ID: 954378305

View in Genome Browser
Species Human (GRCh38)
Location 3:50206154-50206176
Sequence GCGTTTGTTTACACCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 89}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954378294_954378305 19 Left 954378294 3:50206112-50206134 CCCCGCCCGGTTGGCCCCTTCGA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378296_954378305 17 Left 954378296 3:50206114-50206136 CCGCCCGGTTGGCCCCTTCGATT 0: 1
1: 0
2: 0
3: 0
4: 24
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378302_954378305 3 Left 954378302 3:50206128-50206150 CCTTCGATTGGCCACAGCAAATG 0: 1
1: 0
2: 0
3: 14
4: 89
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378299_954378305 13 Left 954378299 3:50206118-50206140 CCGGTTGGCCCCTTCGATTGGCC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378293_954378305 20 Left 954378293 3:50206111-50206133 CCCCCGCCCGGTTGGCCCCTTCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378303_954378305 -8 Left 954378303 3:50206139-50206161 CCACAGCAAATGCGTGCGTTTGT 0: 1
1: 0
2: 0
3: 11
4: 114
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378295_954378305 18 Left 954378295 3:50206113-50206135 CCCGCCCGGTTGGCCCCTTCGAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378301_954378305 4 Left 954378301 3:50206127-50206149 CCCTTCGATTGGCCACAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 111
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378298_954378305 14 Left 954378298 3:50206117-50206139 CCCGGTTGGCCCCTTCGATTGGC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378300_954378305 5 Left 954378300 3:50206126-50206148 CCCCTTCGATTGGCCACAGCAAA 0: 1
1: 0
2: 1
3: 8
4: 76
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378292_954378305 23 Left 954378292 3:50206108-50206130 CCGCCCCCGCCCGGTTGGCCCCT 0: 1
1: 0
2: 6
3: 31
4: 257
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378291_954378305 24 Left 954378291 3:50206107-50206129 CCCGCCCCCGCCCGGTTGGCCCC 0: 1
1: 0
2: 7
3: 44
4: 476
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954378305 Original CRISPR GCGTTTGTTTACACCCAGGC AGG Intronic