ID: 954375977

View in Genome Browser
Species Human (GRCh38)
Location 3:50194326-50194348
Sequence CTCCTCAGGCCGCCCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954375977_954375987 6 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375987 3:50194355-50194377 AGGCGTTCAGCAGGCCCATCTGG 0: 1
1: 0
2: 1
3: 7
4: 79
954375977_954375989 8 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375989 3:50194357-50194379 GCGTTCAGCAGGCCCATCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 106
954375977_954375984 -3 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375984 3:50194346-50194368 GAGGCCCGGAGGCGTTCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 88
954375977_954375990 16 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375990 3:50194365-50194387 CAGGCCCATCTGGGGCAGTGCGG 0: 1
1: 0
2: 2
3: 31
4: 332
954375977_954375991 17 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375991 3:50194366-50194388 AGGCCCATCTGGGGCAGTGCGGG 0: 1
1: 0
2: 1
3: 31
4: 249
954375977_954375988 7 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375988 3:50194356-50194378 GGCGTTCAGCAGGCCCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 200
954375977_954375992 18 Left 954375977 3:50194326-50194348 CCTGTCCCGGGCGGCCTGAGGAG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 954375992 3:50194367-50194389 GGCCCATCTGGGGCAGTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954375977 Original CRISPR CTCCTCAGGCCGCCCGGGAC AGG (reversed) Intronic
900546891 1:3234399-3234421 CTCCCCAGGCTGCCCCGGCCAGG + Intronic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
901862582 1:12084376-12084398 CGTCTCAGGCCTCCTGGGACTGG + Intronic
903062774 1:20681778-20681800 CTCCTCATGCCACCCAGCACTGG + Intronic
904852257 1:33467973-33467995 CTCCTCAAGCCGCACTGGGCAGG - Intergenic
907326210 1:53640201-53640223 CTCCCCAGGCAGCCAGGGTCAGG + Intronic
908544272 1:65148435-65148457 ATCCTCGGGCCGCCCGGCTCGGG + Exonic
913250640 1:116909973-116909995 CTCCTCCAGCCGGCCGGGCCCGG - Intergenic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
1066004463 10:31133971-31133993 CTCCTCAGGCTGCGGGGGAGGGG - Intergenic
1070257380 10:74824720-74824742 CTCCTCTGGCCGCCCAGGCGAGG - Intergenic
1072680045 10:97499422-97499444 CTCCCCCGGCCGCCCGGCGCTGG - Intronic
1072808596 10:98443008-98443030 CTGCTCATGCTGCCCAGGACAGG + Intronic
1074182559 10:111077238-111077260 GTCCTCAGGCGGGCCGGGGCAGG - Exonic
1076156535 10:128210036-128210058 TTCCGCAGGCAGCACGGGACAGG - Intergenic
1077302940 11:1855504-1855526 CCCCTCAGACTGCCCGGGACGGG + Intronic
1079668833 11:23140770-23140792 CTCCTCAGGCCTTACAGGACAGG - Intergenic
1081537498 11:44006163-44006185 CTCCTCTGGCAGCCAGGGCCTGG + Intergenic
1081969096 11:47186123-47186145 TTCCGCAGGCCGCCCGGGGGAGG - Intronic
1083876086 11:65525090-65525112 GTCCTCCGGCCGCCCGAGCCGGG - Exonic
1084300931 11:68251924-68251946 CTCCATAGGCCGCTCGTGACAGG - Intergenic
1084385601 11:68841393-68841415 CTCCTTAATCCGCCCTGGACTGG - Intronic
1085574465 11:77589881-77589903 CTCCTCACGCCCCTCGGGGCGGG - Exonic
1086515237 11:87604197-87604219 CTCATCAGGTCCCCAGGGACAGG - Intergenic
1087774235 11:102243083-102243105 CTGCTCAGGCTGCCCTGGGCAGG - Intergenic
1088890533 11:114040879-114040901 TTCCTCAAGCCGCCGGGGTCAGG - Intergenic
1089330337 11:117685013-117685035 GGCCTCAGGCCTCCTGGGACAGG - Intronic
1090865669 11:130698485-130698507 CTCCTCAGGCCTCCCGCTGCTGG - Intronic
1094473200 12:30822528-30822550 CACCTCCGCCCGCCCGCGACGGG - Intergenic
1094567844 12:31616390-31616412 ATCCTCGGGCCGCCCGGCTCGGG - Intergenic
1096498754 12:52053256-52053278 CTCTTCAGGCTCCTCGGGACTGG + Intronic
1096845710 12:54405308-54405330 CTCCTGAGGCCGCCCGTCAGGGG + Exonic
1099574493 12:84362557-84362579 CTCCTCAGCCTGCTCTGGACTGG + Intergenic
1099792120 12:87349398-87349420 CTCCTCAGGCAGCCAGGGTCAGG - Intergenic
1105239984 13:18599903-18599925 ACCCTCAGGCCGTCTGGGACCGG - Intergenic
1113440234 13:110322914-110322936 CTACTGAGGCCGCCCGAGTCAGG + Intronic
1113914781 13:113863787-113863809 CTCCTCCCGCCGCCCGGGGACGG + Intronic
1114065370 14:19054981-19055003 ACCCTCAGGCCGTCTGGGACCGG - Intergenic
1114096892 14:19345021-19345043 ACCCTCAGGCCGTCTGGGACCGG + Intergenic
1114473887 14:22981295-22981317 TTCCGGAGGCCGCCCGGGCCCGG - Exonic
1118594891 14:67427774-67427796 CTCCTCAGGCCCCCCTGCACTGG + Intergenic
1122877816 14:104677027-104677049 CTCCTCAGGCGGCCCTGGGGCGG - Intergenic
1123474920 15:20582576-20582598 ATCCGCAGGCCTCCCGGGCCAGG - Intergenic
1123643091 15:22417781-22417803 ATCCGCAGGCCTCCCGGGCCAGG + Intergenic
1128781682 15:70362621-70362643 ATCCTGAGGCCTCCCGGAACAGG + Intergenic
1129323490 15:74787518-74787540 CTCAGCAGGCCCCCAGGGACTGG + Intronic
1132222971 15:100118643-100118665 CTCCCCAGGCAGCCTGGGCCAGG + Intronic
1132692478 16:1187781-1187803 CTCCTCAGACCACCAGGGAGGGG - Intronic
1140512209 16:75516830-75516852 CTCCTCAGCCGGGCCGGGCCGGG + Intergenic
1142012373 16:87722321-87722343 CTCCTGAGGGAGCCTGGGACGGG + Intronic
1142385234 16:89759886-89759908 CTCCTCACACTGTCCGGGACTGG + Intronic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1145993582 17:29093264-29093286 CTCCTCAGGCCGCATGGGCAGGG + Intronic
1146251184 17:31345546-31345568 ATCCTCGGGCCGCCCGGCTCGGG + Intronic
1148674707 17:49438673-49438695 CTCCGCAGCCCGCCCGTGCCTGG + Intronic
1149498916 17:57136542-57136564 TTCCTCAGGCCGCCCTGGCCGGG - Intergenic
1149678594 17:58488105-58488127 CTGCTCAGCCCGCCCGGGCCGGG - Exonic
1150217148 17:63477103-63477125 CGCCTCGGGCCGCCGGGGGCCGG + Intergenic
1152157064 17:78641385-78641407 CTCTTGGGGCCGCCCGGGTCTGG + Intergenic
1152729561 17:81962751-81962773 CTCCTCACTCAGCCCGGGGCTGG - Intergenic
1152856668 17:82668538-82668560 CACCTCAGCCCCCTCGGGACTGG - Intronic
1153524426 18:5980882-5980904 CTCCTCAAGCCGCCCTTGCCTGG + Intronic
1154448847 18:14458871-14458893 ACCCTCAGGCCGTCTGGGACCGG + Intergenic
1160731789 19:644577-644599 CTCCTCAGATCCCCCGGGAAGGG + Intergenic
1161272687 19:3398694-3398716 CCCCACAGACAGCCCGGGACAGG + Intronic
1162291838 19:9786065-9786087 CTCCTCAGGCCTCCGAGGCCGGG - Intronic
1162808668 19:13151734-13151756 CTGCTCCGGCTGCCCGGGTCGGG + Intronic
1163462644 19:17448277-17448299 GTCCTCTGGCAGCCCGGGGCCGG + Exonic
1163743997 19:19033954-19033976 CTCCCCACTCCGCGCGGGACAGG - Exonic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166732672 19:45067753-45067775 CTCCTCAGACCCCCCAGGCCAGG - Intronic
1168319394 19:55500212-55500234 CCCCTCAGGCCCCCCGAGAACGG + Exonic
1168719034 19:58544802-58544824 CGCCTCTGGCAGCCCGGGCCCGG + Exonic
925969349 2:9096038-9096060 CCCCTCAGGCCCCTCTGGACGGG - Intergenic
927110178 2:19858932-19858954 CCCGTCAGGCCGCCCAGGCCAGG + Intergenic
934616568 2:95774915-95774937 CTCTGCAGGCCGCCTGGTACAGG + Intergenic
934644324 2:96049644-96049666 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
934690158 2:96352403-96352425 CTCCTCAGGGCCCCCTGGATGGG - Intronic
934837740 2:97605734-97605756 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
935991147 2:108719941-108719963 CTCCTGGGGCCGCCCTGGCCCGG + Intronic
936396591 2:112136642-112136664 CTCCACAGGCTGCCCTGGATCGG + Intergenic
937924066 2:127154178-127154200 CTCTTCAGGCAGCCAGGGTCAGG + Intergenic
938482633 2:131673983-131674005 ACCCTCAGGCCGTCTGGGACAGG - Intergenic
941021086 2:160408060-160408082 CTCCCCGGGCCGCCCGGCCCCGG - Intronic
949020654 2:241739347-241739369 CTCCTGAGCCCACTCGGGACAGG + Intronic
1171392204 20:24808933-24808955 CTCCTCAGGAGGCCCAGGGCAGG + Intergenic
1175227037 20:57450730-57450752 CTCCTCAGGCCACTCTGGGCAGG - Intergenic
1175305672 20:57974024-57974046 CTCCTCAGCCGGCCAGGGTCAGG + Intergenic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1176360798 21:5995314-5995336 CTCCTCAGGGCCCCAGTGACAGG - Intergenic
1176447371 21:6831654-6831676 GCCCTCAGGCCGTCTGGGACCGG - Intergenic
1176825539 21:13696680-13696702 GCCCTCAGGCCGTCTGGGACCGG - Intergenic
1178496267 21:33089040-33089062 CTCCTCAGGCCACCTGTGGCGGG + Intergenic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1179673233 21:42964277-42964299 CTGCACAGGCCCCCCGGGCCTGG - Intergenic
1179762720 21:43543236-43543258 CTCCTCAGGGCCCCAGTGACAGG + Intronic
1180483860 22:15777601-15777623 ACCCTCAGGCCGTCTGGGACCGG - Intergenic
1181049878 22:20233438-20233460 CTGCCCAGGACGCCCTGGACAGG - Intergenic
1182296050 22:29311687-29311709 CTCCTGGGGCCCCCCGGGGCCGG - Intronic
1184036213 22:41919573-41919595 CTCCTGAGGTCGCCAGGGAGCGG + Intergenic
1184516895 22:44967804-44967826 CTCCCCAGGCTGCCCTGGGCTGG + Intronic
1184943512 22:47785042-47785064 CTCCTCAGGAAGCCCTGGAATGG - Intergenic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1185322173 22:50206650-50206672 CTTCTGAGGCTGCCAGGGACAGG - Intronic
951543517 3:23805722-23805744 CTCCTCCGGACGCCCGGGAAGGG - Intergenic
953022152 3:39121486-39121508 CTTCTCAGGCTGCCCAGGCCGGG + Intronic
953801094 3:46023153-46023175 CTCCTCAGGCCCCGCGCCACGGG - Intronic
954149091 3:48648356-48648378 CTCCCCAGGCAGCGCGGGACTGG - Exonic
954367439 3:50154191-50154213 CTCCGCAGGGTGCCCGGGGCAGG + Intergenic
954375977 3:50194326-50194348 CTCCTCAGGCCGCCCGGGACAGG - Intronic
954802371 3:53194626-53194648 CACCTCAAGCAGCCCAGGACAGG + Intergenic
955276951 3:57555947-57555969 CTCCTCCCTGCGCCCGGGACTGG - Intergenic
955404488 3:58617394-58617416 CTCCTCAGGAAGCTCAGGACGGG - Intronic
956393589 3:68800666-68800688 CTTCTCAGCTCGCCAGGGACTGG + Intronic
960938555 3:122918709-122918731 CCCCTCAGGCTGCCAGGGAAGGG - Intronic
962403759 3:135083019-135083041 CTCCTCAGGCAGCCAGGCAGAGG + Intronic
967912080 3:194550792-194550814 TTCCTCAGGGAGCCCAGGACTGG + Intergenic
968466164 4:752528-752550 ATCCTGAGGCCTCCGGGGACCGG + Intronic
968728109 4:2257548-2257570 CTTCCCAGGCGGCCAGGGACTGG + Intronic
968874066 4:3256009-3256031 CTGCTCAGGCCACCCAGGGCAGG + Exonic
968878668 4:3287561-3287583 TTCCTCGGGCCGCCAGGGCCAGG - Intergenic
969413604 4:7044706-7044728 CTCCTCAGGGTGCCCGGGGATGG - Intronic
972407654 4:38762177-38762199 CTCCTAAGGCCGCCTGGGAGAGG - Intergenic
985588993 5:755197-755219 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985603673 5:847713-847735 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985713894 5:1445343-1445365 CTCACCTGGCCGCCCGGGCCTGG + Exonic
986706305 5:10457301-10457323 CCCATCAGGCCGCTGGGGACAGG + Intronic
990347360 5:54883850-54883872 CTCCACCGGCCGCCCGGCTCAGG + Intergenic
992550169 5:77852074-77852096 CTCCTCCCGCGGCCCGGGGCGGG - Intronic
996862730 5:128083978-128084000 CTCCTCCGGCGCCCCGGGACTGG + Exonic
1001070239 5:168579390-168579412 CCCCTCAGGCCGGGCGGGGCCGG + Exonic
1002082248 5:176744023-176744045 CTGCCCCGGCCCCCCGGGACGGG - Intergenic
1002093571 5:176818120-176818142 CTTCTCAGGGGGCCCGGGAAGGG - Intronic
1002487668 5:179550702-179550724 CTCCGCAGGTCGCCTGGGCCGGG - Exonic
1002813421 6:656665-656687 CGCTTCTCGCCGCCCGGGACAGG + Exonic
1004815929 6:19311788-19311810 CTCCTCAAGCCGCCCTGGTTTGG - Intergenic
1007076911 6:39074093-39074115 GCCCTCGGGCTGCCCGGGACTGG - Intronic
1007473557 6:42105423-42105445 CTCCTCAGGCACCCGGTGACTGG - Exonic
1007607969 6:43129990-43130012 CTCTTCAGGCCACCAGGGGCCGG - Intronic
1010187147 6:73157414-73157436 CTGCACAGGCCGCCCGGGGGCGG + Intronic
1013117705 6:107115194-107115216 CTCCCCGGGCCGCCCTGGCCAGG - Intronic
1013368493 6:109451868-109451890 GTCCTCAGGCCTCCTGGGCCTGG - Intronic
1019298452 7:290978-291000 CCCCTCGGGGCGCCCTGGACCGG - Intergenic
1019349802 7:549397-549419 CTCCCCGGGACGCACGGGACAGG + Exonic
1019360424 7:601875-601897 CTCCCCAGCCCCCCCGGGTCAGG - Intronic
1020006176 7:4784784-4784806 CGCCTCACGCCTCCCGGGAGGGG + Intronic
1020016491 7:4834820-4834842 CTACTCAGGCCGCCCTGCCCCGG - Exonic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1023812938 7:43926482-43926504 CGCCTCAGGCAGCCCCGGCCGGG + Exonic
1024983000 7:55173132-55173154 CTCCTGAGCCCACCCAGGACTGG - Intronic
1034306452 7:150048350-150048372 CTCCTCCCCGCGCCCGGGACTGG + Intergenic
1034501217 7:151452183-151452205 CAGCTCAGGCGGCCCGGCACCGG + Intergenic
1034800394 7:154052292-154052314 CTCCTCCCCGCGCCCGGGACTGG - Intronic
1037723843 8:21467155-21467177 CTCCTCAGCTGGCCCGGGAGTGG + Intergenic
1039913574 8:41843585-41843607 CTCCTCAGGCCTTCCTGGAAAGG + Intronic
1049224832 8:141445190-141445212 CTGCTCAGGCCGCTCCGGGCAGG - Intergenic
1049405772 8:142451266-142451288 CTCTTCAGGCTGCCGGGGAGTGG - Intronic
1049751187 8:144285006-144285028 CTCCGCAGGACGCCCCGGGCCGG + Intronic
1053352833 9:37424732-37424754 GGCCTCAGGCTGCCCGGGGCTGG - Intronic
1060248858 9:121969493-121969515 CTCCCCAGACTGCCCTGGACAGG - Intronic
1060494076 9:124105248-124105270 CTCCTCAGCCTGCCCCGGTCAGG + Intergenic
1061037262 9:128120751-128120773 CTTCCCAAGCCTCCCGGGACTGG - Exonic
1062387095 9:136316983-136317005 CTCCTCCTGCCACCTGGGACAGG - Intergenic
1062398901 9:136363838-136363860 CCCCTCAGGCCGCCAGGGGGCGG - Intronic
1062517647 9:136944335-136944357 CCCCTCAGCCCGCCAGGGCCCGG + Intronic
1203521819 Un_GL000213v1:52877-52899 GCCCTCAGGCCGTCTGGGACCGG + Intergenic
1188085234 X:25895213-25895235 CACCTCAGGGAGCCCAGGACTGG + Intergenic
1190333661 X:49250243-49250265 CTCCTCAGGCCTCCCGGACCCGG - Exonic
1190699852 X:52979553-52979575 GTCGTCAGGCTGCCAGGGACAGG - Intronic
1198286271 X:135194795-135194817 CTCCTCAGCCTCCGCGGGACGGG + Intergenic
1199991024 X:152987908-152987930 CTCCTGAGCCCTCCTGGGACTGG - Intergenic
1200034108 X:153317382-153317404 CTCCTGAGCCCTCCTGGGACTGG - Intergenic
1201584809 Y:15548801-15548823 TTCCTCATGCCCCCAGGGACAGG - Intergenic