ID: 954375304

View in Genome Browser
Species Human (GRCh38)
Location 3:50191403-50191425
Sequence TCCCCGCAACCCTCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954375304_954375308 8 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375308 3:50191434-50191456 CAGCCGGAGTGCAGAGTCAGCGG 0: 1
1: 0
2: 0
3: 12
4: 180
954375304_954375312 20 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375312 3:50191446-50191468 AGAGTCAGCGGTTGAGGGATTGG 0: 1
1: 0
2: 0
3: 11
4: 143
954375304_954375311 15 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375311 3:50191441-50191463 AGTGCAGAGTCAGCGGTTGAGGG 0: 1
1: 0
2: 1
3: 11
4: 131
954375304_954375310 14 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375310 3:50191440-50191462 GAGTGCAGAGTCAGCGGTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 175
954375304_954375307 -8 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375307 3:50191418-50191440 TGCGGGGACAGAAGGACAGCCGG 0: 1
1: 0
2: 2
3: 20
4: 261
954375304_954375314 22 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375314 3:50191448-50191470 AGTCAGCGGTTGAGGGATTGGGG 0: 1
1: 0
2: 1
3: 5
4: 143
954375304_954375313 21 Left 954375304 3:50191403-50191425 CCTCTCCTGGAGGGTTGCGGGGA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 954375313 3:50191447-50191469 GAGTCAGCGGTTGAGGGATTGGG 0: 1
1: 0
2: 0
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954375304 Original CRISPR TCCCCGCAACCCTCCAGGAG AGG (reversed) Intergenic
902412350 1:16218843-16218865 TCCCCTCAACTCTCATGGAGAGG + Intergenic
903662097 1:24984500-24984522 TCCATGCAGCCCTCCAGGAGAGG - Intergenic
907975996 1:59432039-59432061 TCCACCCAATCCACCAGGAGGGG + Intronic
911660501 1:100496520-100496542 TCCCCTGAAACCTCCGGGAGTGG + Intronic
915549534 1:156624334-156624356 TCCCCGCCACCCCCTAGGTGTGG + Exonic
915633749 1:157172261-157172283 TCCCAGCAACCCTGCAGAGGAGG + Intergenic
915637574 1:157197215-157197237 TCCCAGCAACCCTGCAGAGGAGG + Intergenic
915658013 1:157377564-157377586 TCCCAGCAACCCTGCAGAGGAGG + Intergenic
916024804 1:160824102-160824124 TACCCTCAACCCTTGAGGAGAGG - Intronic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
921142373 1:212320642-212320664 TCCCCGCCTCCCTCCCGGATGGG + Intronic
922006563 1:221536802-221536824 TCCACTCAATCCTCCAGGACAGG - Intergenic
923424861 1:233858808-233858830 TCCCCACCAACCTCCAGGAAGGG - Intergenic
1063808788 10:9679870-9679892 TCCTCCCAAAACTCCAGGAGTGG - Intergenic
1064491663 10:15864068-15864090 TCACTGCAACTCTCCAGGAGTGG + Intergenic
1069028610 10:63571365-63571387 TCCCCTAAACCCTCCAGAAGGGG - Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070966646 10:80534599-80534621 TCCCCGCCTCCCTCCCGGACGGG - Intergenic
1070966768 10:80534873-80534895 TCCCCGCCTCCCTCCCGGATGGG - Intergenic
1073350821 10:102818647-102818669 TCCTAGGAACCCTCCAGGAAGGG + Intergenic
1074392769 10:113071844-113071866 TCCCCCCCACCCCCCATGAGTGG + Intronic
1075090122 10:119439487-119439509 TCCCAGTCACCCTCCAGGATTGG + Intronic
1076363367 10:129905704-129905726 TCCCCGCCACCGTCCTGGAGAGG - Intronic
1076991904 11:279909-279931 TCCCCGGGACCCTCCAAGTGGGG - Intronic
1078177193 11:8978882-8978904 CCCCCCCAACCCTCCCGGACGGG - Intergenic
1078930088 11:15905998-15906020 GCCCTGCATCCCTCCAGCAGAGG + Intergenic
1079020763 11:16907495-16907517 TCCCCGCCTCCCTCCCGGACGGG - Intronic
1079368622 11:19831206-19831228 CCCCCGCAACACTCCTGGAATGG - Intronic
1082024930 11:47565186-47565208 TCCCCCCAACCCTCGACCAGAGG - Intronic
1086978504 11:93165983-93166005 TCCCCACAACCTTCCAATAGTGG - Exonic
1089130306 11:116207175-116207197 TCACCACCATCCTCCAGGAGTGG + Intergenic
1091732452 12:2891055-2891077 TCCCCGCAGGGCTCCCGGAGAGG - Intronic
1091737882 12:2938281-2938303 TGACCGTAAGCCTCCAGGAGGGG + Exonic
1092052940 12:5485823-5485845 TCCCCGCATCACTACATGAGTGG + Intronic
1093453357 12:19340348-19340370 TCCCCGCCTCCCTCCTGGACGGG - Intronic
1094503414 12:31039812-31039834 TCCCCGCTTCACTCCATGAGTGG - Intergenic
1097033241 12:56104630-56104652 TCCCCTCGATCCTCGAGGAGAGG - Exonic
1097872114 12:64610446-64610468 TCCCCGCCAGGCTCCAGGCGCGG - Intergenic
1101939324 12:109088352-109088374 CCACCGCCACCCTCCTGGAGGGG + Exonic
1102206667 12:111095650-111095672 TCACTGCAGCCCTCAAGGAGGGG - Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103834682 12:123809280-123809302 TCACTGCAACAGTCCAGGAGAGG - Intronic
1103882267 12:124175319-124175341 TCCCTCCAATCCTGCAGGAGCGG - Intronic
1107499062 13:40955706-40955728 TCCCCGCCTCCCTCCCGGATGGG - Intronic
1107499139 13:40955882-40955904 TCCCCGCCTCCCTCCTGGATGGG - Intronic
1109304454 13:60623296-60623318 TCCTCAGAAACCTCCAGGAGAGG + Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1115628610 14:35220587-35220609 TGCTCCCAACCCTCCTGGAGGGG - Intronic
1119825978 14:77657332-77657354 TCCCCCACACCCACCAGGAGAGG + Intergenic
1121521644 14:94590168-94590190 CCCCCACCACCCTGCAGGAGAGG - Exonic
1122003653 14:98684731-98684753 TCCCCACACCCCTCCAGGGCAGG - Intergenic
1124364904 15:29064465-29064487 TCCCCGCCCCCATCCAGGTGTGG + Intronic
1124405630 15:29389374-29389396 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1124405708 15:29389865-29389887 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1126195241 15:45923673-45923695 TCACCGCACCCGGCCAGGAGTGG + Intergenic
1128737631 15:70062200-70062222 TCCCCACAGCCGTGCAGGAGCGG + Intronic
1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG + Intergenic
1129467342 15:75731497-75731519 TCCCTGCATTCCCCCAGGAGAGG + Intergenic
1129677830 15:77642016-77642038 TTCCCACAACCCTCCAAGATAGG - Intronic
1129719865 15:77872114-77872136 TCCCTGCATTCCCCCAGGAGAGG - Intergenic
1130878215 15:88032454-88032476 TCCACCCAAGCCTCCATGAGGGG - Intronic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132517851 16:374189-374211 ACCCCACATCCCTGCAGGAGGGG + Intronic
1132684491 16:1156626-1156648 GCCCCGCATCCCTCCTGAAGAGG + Intronic
1132984299 16:2756317-2756339 TCCCCGCTCCCCCTCAGGAGCGG + Exonic
1133557119 16:6916122-6916144 TGAAGGCAACCCTCCAGGAGAGG + Intronic
1137569060 16:49552859-49552881 GGCCCCCACCCCTCCAGGAGGGG + Intronic
1137954931 16:52819679-52819701 TCCCACCTTCCCTCCAGGAGAGG - Intergenic
1138214586 16:55191940-55191962 TCCCTCCCACCCTCCAGGAGAGG - Intergenic
1142189494 16:88711345-88711367 TCCCAACAACGCCCCAGGAGAGG - Intronic
1142753279 17:2000897-2000919 TCCCACCATCCCTCCAAGAGGGG - Intronic
1143610236 17:8013863-8013885 TCCCCTCATGCCTCCAGAAGTGG + Exonic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1144735497 17:17553228-17553250 CCCACCCCACCCTCCAGGAGGGG + Intronic
1146437105 17:32860372-32860394 ACCACACACCCCTCCAGGAGAGG + Intronic
1146848996 17:36205786-36205808 TCTCCCCAACACTCTAGGAGAGG + Intronic
1146883998 17:36458958-36458980 TCACCACAACCCTGAAGGAGGGG + Intergenic
1148430800 17:47641968-47641990 TCCCAGCAACCCTCCAAAATAGG - Intergenic
1149379669 17:56080980-56081002 GCCCCTCAACCCTGCAGAAGCGG - Intergenic
1149569584 17:57663075-57663097 TCCCAGCGACCTTCCAGAAGCGG - Intronic
1149849728 17:60027341-60027363 CCCCCGCATCTCTCCAGGATGGG + Intergenic
1149860440 17:60119183-60119205 CCCCCGCATCTCTCCAGGATGGG - Intergenic
1152287393 17:79421013-79421035 GCCCCTCAACCCACCAGGGGAGG - Intronic
1152535329 17:80947548-80947570 TCCCTGGAACCCTCAAGGATGGG - Intronic
1152926811 17:83091116-83091138 TCCCAGCAACCCTCCAGAATGGG - Intronic
1153757459 18:8298784-8298806 TCCCAGCACCCATCCAGCAGTGG - Intronic
1157843323 18:50979607-50979629 TCCCAGCCACACTCAAGGAGAGG + Intronic
1158509539 18:58078428-58078450 TCCCTGCCACCCTGCAGGACAGG - Intronic
1160681172 19:412295-412317 TCGCTGCAGCCCTCCAGGATGGG + Intergenic
1162921674 19:13906617-13906639 TCCCCGCCTCCCCCCAGGTGAGG + Intronic
1163807707 19:19409995-19410017 TCCACGAAACCCTCTAGGTGTGG + Intronic
1164214754 19:23134582-23134604 CCCCCCCCACCCTCCAGGACGGG - Intronic
1165067170 19:33235995-33236017 TGCCCGCTCCCCTCCAGCAGTGG - Intergenic
1166307128 19:41941162-41941184 TCCCCGAACACCCCCAGGAGAGG + Intergenic
1166318667 19:42003230-42003252 TCCCCACCACCCTCCAGGTATGG + Intronic
1166425724 19:42676477-42676499 TCCCCGCCTCCCTCCCGGATAGG + Intronic
1166453250 19:42919020-42919042 TCCCCGCAAGCACACAGGAGAGG + Intronic
1166455737 19:42938328-42938350 TCCCCGCAAGCACACAGGAGAGG + Intronic
1166531428 19:43545787-43545809 TCCCCCCATCCCTCCTGAAGTGG - Intronic
1168523618 19:57071596-57071618 GCCCCGCATCCCTCCAGCATTGG + Intergenic
926273914 2:11388975-11388997 TCCCCACCACCCTCCAGGATGGG - Intergenic
929650769 2:43677885-43677907 TCCCCACCTCCCTCCAGGACGGG + Intronic
929689529 2:44062881-44062903 TCCCGTCCCCCCTCCAGGAGGGG + Intergenic
930079123 2:47433104-47433126 TCCCCGCCTCCCTCCCGGATGGG + Intronic
932173355 2:69577509-69577531 TCCCCTCTACCCTCCATGACAGG + Intronic
933778152 2:85784189-85784211 TCACTTCAACCCTCCAGGAAAGG - Intronic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
936055083 2:109256526-109256548 GCCCCTCAAAGCTCCAGGAGTGG - Intronic
942454859 2:176130589-176130611 TCCCCGCCGCCCTCCGGGACTGG + Exonic
943844966 2:192634411-192634433 TCCCCCCCATCCTCCAGCAGTGG + Intergenic
944212003 2:197216116-197216138 TCCTCACAAGCCTCCAGAAGAGG - Intronic
946403457 2:219480869-219480891 TCCCCACACCCCTCCATAAGAGG + Intronic
947069740 2:226274973-226274995 GCCCCCCCACCCGCCAGGAGAGG + Intergenic
947403932 2:229755359-229755381 TGCCCGCCAACCTCCAGGAAAGG - Intergenic
948974295 2:241454069-241454091 TCACCGCACCCGGCCAGGAGTGG + Intronic
1172721151 20:37000703-37000725 TCCCCGCCTCCCTCCCGGACGGG - Intronic
1172721304 20:37001056-37001078 TCCCCGCCTCCCTCCCGGATGGG - Intronic
1172865968 20:38097646-38097668 TCCCCTGAAGCCTCCAGAAGAGG + Intronic
1173864254 20:46304188-46304210 TGCCTGCACCCCTGCAGGAGGGG - Intronic
1175939278 20:62530505-62530527 TCCCCTCAAACCTCCAGGGGGGG + Intergenic
1177807523 21:25888855-25888877 TCCGCGCAAGCCTCAGGGAGTGG - Intronic
1178919721 21:36730675-36730697 CCCCCGAAGCCCTCCAAGAGTGG + Intronic
1178934660 21:36850929-36850951 TCGCCTCACCCCTCCAGCAGGGG - Intronic
1180040555 21:45277184-45277206 GCCACGCAGCCCTCCCGGAGCGG + Intronic
1180699706 22:17774534-17774556 TCCCCGCAAGCCGCCGGGGGCGG - Intronic
1181314849 22:21964411-21964433 CCACCGTCACCCTCCAGGAGGGG - Intronic
1181579088 22:23817081-23817103 TCCCTGCAATCCCCCAGGAAGGG + Intronic
1182678824 22:32062316-32062338 TCCCACCAACCTTCCAGGATAGG + Intronic
1183103490 22:35598425-35598447 TCCCTGCAGCCCTGCAGGTGAGG + Intergenic
1184152092 22:42645172-42645194 TCCCCACAAGTCTCCAGAAGTGG + Intronic
1184511197 22:44934257-44934279 TCACCGCCACGCTCCAGGACAGG - Intronic
950303874 3:11903742-11903764 TGCCATCAACCCTTCAGGAGTGG - Intergenic
950506019 3:13395088-13395110 GGCCATCAACCCTCCAGGAGAGG + Intronic
950519269 3:13486916-13486938 TCCCCTCCACCCTCCAGGCCTGG - Intronic
950538154 3:13593749-13593771 TCCCCACAACCCTGCAGGCTAGG - Intronic
952287180 3:31980724-31980746 TCCCTGCTCCCCTCCAGGTGGGG - Intronic
953055068 3:39381515-39381537 TCCCCACAAACATCCAGGGGAGG + Intergenic
953391539 3:42536496-42536518 CACCTGCAATCCTCCAGGAGAGG - Exonic
953904629 3:46862276-46862298 TCCCAGCAGCCCTGCAAGAGGGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961531724 3:127544231-127544253 GCCCAGCATCCCTCCAGGACTGG - Intergenic
963036123 3:141030527-141030549 TCCCCGCCTCCCTCCCGGACGGG + Intergenic
964450800 3:156810818-156810840 TCCCCTCCATCCTCGAGGAGAGG + Intergenic
967177570 3:186874167-186874189 TCCCCGCCTCCCTCCCGGACGGG - Intergenic
967177668 3:186874421-186874443 TCCCCGCCTCCCTCCTGGATGGG - Intergenic
968767754 4:2482774-2482796 TCCCTGCAAACCTTCAGGGGAGG + Intronic
968924128 4:3538533-3538555 TCCCCGCCTCCCTCCCGGATGGG + Intergenic
968924248 4:3538836-3538858 TCCCCGCCTCCCTCCCGGATGGG + Intergenic
971427024 4:26526058-26526080 TGCCAGCAACCCTCCAAGACAGG + Intergenic
972647697 4:40984631-40984653 CCCCTGGAACCCTCAAGGAGTGG + Intronic
973609833 4:52625224-52625246 TCCCACCAACCCTCCAAGATGGG + Intronic
975608833 4:76183714-76183736 ACCCCCCAACCTCCCAGGAGGGG - Intronic
977693811 4:99946341-99946363 GCCCCGCAGGCCTCCAGGAGGGG + Intronic
978271198 4:106893000-106893022 TCCTCGCACACCTCCAGGACCGG + Intergenic
979459518 4:120965520-120965542 TCCCCACAAACCGCCAGGGGTGG + Intergenic
980920659 4:139083305-139083327 ACGCCGCAACCCTCCAGGTCAGG + Intronic
982275937 4:153637279-153637301 TCCCAGCAACACACCAGGACTGG - Intergenic
982575932 4:157110061-157110083 ACCCCGCAACCTTCAGGGAGGGG - Intronic
985609034 5:876316-876338 TCCCCGTGACCCTCCCAGAGCGG + Intronic
985676542 5:1234421-1234443 TCCCAGCCACACTCCAGAAGCGG + Intronic
986245116 5:6000177-6000199 TCTCAGCCAGCCTCCAGGAGTGG + Intergenic
986389640 5:7272683-7272705 TCCTCTGAAGCCTCCAGGAGAGG - Intergenic
986404825 5:7415507-7415529 TGCTTGCAACCCTCCAGGACTGG + Intronic
991579225 5:68136863-68136885 TCCCCCCACCCCTCCAGTACAGG + Intergenic
998091784 5:139375288-139375310 CCCCTGAAACCCTCCAGCAGAGG + Intronic
999177073 5:149639153-149639175 TCCCCGCATCCCTCCAGTGGAGG + Intergenic
1000987445 5:167876174-167876196 CCCCAGCAAGCCTCCAGCAGTGG + Exonic
1001602020 5:172935091-172935113 CCCCAGCAACCCTCCAGAAAGGG - Intronic
1002660015 5:180785508-180785530 TCCCCAGAACCCTCCAGCAAGGG + Intergenic
1005761063 6:28968827-28968849 TCCCTCCAACCCTCCACGAGAGG + Intergenic
1005940678 6:30557206-30557228 TCTCCGCAACCTTCCGGAAGTGG + Exonic
1007638416 6:43315581-43315603 CCCCCTCTACCCTCCAGGAGAGG - Intronic
1010030273 6:71266094-71266116 TCCCCGCCTCCCTCCCGGATGGG + Intergenic
1017399100 6:154039281-154039303 GCCCCGCACCGCTGCAGGAGGGG - Exonic
1017793528 6:157822737-157822759 ACCCCGCAACACCCCAGGCGTGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018797801 6:167200827-167200849 TCTGGGAAACCCTCCAGGAGGGG + Intergenic
1019519564 7:1454592-1454614 TGGCCGGAACCCTCCAGGACGGG - Intronic
1020921396 7:14269309-14269331 TCCACCCCACACTCCAGGAGAGG + Intronic
1021735798 7:23637778-23637800 TCCCCGCCTCCCTCCCGGACTGG - Intronic
1024992790 7:55249561-55249583 TCTCCACATTCCTCCAGGAGAGG + Intronic
1025821346 7:64967619-64967641 TCCCCGCCTCCCTCCTGGATGGG + Intergenic
1026004711 7:66591816-66591838 TCCCCGGAACGCTCCGGGATGGG - Intergenic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1030975315 7:116114894-116114916 TCCCCGCCACCCCCCAGTAATGG + Intronic
1031987686 7:128173772-128173794 ATCCAGCAACCCTACAGGAGGGG - Intergenic
1032080094 7:128854396-128854418 TCCCCCAAACCCTGCAGGTGAGG + Exonic
1032123376 7:129172987-129173009 TCCCCGGAAGCCTCCAGGGGAGG + Intergenic
1032536907 7:132672106-132672128 TCCCCGCAGCCCTCCCTGTGTGG + Intronic
1034273283 7:149813422-149813444 TCCCCTCCACCCTCAGGGAGGGG + Intergenic
1039581593 8:38671237-38671259 GCTCCGAAAGCCTCCAGGAGAGG - Intergenic
1040785609 8:51159494-51159516 TCCCCGCCTCCCTCCTGGATGGG - Intergenic
1042823000 8:72952395-72952417 ACCCCGCACCCCGCCAGGAGCGG + Intergenic
1047402119 8:124556444-124556466 TCCCCGCAGCCCTCCAGTGGAGG - Intronic
1049048684 8:140173651-140173673 TCCCCACATACCTCCAGTAGGGG + Intronic
1049412564 8:142479778-142479800 TCCCCGCAACGCCACAGGTGAGG + Exonic
1049495255 8:142927520-142927542 TCGCCACAACCCTCCAGGCTGGG + Intergenic
1049639820 8:143710429-143710451 TCCCTGCATCCCTGCAGCAGGGG + Intronic
1051594539 9:18811230-18811252 GCCCCCCAACCCTCATGGAGGGG + Intronic
1056624708 9:88244777-88244799 TCCCCGCCTCCCTCCCGGACGGG + Intergenic
1057304445 9:93904152-93904174 CCCCCGGGAGCCTCCAGGAGAGG - Intergenic
1060108666 9:120891105-120891127 TCTCCCCACCCCTGCAGGAGAGG - Intronic
1061919514 9:133775041-133775063 TACCTGCAAACCTACAGGAGGGG + Exonic
1062213716 9:135378026-135378048 TCCTCGGAAGCTTCCAGGAGGGG - Intergenic
1186374717 X:8987482-8987504 TCCCACCAACCCTGCAGAAGAGG - Intergenic
1192232391 X:69274512-69274534 TCCCCACATCCCTCCACCAGGGG + Intergenic
1192340266 X:70258389-70258411 TCCCTGCAACCCTCAGGGTGAGG + Exonic
1200001703 X:153065482-153065504 ACCCCGGAGTCCTCCAGGAGAGG + Intergenic
1201176731 Y:11314464-11314486 TCCCCTCCACCCTCCCAGAGGGG + Intergenic