ID: 954378002

View in Genome Browser
Species Human (GRCh38)
Location 3:50205103-50205125
Sequence CTAGGGGCTCCCTAACGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954377994_954378002 2 Left 954377994 3:50205078-50205100 CCCTCTGGCAGCTCTGCTCTCCC 0: 1
1: 0
2: 2
3: 49
4: 442
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377991_954378002 22 Left 954377991 3:50205058-50205080 CCCACAAGACTCAACGGAGTCCC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377992_954378002 21 Left 954377992 3:50205059-50205081 CCACAAGACTCAACGGAGTCCCT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377989_954378002 24 Left 954377989 3:50205056-50205078 CCCCCACAAGACTCAACGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377995_954378002 1 Left 954377995 3:50205079-50205101 CCTCTGGCAGCTCTGCTCTCCCA 0: 1
1: 1
2: 4
3: 47
4: 451
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377990_954378002 23 Left 954377990 3:50205057-50205079 CCCCACAAGACTCAACGGAGTCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
954377988_954378002 25 Left 954377988 3:50205055-50205077 CCCCCCACAAGACTCAACGGAGT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954378002 Original CRISPR CTAGGGGCTCCCTAACGCTC AGG Intergenic
904128582 1:28259701-28259723 CTCGGGGCTCCAGAACGCTCCGG - Exonic
904472297 1:30743394-30743416 CTAGGGCCACCCCAACACTCAGG - Intronic
904998371 1:34648890-34648912 CTATGTGCTCCATAACTCTCGGG - Intergenic
906032877 1:42734684-42734706 CCAGGGGCTCCCTGACCCTGGGG + Exonic
907651851 1:56302772-56302794 CGATGGGCTTCCTATCGCTCTGG - Intergenic
910641332 1:89465916-89465938 CTATGAGTTCCCTAACCCTCAGG - Intergenic
919521018 1:198586796-198586818 CAAGAGGATCCCTAAAGCTCAGG + Intergenic
1066298410 10:34075926-34075948 CAAGGAGCTCCCTACTGCTCAGG + Intergenic
1067289362 10:44930018-44930040 CCAGTGGGTCCCTAACTCTCGGG + Intronic
1071675627 10:87653244-87653266 CTAGGGGGTCCCAAACCTTCTGG - Intergenic
1072539365 10:96386472-96386494 CTGGGGGCTCCCTATGGCTTGGG + Intronic
1089522983 11:119078036-119078058 CTGGGGCCTCCCTATCGCTGCGG - Exonic
1090411267 11:126511595-126511617 GTGGGGGCTCCCTTAGGCTCTGG + Intronic
1090740279 11:129653788-129653810 CTAGGGCCTACCTAACATTCTGG + Intergenic
1104982757 12:132581603-132581625 CAAGGGGCTCCCTGGGGCTCGGG - Intronic
1115310586 14:31974665-31974687 CTAGGGACTGCCTAAAGCACAGG - Intergenic
1128675877 15:69608057-69608079 TAAGGGGCTCCCTTGCGCTCTGG - Intergenic
1133051686 16:3120564-3120586 CCAGGAGCTCCCCCACGCTCGGG - Intergenic
1135036886 16:19086142-19086164 TTGGGGGCCCCCTAACGCTTAGG + Intergenic
1137918312 16:52456826-52456848 CTGGGGCCTGCCTAAGGCTCTGG + Intronic
1140222927 16:73057664-73057686 CTAGGGGCTCCCGGGGGCTCGGG - Intronic
1147591082 17:41683771-41683793 CTAGGGGCTCCTTGTAGCTCTGG - Intergenic
1152194577 17:78909669-78909691 CTAGGGTCACCGTAAGGCTCGGG + Intronic
1156401452 18:36743836-36743858 CTAGAGGCTCCCTCATTCTCAGG + Intronic
1162299288 19:9835205-9835227 CATTGGGCTCCCTAACGGTCCGG - Intergenic
1162459633 19:10806875-10806897 CTAGGGGCTCCCAATCCCTGGGG - Intronic
1162811216 19:13165208-13165230 CTAGGAGCTCCCTAAGGGGCAGG + Intergenic
1165162220 19:33823526-33823548 GAAGGGGCTCCCTTACCCTCTGG + Intergenic
1166704351 19:44900561-44900583 CCAGGGGTTCCCTACCGCTGAGG - Intronic
1168185289 19:54696521-54696543 CTGGGAGCTCCCTAAAGCCCTGG - Intronic
1168424049 19:56224450-56224472 CTAAGCGTTCTCTAACGCTCAGG - Intronic
925456858 2:4023385-4023407 CGGGGGGCTTCCTAACTCTCTGG + Intergenic
927482685 2:23466963-23466985 CCCGGGGCTTCCTAACTCTCTGG - Intronic
929217839 2:39435367-39435389 CTAGGGCCACCCTCCCGCTCTGG + Intronic
931121440 2:59224823-59224845 CCAGGGGCTTCCTAACTCCCAGG + Intergenic
933864720 2:86505785-86505807 CTAGGGGCTGCCTACCCCGCTGG - Exonic
934783812 2:96990185-96990207 GAAGGGGCTCTCTAACGCTTTGG - Intronic
946451216 2:219781552-219781574 CTAGGGGCTCTCTCTCTCTCCGG + Intergenic
1181949680 22:26544930-26544952 CCAGGGGCTCCCTAAGGCAGCGG - Intronic
1185169924 22:49286805-49286827 CTCAGTGCTCCCTAAGGCTCCGG - Intergenic
952004041 3:28821863-28821885 ATAGGGGCTGGCTAACTCTCTGG + Intergenic
954378002 3:50205103-50205125 CTAGGGGCTCCCTAACGCTCAGG + Intergenic
955063223 3:55512356-55512378 CTAGGAACTCCCTAACTTTCTGG - Intronic
963062924 3:141239839-141239861 CTAGGGGCTCCCTATCAAGCTGG - Intronic
968981369 4:3851620-3851642 CTTGGGGCTGCCTAGGGCTCTGG - Intergenic
975023565 4:69520880-69520902 CTAGGGGCACCCTAAAGCCTAGG + Intronic
984024149 4:174522630-174522652 CTTGGCGCTCCAGAACGCTCAGG - Exonic
985790759 5:1925892-1925914 CCAGGGTCTCCCTGAGGCTCCGG + Intergenic
990983179 5:61619714-61619736 CCAGGGGCTCCCTTGCCCTCTGG - Intergenic
1000265580 5:159633121-159633143 CTAGAAGTTCCCTAACACTCTGG - Intergenic
1003469133 6:6412339-6412361 CAAGGTGCTTCCTAACTCTCTGG - Intergenic
1012255401 6:97025949-97025971 CTAGGGCCTCCCTATAGCTCTGG - Intronic
1014036032 6:116767352-116767374 CTAGGAGCTCCCTGACCTTCAGG + Intergenic
1018953994 6:168395827-168395849 CCAGGGGCTCCCTCACTCTGCGG - Intergenic
1019497547 7:1347530-1347552 CATGGGGCTCCCTTACACTCGGG + Intergenic
1019559252 7:1647813-1647835 CCAGGGGCTCCCTGAGGCTCTGG + Intergenic
1046015243 8:108597243-108597265 AAAGGGGTTCCCTAACACTCAGG - Intergenic
1056957343 9:91092690-91092712 CGAGGGGCTCCCTAGCTATCTGG + Intergenic
1061922479 9:133789580-133789602 CAAGGGGCTCCCTTCAGCTCTGG + Intronic
1062555131 9:137110399-137110421 GTAGAGGCTCCACAACGCTCAGG - Intergenic
1193689222 X:84619972-84619994 TTAGTGGCTGCCTAAGGCTCTGG - Intergenic
1200182947 X:154162324-154162346 CTATGGGTTCCATCACGCTCTGG - Intergenic
1200188601 X:154199438-154199460 CTATGGGTTCCATCACGCTCTGG - Intergenic
1200194250 X:154236579-154236601 CTATGGGTTCCATCACGCTCTGG - Intergenic
1200200006 X:154274382-154274404 CTATGGGTTCCATCACGCTCTGG - Intronic