTGTGAGTGGGGGTGGCTATGG - Intergenic
1114655944 14:24315723-24315745 GCTGTCAGTGGCGCTGGCTGTGG + Exonic
1114711168 14:24779814-24779836 GATGATGGTAGGGCTGGCTTAGG - Intergenic
1114756836 14:25269334-25269356 TCCTTTGGTGGGGCTTGCTATGG + Intergenic
1115519756 14:34221533-34221555 GCTGTTGGTGGTGCTGGAGATGG + Intronic
1119858768 14:77921764-77921786 GCTGCTGGTGGGGTTGGGAAGGG - Intronic
1119978133 14:79048705-79048727 GCTGAAGGTTGGGGTGGCTATGG + Intronic
1120002349 14:79316938-79316960 AGTGTTGGTGGGGCTGGACACGG + Intronic
1120499187 14:85273179-85273201 GCTGCTGGTGGGGCTGCGTATGG - Intergenic
1121115383 14:91339358-91339380 GCTGCTGGTGGGGCTGGGAGTGG + Exonic
1121315949 14:92961119-92961141 TCTGTTGGTGGGGCTTTCCAAGG + Intronic
1121588289 14:95079020-95079042 GCTGAGGGTGGGGCTGGGTGTGG + Intergenic
1122735602 14:103838641-103838663 TCTGATGGTGGAGTTGGCTAAGG + Intronic
1123050048 14:105537006-105537028 CCTGTCGGTGTGGCTGGCTTCGG - Intergenic
1123439651 15:20281261-20281283 GCTGTTCGAGGGGCTGCCTGGGG + Intergenic
1124121607 15:26893550-26893572 GCAGCTGGTCGGGCTGCCTAGGG + Intronic
1125368299 15:38942740-38942762 GTTGTTGGTGGTGATGGCAATGG + Intergenic
1125722862 15:41853467-41853489 GCTGTTGTCAGGGCTGGCTGGGG + Intronic
1125928750 15:43584577-43584599 GCTGTGGGTGGGGCTGGGGATGG + Intronic
1125929894 15:43593157-43593179 CCTGTTGGTGGTGCTGGGTGTGG - Exonic
1125941916 15:43684412-43684434 GCTGTGGGTGGGGCTGGGGATGG + Intergenic
1125943062 15:43692989-43693011 CCTGTTGGTGGTGCTGGGTGTGG - Intronic
1126793084 15:52238586-52238608 TCAGTTGGTGGGGAGGGCTATGG - Intronic
1126836497 15:52671860-52671882 GCAGCTAGTGGGGCTGGATATGG + Intronic
1128707993 15:69851444-69851466 GCAGTTGGAGGGGCTGGGTTTGG - Intergenic
1129413837 15:75363968-75363990 GCAGCTGGTTGGGCTGGCTGGGG - Intronic
1131120947 15:89823099-89823121 GCTGCTGCTGGGGCTGGGGAGGG + Intergenic
1131176115 15:90210806-90210828 GCTGAACGTGGGGCTGGCTGAGG + Intronic
1131350977 15:91699380-91699402 GTTGTAGCTGGGGTTGGCTATGG + Intergenic
1132321912 15:100931629-100931651 TCTGCTGGTGGGGCTGGCGCGGG + Intronic
1133128886 16:3664243-3664265 GCGGTGGGTGGGGCGGGCTCCGG - Exonic
1133598700 16:7318206-7318228 GGTGTTGGTGGTGATGGCCATGG + Intronic
1134866193 16:17609353-17609375 GCTGTTGATGGGGCCCGCTTCGG + Intergenic
1135186540 16:20320617-20320639 GCAGTAGGTGGGACTGGCAAAGG + Intronic
1135221017 16:20614002-20614024 GCTGTTTGAGAGGCTGGCTGAGG + Intronic
1135338901 16:21629776-21629798 GCTGTGGGTGGGGCCAGATAAGG - Intronic
1135340000 16:21637163-21637185 GATGTTGGTGGGGCCAGATAAGG - Intronic
1135470102 16:22722590-22722612 GATGTGGGTGGGGCTAGATAAGG - Intergenic
1136611567 16:31369526-31369548 GCTGGAGGTTGGGGTGGCTATGG - Intronic
1136845516 16:33573136-33573158 GCTGTTTGAGGGGCTGCCTGGGG - Intergenic
1142153441 16:88522698-88522720 ACTGCTGGTGGGGCCGGCCAGGG + Intronic
1203107224 16_KI270728v1_random:1421789-1421811 GCTGTTTGAGGGGCTGCCTGGGG - Intergenic
1142495502 17:304522-304544 GTTGTTGGTGGGGGTGGCCTGGG - Intronic
1142716663 17:1750805-1750827 GCTGTGGGTGAGGCTGGCCCGGG + Intronic
1143111995 17:4558149-4558171 GCTGGTGCTGGGCCTGGGTAGGG + Exonic
1143479566 17:7220555-7220577 GCTCTGGTTGGGTCTGGCTAAGG - Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1144960013 17:19039607-19039629 CCTGCTGATGGGGCTGGCTCTGG + Intronic
1144975147 17:19134917-19134939 CCTGCTGATGGGGCTGGCTCTGG - Intronic
1145796890 17:27660716-27660738 GATGGTGGTGTGGCTGGGTAAGG + Intergenic
1146412497 17:32599010-32599032 GCTGATGGCGGGGGTGGCTGTGG + Intronic
1149311536 17:55399036-55399058 GCAGTTTGTGGGGCAGGGTATGG - Intronic
1149397543 17:56260407-56260429 GGTGGTGGTGGGGCGGGGTAGGG + Intronic
1150311183 17:64130294-64130316 GATGTGGGAGGGGCTGGCTCGGG + Intronic
1150759099 17:67944328-67944350 GGTGGTGGTGGTGCTGGCTGTGG - Exonic
1151358384 17:73573615-73573637 GCTGGTGGTGGTGCTGCCCAGGG - Intronic
1151371443 17:73648650-73648672 GCTGTAGGTGGGGCTGGGCCAGG + Intergenic
1151853874 17:76708391-76708413 GCTGTTGGTGGGGTTCGCTTAGG + Intronic
1152531689 17:80922782-80922804 CTTGTTGGTGGGGCTGGCGGGGG - Exonic
1152587524 17:81195686-81195708 GCGGTGGGTGGGGCTGTCTGGGG - Intronic
1152644862 17:81464059-81464081 GCTGTGGGTGGGGCGGGCCGGGG - Exonic
1153820417 18:8826995-8827017 GATGCTGGTGGTGATGGCTATGG + Intronic
1153992172 18:10410319-10410341 GCTCATAGTGGGGCTGGCCAGGG - Intergenic
1155265981 18:24093901-24093923 GCTGAAGGTGGGGGTGGCTGTGG + Intronic
1156896849 18:42256249-42256271 GCTGGTGGTGGTGATGGCTTGGG + Intergenic
1159346653 18:67215322-67215344 GATGTTGGTGGGGCCAGATAAGG - Intergenic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1161146824 19:2683870-2683892 GCTCCTGCAGGGGCTGGCTAGGG + Intronic
1161329961 19:3682017-3682039 GCTATTGGTGGGGGTGGTGACGG - Intronic
1161587703 19:5114460-5114482 CCTGTTGGTGGGGAGGGCTCAGG - Intronic
1161687052 19:5708092-5708114 GCTGTTGGTGGCATTGGCTGGGG - Intronic
1161768918 19:6221036-6221058 GGAGGTGGTGGGGCTGGCTGGGG - Intronic
1163115261 19:15185218-15185240 GGTGTTGGTGGGGCTGCAGAGGG + Intronic
1163469153 19:17486824-17486846 GCTGTGGCTGGGCCTGGCCAAGG + Exonic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1164490073 19:28702205-28702227 GCTGAAGGTTGGGCTGGCTGTGG + Intergenic
1164638347 19:29807564-29807586 GCTGGCAGTGGAGCTGGCTAAGG - Intergenic
1165925003 19:39321097-39321119 GCTGGGGGTGGGGCTGGGGAAGG - Intergenic
1166925052 19:46261371-46261393 GCTGTGGATGGGGCTGGCCCGGG + Intergenic
925100844 2:1244034-1244056 GGTGGTGGTGGGGGTGGCTGGGG + Intronic
925915271 2:8600195-8600217 GCTGATGCTGGGCCTGGCTGTGG - Intergenic
927398855 2:22687396-22687418 GCTGTGGGTCAGACTGGCTATGG + Intergenic
927719037 2:25371579-25371601 GCAGTGGTTGGGGCTGGCTGTGG + Intergenic
929756687 2:44771820-44771842 GTTTTTGGTGGGGGTGGGTAGGG - Intronic
929887212 2:45889559-45889581 GCTGTTGGTGGGGTGGGGTGGGG + Intronic
932086810 2:68769789-68769811 GATGTAGGTGGGGGTGGGTAGGG + Intronic
932411536 2:71550638-71550660 GCTGGGGGTGGGGCTGGGGAGGG + Intronic
932701055 2:73991876-73991898 GGTGTTGGTGGGACTGGGGAAGG + Intronic
935594706 2:104869637-104869659 GCTGGTGGTGGTGCTGGCTCTGG - Intergenic
936083260 2:109449434-109449456 CGTGTTGGTGGGGCTGGATGTGG - Exonic
936922644 2:117704926-117704948 CGTGTTGCTGGGGCTGGCTGGGG + Intergenic
937089760 2:119198390-119198412 GGCCTTGGTGGGGCTGGCTAGGG - Intergenic
937426278 2:121801597-121801619 GGTGTTGGTGGGGCTGAGTGGGG + Intergenic
937839417 2:126510883-126510905 GTTGGTGGTGGGCGTGGCTATGG - Intergenic
938053435 2:128195800-128195822 TCTGCTGCTGGGGCTGGCTTCGG + Intergenic
938424129 2:131170415-131170437 GCTGAAGGTTGGGGTGGCTATGG - Intronic
938727250 2:134119960-134119982 GAAGTTGGTGAGGTTGGCTAGGG + Intergenic
941476470 2:165956617-165956639 GATGTGGGTGGGGCCGGATAAGG - Intergenic
942391743 2:175502388-175502410 GCTGCTGGTGGTGGTGGCCATGG - Intergenic
944237180 2:197451122-197451144 GCTGTGGGTGGGGTCCGCTAAGG + Intergenic
944502766 2:200378935-200378957 GCTGTTAGCGGGGCTGGGGATGG - Intronic
944666977 2:201966995-201967017 GCTGTTGTTGGGGGTGGGGAGGG - Intergenic
944869909 2:203899537-203899559 CCTGTTGGTGGGGCAGGGGAGGG + Intergenic
945334043 2:208570736-208570758 GCTGTTGGTGGTAGTGGGTAGGG + Intronic
945436180 2:209820545-209820567 GCTGTTAGTGGAGCTGGAGATGG + Exonic
946374136 2:219297983-219298005 GCTGCTGGTGGCTCTGGCTGTGG - Exonic
946625781 2:221611000-221611022 GCTGCTGGTGGGGTTTCCTACGG + Intergenic
946800866 2:223414829-223414851 GTTGTTCTTGGGGCAGGCTATGG - Intergenic
947716237 2:232340269-232340291 GCTGTTGCTGCTGCTGGCTTTGG - Intronic
948061185 2:235044352-235044374 GCTGACGGTGGGGCTGCCTGCGG - Intronic
948304318 2:236935447-236935469 GAGGTTTGGGGGGCTGGCTAAGG + Intergenic
948768016 2:240233414-240233436 GCCGTGGGTGGGGCTGGAGAGGG - Intergenic
948768072 2:240233580-240233602 GCTGTGGGTGGGGCTGGAGGGGG - Intergenic
948794552 2:240395588-240395610 GCAGTAGGTGGGGCTGGTAACGG - Intergenic
948840212 2:240645061-240645083 GCTGTGGGTGGGACTGGGGATGG + Intergenic
1170788284 20:19486623-19486645 GCTGTTGATGGAGCTGTGTATGG - Intronic
1170837261 20:19895052-19895074 GCTGATGGTGGGGAGGGGTAAGG - Intronic
1170838475 20:19904866-19904888 GCTGATGGGGAGGCTGGCTCTGG - Intronic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1172113548 20:32561188-32561210 GCTGCTGGTGGGGTTGGCTGCGG - Intronic
1172782575 20:37445926-37445948 CCTGTGGGTGGTGCTGGCTTTGG + Intergenic
1172947507 20:38700752-38700774 GCAGATGGTGGGGCTGCCCAAGG - Intergenic
1174744570 20:53048637-53048659 GCTGCTGGTGGGGCTCTCTATGG - Intronic
1175716113 20:61254595-61254617 GCTGTGTGTGGGGCTGGGGAAGG + Intronic
1175904841 20:62374712-62374734 GCTCTTGGAGGGGCTGCCCAGGG + Intergenic
1175927974 20:62480214-62480236 GGTGTTGGGGGGGCTGGCATTGG + Intergenic
1176020226 20:62958955-62958977 GATGCTGGAGGGGCTGGCTCTGG - Intronic
1176075103 20:63244784-63244806 GCTGTTGGTGTTTCTGGCTGCGG - Intronic
1176120425 20:63452033-63452055 GCAGTTGGTGGGGCTGACCTTGG - Intronic
1176136008 20:63522303-63522325 GCTGTTGCTGGGGCTGATAAGGG + Intergenic
1176159067 20:63639430-63639452 GCTGTGGGTGGGGCTGGCGGGGG - Intergenic
1178140656 21:29679795-29679817 GGTGTTGGTGAGGCAGGTTACGG - Intronic
1178545525 21:33490395-33490417 GCAGCTGGTGGGGCTGGGTGCGG - Intronic
1179016817 21:37600977-37600999 ACTGTTTGTGGGGCTGGAGATGG - Intergenic
1180156255 21:45978501-45978523 GCTGTGGGTGGGGCAGGTTGTGG + Intergenic
1180717367 22:17880988-17881010 GATGTGGGTGGGACTGACTAGGG + Intronic
1180901227 22:19374783-19374805 GCTGATGGTGGCACAGGCTAGGG + Intronic
1181035058 22:20165835-20165857 GCTCTCGGTGAGGCTGGCTGTGG - Intergenic
1181051874 22:20241765-20241787 GCTGCAGGTGAGGCTGGGTAGGG + Exonic
1181120393 22:20664137-20664159 GCTGGTGGTGAAGCTGGCCAGGG + Intergenic
1181432148 22:22888131-22888153 GCTGCTGCTGGGTCTGGCCATGG + Exonic
1181508760 22:23379524-23379546 GCTCTGGGTGAGGCTGGCTAGGG + Intergenic
1181992943 22:26851340-26851362 CTGGTTGGTGGGGCTGGCCAGGG + Intergenic
1182356953 22:29726472-29726494 GCTGTTGCTTGGGCTGGCCCAGG - Intronic
1182999427 22:34842930-34842952 CCTGTTAGTGGGGCTGCCTCAGG + Intergenic
1183487482 22:38097326-38097348 GCTGATGATGGGGCAGGCTCAGG - Intronic
1183582836 22:38735885-38735907 GCTGTGGGAGGGGCAAGCTACGG - Exonic
1184696159 22:46140178-46140200 GCTGTTTGCGGGGCTGCCTGGGG + Intergenic
1185029107 22:48432335-48432357 GCTGGTGTTGGAGCTGGGTACGG + Intergenic
1185097094 22:48815755-48815777 GCTGAAGGTGGGGGTGGCTGTGG - Intronic
949769871 3:7568102-7568124 GCTGGTGGCAGGGCTAGCTAAGG + Intronic
949852661 3:8434518-8434540 GCTGTAGGTGGCACTGGCTAAGG + Intergenic
950577106 3:13838560-13838582 GCTGCTGTTGGGGCTGGCTCAGG + Intronic
952253635 3:31677403-31677425 GCTGTGGGTGGGCCTGGGCATGG - Intronic
954089193 3:48271346-48271368 GATGTGGGTGGGGCCGGATAAGG - Intronic
954273858 3:49529827-49529849 GCTGTTGGTGGAGGTTTCTATGG + Intronic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954431182 3:50471631-50471653 GATGTTGGTGGTGCCGGCTGAGG + Intronic
954531855 3:51327970-51327992 GCTGGTGATGGGGCTGGGTGTGG - Intronic
954706917 3:52485811-52485833 GCTGTTGGTGGTGCAAGGTAAGG + Exonic
956204202 3:66738969-66738991 GGTGTTGGTGAGGCAGGTTATGG - Intergenic
956756719 3:72395373-72395395 GCTGTAGGGAGGGCTGGATAGGG - Intronic
957416315 3:79909834-79909856 GCTGGTGGTGCTGCTGCCTATGG + Intergenic
957573033 3:81972787-81972809 GCTGAAGGCTGGGCTGGCTATGG - Intergenic
957919562 3:86731131-86731153 GATGTTGGTGGGGCCAGATAAGG - Intergenic
961406257 3:126681846-126681868 GTTGTTGGTGTGGCTGACCAAGG - Intergenic
961449152 3:126994723-126994745 CCTGTGTGTGGGGCTGGCTGTGG + Intronic
961479511 3:127171029-127171051 GCAGTTAGTGTGGCTGGCCATGG + Intergenic
961509463 3:127392084-127392106 CCTGTTTCTGGGGCTGGCCAAGG + Intergenic
962357316 3:134705789-134705811 GCTGTTGGTGGGACAAGCTCAGG + Intronic
965898200 3:173604848-173604870 CCTGTTGGTGGGGCTGCATATGG - Exonic
965978163 3:174651978-174652000 TCTGTTGGCTGGGCTGGTTATGG - Intronic
966259479 3:177957837-177957859 GCTGTTGGTGGGGGTTGAAAAGG + Intergenic
966289962 3:178343776-178343798 GCTGTAGGTGGTGTTGGCTTCGG - Intergenic
966656492 3:182364393-182364415 GCTGTTGGCAGGGCTGGCACTGG + Intergenic
967665041 3:192161177-192161199 GCTGTTGGTGGTGGTGGTTAGGG - Intronic
968953630 4:3707295-3707317 GCTCTGGGTGCTGCTGGCTAGGG + Intergenic
969278377 4:6152388-6152410 GTTGGTGGTGGGGCTGGGTGAGG - Intronic
972974839 4:44621424-44621446 GCAGGTGGAGGGGCTGGCTGTGG + Intergenic
973603996 4:52569069-52569091 GCTGTTGGGGAGGCAGCCTAGGG + Intergenic
973901328 4:55475595-55475617 GCTGAAGGTTGGGGTGGCTACGG - Intronic
975928253 4:79486379-79486401 GTTGTTGGTGGGGCGGGGGAGGG + Intergenic
976207134 4:82633902-82633924 GCGGTTGGGGGTGATGGCTAAGG - Intronic
977163993 4:93672329-93672351 GCTGTTTGTGGGGGTGTCGATGG + Intronic
977584564 4:98760595-98760617 GCTCTTGAAAGGGCTGGCTATGG - Intergenic
980087869 4:128410191-128410213 GCTGTTGATGGGGCATGGTAGGG - Intergenic
980723489 4:136727555-136727577 GCTGATGGTGGTGGTGGCTAAGG - Intergenic
981000544 4:139825018-139825040 GCTGCAGGAGGGGCTGCCTAGGG - Intronic
981793188 4:148563408-148563430 GCTGGTGGCGGTGGTGGCTATGG - Intergenic
981924306 4:150121177-150121199 GCTGAAGGTGGGGGTGGCTATGG + Intronic
982062161 4:151615553-151615575 GCCTTTGGTGGGGATGGCAAGGG + Intronic
983425827 4:167582273-167582295 GCTGTGGGTGGGGCCGGATAAGG + Intergenic
984377602 4:178953350-178953372 GCTGTTGGTGGTGGTGGTAATGG - Intergenic
985066264 4:186125402-186125424 TGTGTTTGTGGGGCTGCCTAGGG - Intronic
985504917 5:273268-273290 GGTGTTGGAGGCGCTGGCCAGGG + Intronic
985844375 5:2333435-2333457 GCTGTGGGTGTGTCTGGCTGTGG - Intergenic
985926657 5:3024677-3024699 GCTGGCGGTGGGGCAGGCTGGGG + Intergenic
986408672 5:7453420-7453442 GCTGAAGGTGGGGGTGGCTGTGG - Intronic
986485674 5:8233953-8233975 GCTGAAGGTTTGGCTGGCTATGG + Intergenic
987544587 5:19296869-19296891 GCTGATGGTTGGGTTGGCTGTGG - Intergenic
988855983 5:35228814-35228836 GCTGCTGGTTGGGCTGACTGTGG - Intronic
991077636 5:62559145-62559167 GCTGTAGGTGTGGGTGGCTGTGG + Intronic
991486782 5:67145344-67145366 GCTGCTGATGGTGCTGGCTGGGG - Exonic
991559332 5:67932947-67932969 GATCTTGGTGGTGCTGGCTCTGG + Intergenic
997589533 5:135064307-135064329 GCTGTTGGTGGGGCAGACATGGG + Intronic
997645385 5:135478107-135478129 TCTGGTTGTGGGGCTGGCTTTGG + Intergenic
997672563 5:135688038-135688060 GCGGTTGCTGGGGCTGGGGAAGG - Intergenic
1001460580 5:171909546-171909568 GCTGATAGTGGGGCAGGCTGAGG + Intronic
1001636800 5:173216177-173216199 GCTGATAGTGGGGCGGGCTGGGG - Intergenic
1002099763 5:176851600-176851622 GCTGGGGGCGGGGCTGGCCATGG + Intronic
1002372907 5:178768986-178769008 GCAGAAGGTGGGGCTGGCTACGG + Intergenic
1002517335 5:179768920-179768942 GCTGTTGTGGGAGCTGGCCACGG - Exonic
1003187372 6:3843950-3843972 GCTGATGGTGGGCCTGGCCTGGG - Intergenic
1003809949 6:9768241-9768263 GATGTTGGTGTGGCAGGCCAGGG + Intronic
1004587351 6:17015590-17015612 GATGTGGGTGGGGCCGGATAAGG - Intergenic
1006098551 6:31671307-31671329 GCTGCTGGTGGGGCAGCCAATGG + Intronic
1006398931 6:33804711-33804733 GCTGTTGCTGGGGCTGGGCGGGG + Intergenic
1007679810 6:43626272-43626294 GCTGCTGGTGGGGCTGGCTGAGG - Exonic
1009746809 6:67826375-67826397 GATGTTGGTGGGGCCAGATAAGG + Intergenic
1009885633 6:69620971-69620993 GCTGATGTTGGGGAGGGCTAGGG - Intergenic
1010135371 6:72545777-72545799 GCTGAAGGTTGGGGTGGCTATGG - Intergenic
1011178476 6:84591474-84591496 GCTGAAGGTTGGGGTGGCTATGG + Intergenic
1011300603 6:85868917-85868939 GCCGCTGGTTGGGCTGCCTACGG - Intergenic
1011520347 6:88197514-88197536 GATGCTGGTGGTGCTGGCCAGGG + Intergenic
1012252409 6:96993346-96993368 GCTGTTGGTTGGGGTGGTAAGGG + Intronic
1013070914 6:106728491-106728513 GCTGTGGGTGGAGATGGCAAGGG - Intergenic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1015820821 6:137258684-137258706 GCTGCTGCTGGGGCTGGCAGTGG + Intergenic
1016815567 6:148299874-148299896 TTTGTTGGTGGGGCGGGTTAGGG - Intronic
1017181002 6:151551791-151551813 GCTGGTGGTGGTTCTGGCTCAGG - Intronic
1017913628 6:158816165-158816187 GCTGGTGGTGGGGATGGGGAGGG + Intronic
1018315512 6:162553018-162553040 GCTGTTGGTGATGCTGTCTCAGG + Intronic
1019159660 6:170061340-170061362 GCTGAAGGTGGGGGTGGCTGTGG - Intergenic
1019551990 7:1607831-1607853 GCCGCTGGTGGTGCTGGCCAGGG + Intergenic
1019727814 7:2612624-2612646 GCTGTGAATGGGGCTAGCTATGG + Exonic
1019921116 7:4163773-4163795 GCTGTGGGTGGGGCCAGCCAGGG + Intronic
1021472104 7:21015269-21015291 GCTGAAGGTTGGGGTGGCTAGGG + Intergenic
1021940894 7:25678222-25678244 GCTGGAGGTGGGGCTGGTTCTGG - Intergenic
1022046266 7:26624845-26624867 TCTGTGGGTGGTGCTGGCTTGGG + Intergenic
1023039041 7:36156160-36156182 GTTGTTGGTGAGGCTGGCGGCGG + Intronic
1023230397 7:38021892-38021914 GCTGGTGGTGGGGCAGGTGAAGG + Intronic
1023356133 7:39369231-39369253 GCTGGAGGTTGGGCTGGCTGTGG - Intronic
1027659700 7:80974755-80974777 GCTGTGGGTGGGGCCTGGTAAGG - Intergenic
1028716483 7:93977168-93977190 GATGTTGGAGGGGCTGGGTACGG + Intronic
1028822577 7:95229605-95229627 TCCTTTGGTGGGGCTTGCTATGG - Intronic
1029135301 7:98366322-98366344 GCTGCTGGTGGTGGTGGCTGGGG + Intronic
1029807262 7:103010331-103010353 GCTGGTGGTGGTGGTGGCTGGGG - Intronic
1030172807 7:106621144-106621166 GCTGAAGGTTGGGGTGGCTATGG + Intergenic
1031734101 7:125334424-125334446 GCTGATGGTGGTGGTGGTTATGG + Intergenic
1031851444 7:126868853-126868875 GCTGAAGGTTGGGGTGGCTATGG + Intronic
1032016622 7:128384130-128384152 GAGGTTGGTGGGGCTGGCACGGG + Intergenic
1033508564 7:142030781-142030803 GCTGGTGGAGGGGCTGCATAGGG + Intronic
1033912099 7:146276635-146276657 CCTGTTGGCAGGGCAGGCTATGG - Intronic
1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036259352 8:7228054-7228076 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036307272 8:7611470-7611492 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036311395 8:7686624-7686646 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036358116 8:8059457-8059479 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036753406 8:11456981-11457003 GATGTAGGTGGGGCTGGGTTAGG + Intronic
1036892833 8:12607489-12607511 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1037986584 8:23294219-23294241 GCTGTGGCTGGGGTTGGCCATGG + Intronic
1038165712 8:25083366-25083388 GCTGTAGGTGCAGCTGGTTATGG + Intergenic
1039428018 8:37502934-37502956 CCTGTTGGTGGGGCTGGCGTTGG - Intergenic
1040372169 8:46787947-46787969 CCAGTTGCTGGGGGTGGCTAGGG + Intergenic
1041647473 8:60268085-60268107 ACTGTTGCTGGGGGTGGCAAGGG - Intronic
1043142693 8:76609461-76609483 AATGTTGGTGGGGATGGCCAGGG + Intergenic
1043488055 8:80718447-80718469 GTTGTTGTTGGGGTTGGCTAGGG + Intronic
1044931864 8:97259302-97259324 GCTGTAGGTGGGGAGGGCAAGGG - Intergenic
1045399945 8:101804008-101804030 GCTGAAGGTTGGGGTGGCTATGG - Intronic
1048293147 8:133195754-133195776 GTGGTTGGTGGGGCTTGCTGTGG - Intronic
1049026519 8:139994448-139994470 GCTGTAGGTTTGGGTGGCTATGG - Intronic
1049080648 8:140440739-140440761 GCCGTGGGAGGGGCTAGCTATGG - Intronic
1049282223 8:141755544-141755566 GCTGTTGCTGGTGAGGGCTATGG - Intergenic
1050745506 9:8871213-8871235 GTTGTTGGTGGGTTTGGCTTAGG - Intronic
1050981032 9:12016219-12016241 GCTGTTGGTGGTGGTGGTGATGG + Intergenic
1051254314 9:15196901-15196923 GCTGAAGGTTGGGGTGGCTATGG - Intronic
1051368745 9:16340365-16340387 GCTGTATTTGGGGCTGGGTAGGG - Intergenic
1051721695 9:20043999-20044021 GCTGATGGTTGGGATGGCTCTGG - Intergenic
1051949119 9:22609431-22609453 GCTGTTGTTGGGGCAGGGTGGGG + Intergenic
1052781450 9:32784572-32784594 GCTGTTGATGGAGCTGGCCACGG - Exonic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1055790560 9:79918857-79918879 CCTGTTGGTGGCGGGGGCTAGGG - Intergenic
1055814031 9:80184846-80184868 GATGTGGGTGGGGCTAGATAAGG - Intergenic
1057143661 9:92744065-92744087 TCTGTTGGATGGACTGGCTAGGG - Intronic
1057830080 9:98399562-98399584 GGGGTTGGTGGGGCTGAGTAGGG - Intronic
1058295862 9:103305543-103305565 GCTTTTGGGGAGGCTGCCTAAGG + Intergenic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060189610 9:121583641-121583663 GCTGTTGGGGGGGATGGGTGGGG + Intronic
1061799933 9:133108286-133108308 GCTGGTGTTGGAGCTGGCTCTGG + Exonic
1061922082 9:133787904-133787926 GCTGTGGGTAGGTCTGGCTGTGG - Intronic
1061926333 9:133807795-133807817 GCCGGTGGTGGGGCAGGCTGTGG + Intronic
1062318065 9:135978000-135978022 GCTGCTGGTGGGGGGGTCTAGGG - Intergenic
1203786308 EBV:129816-129838 GCTGTGGGTGAGACTGGCAATGG - Intergenic
1185554845 X:1013080-1013102 GCCGTTGGTGGGGCACGCTCAGG + Intergenic
1185672767 X:1825501-1825523 GTTGGAGGTGGGGCTGGCTGAGG - Intergenic
1186846981 X:13540523-13540545 GCTGATGGCGGGTCTGGCTGAGG + Intergenic
1188719009 X:33500123-33500145 TCTTTGGGTGGGGCTTGCTAAGG - Intergenic
1189904945 X:45748623-45748645 GCTCTTGGTGGGGGAGGATAAGG + Intergenic
1191934741 X:66414638-66414660 GTTGTTGCTGGGCTTGGCTAGGG - Intergenic
1193555737 X:82951663-82951685 GCCCTTGGTGGTGGTGGCTATGG - Intergenic
1194561445 X:95427239-95427261 GCTGTGGGTGGGGTTGGGGAGGG - Intergenic
1194940379 X:100002164-100002186 GCTGAAGGTTGGGGTGGCTATGG - Intergenic
1195339023 X:103886834-103886856 GCTGATGGTTGGGGTGGCTGTGG - Intergenic
1196907426 X:120451464-120451486 GTTGTTGTTGGGGGTGGGTAAGG + Intronic
1196971493 X:121114122-121114144 GCTGAAGGTTGGGGTGGCTATGG + Intergenic
1197758278 X:130011182-130011204 GCTGTGGGTGGGAGTGGCCAAGG - Intronic
1199817863 X:151415245-151415267 GTTGATGGTGGGGATGGCTGGGG - Intergenic
1200971605 Y:9158495-9158517 GCTGTTGGAGGGCCTGCATAAGG + Intergenic
1202139413 Y:21705802-21705824 GCTGTTGGAGGGCCTGCATAAGG - Intergenic