ID: 954377989

View in Genome Browser
Species Human (GRCh38)
Location 3:50205056-50205078
Sequence GACTCCGTTGAGTCTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954377989_954377996 6 Left 954377989 3:50205056-50205078 CCCCCACAAGACTCAACGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 954377996 3:50205085-50205107 GCAGCTCTGCTCTCCCACCTAGG 0: 1
1: 0
2: 4
3: 231
4: 4315
954377989_954377997 7 Left 954377989 3:50205056-50205078 CCCCCACAAGACTCAACGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 954377997 3:50205086-50205108 CAGCTCTGCTCTCCCACCTAGGG 0: 1
1: 0
2: 1
3: 29
4: 230
954377989_954378002 24 Left 954377989 3:50205056-50205078 CCCCCACAAGACTCAACGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377989_954377998 8 Left 954377989 3:50205056-50205078 CCCCCACAAGACTCAACGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 954377998 3:50205087-50205109 AGCTCTGCTCTCCCACCTAGGGG 0: 1
1: 0
2: 2
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954377989 Original CRISPR GACTCCGTTGAGTCTTGTGG GGG (reversed) Intergenic
907049773 1:51322118-51322140 GACTCCCTTTACCCTTGTGGAGG - Intronic
917217959 1:172697523-172697545 GGCTGAGTTAAGTCTTGTGGTGG + Intergenic
1066370694 10:34815683-34815705 GGCTCCGTGGAGACTTCTGGAGG - Intergenic
1067150763 10:43731132-43731154 GACTCCCTTTAGCATTGTGGGGG - Intergenic
1069938570 10:71937313-71937335 GACTCCCTTCAGTCTTGAGGTGG - Intergenic
1077395652 11:2319837-2319859 GACTCTCTGCAGTCTTGTGGTGG + Intergenic
1077725448 11:4670873-4670895 GTCTCCGTTGATACTGGTGGTGG + Intergenic
1095031307 12:37285584-37285606 GAGTGCTTTGAGTCTTATGGTGG + Intergenic
1095069036 12:37816334-37816356 GAGCCCTTTGAGTCTTATGGTGG + Intergenic
1107727653 13:43316109-43316131 GAGTCCCTTGAGCCTGGTGGAGG - Intronic
1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG + Intergenic
1123387363 15:19827532-19827554 GAGCCCTTTGAGTCCTGTGGTGG - Intergenic
1123387838 15:19835635-19835657 GAGTGCTTTGAGTCTTCTGGTGG - Intergenic
1123387892 15:19836660-19836682 GAGTGCTTTGAGTCTTCTGGTGG - Intergenic
1136915585 16:34191762-34191784 GAGTGCTTTGAGTCCTGTGGTGG - Intergenic
1203118499 16_KI270728v1_random:1514660-1514682 GACCCCTGAGAGTCTTGTGGAGG - Intergenic
1143722535 17:8822805-8822827 GATGCCTTTCAGTCTTGTGGGGG + Intronic
1153620709 18:6975090-6975112 GACTCTGTAAAGTGTTGTGGTGG - Intronic
1154534941 18:15394141-15394163 GAGCCCTTTGAGTCCTGTGGTGG + Intergenic
1159568985 18:70090665-70090687 GCCACCCTTGAGTCCTGTGGTGG - Intronic
1160188794 18:76697533-76697555 GACTCCGCTGAGTCTCGGGCAGG + Intergenic
1163316989 19:16547380-16547402 GACTCACTTGAGTCTGGAGGTGG + Intronic
1164350697 19:27335515-27335537 GACTGCTTTGAGGCCTGTGGTGG - Intergenic
1164353611 19:27387709-27387731 GAGTGCGTTGAGGCCTGTGGTGG + Intergenic
1168340559 19:55620955-55620977 GGCTACCTTGAGGCTTGTGGGGG + Exonic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
933250542 2:80024381-80024403 CACTGCATTGAGTCTTGAGGAGG + Intronic
938061840 2:128261064-128261086 GACTCCCTGGAGTCTTGGAGAGG + Intronic
945636645 2:212361743-212361765 GAATCAGTTGAGGATTGTGGAGG - Intronic
1176535820 21:8049459-8049481 GAGTGCTTTGAGTCGTGTGGTGG - Intergenic
1179033436 21:37740029-37740051 GACTCCAGTGTGGCTTGTGGAGG + Intronic
1179085622 21:38215056-38215078 GACTTCGTTGAGTTGGGTGGTGG - Intronic
1180509826 22:16070184-16070206 GAGCCCTTTGAGTCCTGTGGTGG - Intergenic
1180510513 22:16082708-16082730 GAGTGCTTTGAGTCTTCTGGAGG - Intergenic
1181287428 22:21764117-21764139 GACTCCTTTGAGCCGTTTGGAGG - Exonic
949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG + Intronic
951308925 3:21099982-21100004 GTCTTCGTTGAGTCTTATAGTGG - Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954615825 3:51968164-51968186 GGCTCCGTTGAGTCTTTTACTGG + Intronic
956593141 3:70937317-70937339 GAATCTGTTGAGTGTGGTGGAGG - Intergenic
958210990 3:90475344-90475366 GAGAGCTTTGAGTCTTGTGGAGG - Intergenic
959147978 3:102572578-102572600 GATGCAGTGGAGTCTTGTGGGGG + Intergenic
962376070 3:134859553-134859575 GACCCCGTTGAGCCTTCTGCTGG + Intronic
966302155 3:178491670-178491692 GACTTCGTTGAGTCTTAAAGGGG + Intronic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
991437808 5:66614521-66614543 GAATTCGTTGAGTCTTGATGAGG + Intronic
1007670613 6:43550111-43550133 GACTCCGATGACTCTTGTAGAGG - Intronic
1014334176 6:120111191-120111213 GACTCCGTTGTATCTTGGAGTGG + Intergenic
1025523407 7:61771575-61771597 GAGTGCATTGAGGCTTGTGGTGG - Intergenic
1025569268 7:62537175-62537197 GATTCCTTTGAGGCCTGTGGTGG + Intergenic
1032027586 7:128455903-128455925 GTCTCCGGTGAGTTTTGTGGCGG + Exonic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG + Intronic
1040134904 8:43841758-43841780 GAGTCCATTGAGTCCTATGGGGG + Intergenic
1040312401 8:46243591-46243613 GACCCCGTTTTCTCTTGTGGGGG - Intergenic
1043385034 8:79739981-79740003 GACTGCGTTGTGTCTTCTGTTGG - Intergenic
1047756493 8:127922902-127922924 GACTCCCGTGACTCTTTTGGGGG - Intergenic
1048631926 8:136252814-136252836 GAATATGTTGAGTCTTGTGAGGG + Intergenic
1053686603 9:40533867-40533889 GAGCCCTTTGAGTCCTGTGGTGG + Intergenic
1053936811 9:43166278-43166300 GAGCCCTTTGAGTCCTGTGGTGG + Intergenic
1054277183 9:63091987-63092009 GAGCCCTTTGAGTCCTGTGGTGG - Intergenic
1054397653 9:64672942-64672964 GAGCCCTTTGAGTCCTGTGGTGG + Intergenic
1054432293 9:65178136-65178158 GAGCCCTTTGAGTCCTGTGGTGG + Intergenic
1054498091 9:65843540-65843562 GAGCCCTTTGAGTCCTGTGGTGG - Intergenic
1055020627 9:71665593-71665615 GACTCTGAAGAGTCGTGTGGCGG - Intergenic
1055977399 9:81968482-81968504 GTCACAGTTCAGTCTTGTGGCGG - Intergenic
1056622813 9:88228481-88228503 GACACCGCTGACTCTAGTGGTGG - Intergenic
1203396819 Un_KI270519v1:26286-26308 GAGTCCTTTGAGGCCTGTGGAGG - Intergenic
1203413663 Un_KI270589v1:24727-24749 GACTCCTTTGAGGCCTATGGTGG - Intergenic
1203684648 Un_KI270757v1:34485-34507 GACTCCTTTGAGGCCTATGGTGG + Intergenic
1196340929 X:114596608-114596630 AACTCCTTTGAGTCTTTGGGGGG + Intronic
1201079801 Y:10229454-10229476 GAGTTCTTTGAGTCCTGTGGTGG - Intergenic