ID: 954378305

View in Genome Browser
Species Human (GRCh38)
Location 3:50206154-50206176
Sequence GCGTTTGTTTACACCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 89}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954378300_954378305 5 Left 954378300 3:50206126-50206148 CCCCTTCGATTGGCCACAGCAAA 0: 1
1: 0
2: 1
3: 8
4: 76
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378293_954378305 20 Left 954378293 3:50206111-50206133 CCCCCGCCCGGTTGGCCCCTTCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378303_954378305 -8 Left 954378303 3:50206139-50206161 CCACAGCAAATGCGTGCGTTTGT 0: 1
1: 0
2: 0
3: 11
4: 114
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378294_954378305 19 Left 954378294 3:50206112-50206134 CCCCGCCCGGTTGGCCCCTTCGA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378291_954378305 24 Left 954378291 3:50206107-50206129 CCCGCCCCCGCCCGGTTGGCCCC 0: 1
1: 0
2: 7
3: 44
4: 476
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378302_954378305 3 Left 954378302 3:50206128-50206150 CCTTCGATTGGCCACAGCAAATG 0: 1
1: 0
2: 0
3: 14
4: 89
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378295_954378305 18 Left 954378295 3:50206113-50206135 CCCGCCCGGTTGGCCCCTTCGAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378292_954378305 23 Left 954378292 3:50206108-50206130 CCGCCCCCGCCCGGTTGGCCCCT 0: 1
1: 0
2: 6
3: 31
4: 257
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378301_954378305 4 Left 954378301 3:50206127-50206149 CCCTTCGATTGGCCACAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 111
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378296_954378305 17 Left 954378296 3:50206114-50206136 CCGCCCGGTTGGCCCCTTCGATT 0: 1
1: 0
2: 0
3: 0
4: 24
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378298_954378305 14 Left 954378298 3:50206117-50206139 CCCGGTTGGCCCCTTCGATTGGC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
954378299_954378305 13 Left 954378299 3:50206118-50206140 CCGGTTGGCCCCTTCGATTGGCC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954378305 Original CRISPR GCGTTTGTTTACACCCAGGC AGG Intronic
901036435 1:6338820-6338842 GCTTCTTTTTATACCCAGGCTGG - Intronic
901890649 1:12260671-12260693 GCTTTTGTTTTCACCCAAACAGG + Exonic
902216130 1:14935558-14935580 GGGCTTGTTAACACCCAGACTGG - Intronic
903868086 1:26412615-26412637 GTGTAGGTTGACACCCAGGCCGG + Intronic
905489007 1:38329029-38329051 GAGTTCGCTTACTCCCAGGCAGG + Intergenic
905651671 1:39660985-39661007 GGGTTTGTTTGCTTCCAGGCTGG + Intronic
908027250 1:59965946-59965968 GAATTTGGGTACACCCAGGCTGG - Intergenic
908844782 1:68313532-68313554 GCATTTGCTTAGACCCAGTCTGG - Intergenic
910655029 1:89610298-89610320 GTGTGTGTGTACACCCAGCCCGG + Intergenic
912525003 1:110275926-110275948 GAGTCTCTTTTCACCCAGGCTGG - Intronic
913509636 1:119549999-119550021 GCTTTTATATCCACCCAGGCCGG + Intergenic
914779674 1:150773881-150773903 TCTTTTTTTTTCACCCAGGCTGG + Intergenic
919515439 1:198516297-198516319 GGGTGTGTTTACAACCAGCCAGG - Intergenic
1068398766 10:56500630-56500652 GACTTTGTATATACCCAGGCTGG - Intergenic
1071241856 10:83715652-83715674 GAGTTTCTTGTCACCCAGGCTGG - Intergenic
1072906423 10:99458243-99458265 GGGTTTGTCTACACCCATGTTGG + Intergenic
1073099086 10:100997769-100997791 GCGTTTGCTTGGTCCCAGGCCGG + Intronic
1075087073 10:119420953-119420975 GCCTTTGTTTCCACCTAGGAAGG - Intronic
1076391098 10:130103006-130103028 GCTCTTGTTGCCACCCAGGCTGG + Intergenic
1077237873 11:1490874-1490896 TCGTTTGTGTAGACCCAGGCTGG - Intronic
1079080989 11:17413602-17413624 GTGTTTGCTTGCACCCAAGCGGG - Intronic
1083242145 11:61396762-61396784 GAGTTTCTTGTCACCCAGGCTGG - Intronic
1092340801 12:7674157-7674179 GAGTTTCTTGTCACCCAGGCTGG + Intergenic
1092906123 12:13101651-13101673 GGGATTCCTTACACCCAGGCCGG + Intronic
1095770146 12:45945564-45945586 GATTTTGCTGACACCCAGGCTGG + Intronic
1098303365 12:69077229-69077251 CTCTTTGTTTACACCCAGCCAGG - Intergenic
1102495286 12:113315258-113315280 GAGTTTTCTTCCACCCAGGCTGG - Intronic
1102770348 12:115470739-115470761 GCGTGTGTCCACACACAGGCTGG + Intergenic
1103061077 12:117859173-117859195 GTCTTTCTCTACACCCAGGCTGG + Intronic
1103248107 12:119475605-119475627 GAGATTGTCTACACCCAGACAGG + Intronic
1105284037 13:18989990-18990012 TTATTTATTTACACCCAGGCTGG - Intergenic
1106033624 13:26024642-26024664 GATTCTTTTTACACCCAGGCTGG + Exonic
1109654757 13:65374906-65374928 GCTTCTGATTACACCCAAGCAGG - Intergenic
1113902456 13:113804582-113804604 GCGTGCGTTTATACCCAGGCTGG - Intronic
1113902467 13:113804621-113804643 GCGTGCGTTTATACCCAGGCTGG - Intronic
1113902478 13:113804660-113804682 GCGTGCGTTTATACCCAGGCTGG - Intronic
1113902489 13:113804699-113804721 GCGTGCGTTTATACCCAGGCTGG - Intronic
1113902498 13:113804738-113804760 GCGTGCGTTTATACCCAGGCTGG - Intronic
1122399446 14:101458380-101458402 CCGATTGTTCACCCCCAGGCGGG + Intergenic
1125385084 15:39128753-39128775 GCGTTTCTTTTCTCCCAGGCTGG - Intergenic
1125527793 15:40389176-40389198 GCTCTTGTTGCCACCCAGGCTGG + Intronic
1127680840 15:61296470-61296492 TCTTTTCTTTTCACCCAGGCTGG - Intergenic
1129920131 15:79312474-79312496 AAGTGTGTTTAAACCCAGGCTGG - Intronic
1133040410 16:3057476-3057498 GGGTTTGTTTTCTCCAAGGCAGG - Intronic
1134745040 16:16581314-16581336 ACTTTTGCTTTCACCCAGGCTGG - Intergenic
1135000445 16:18772455-18772477 ACTTTTGCTTTCACCCAGGCTGG + Intergenic
1137482239 16:48862127-48862149 GAGTTCCTTTACCCCCAGGCAGG + Intergenic
1151248839 17:72817734-72817756 TCCTATGTTTACTCCCAGGCTGG - Intronic
1154219800 18:12442020-12442042 ACTTTTTTTTCCACCCAGGCTGG + Intergenic
1156235910 18:35204596-35204618 GCATTTGTTGACACCCAGGATGG - Intergenic
1156985167 18:43342172-43342194 GCTTTTTTTTTCACCCAGGCTGG - Intergenic
1159043949 18:63350970-63350992 GTGTTTGTGTCCTCCCAGGCAGG - Exonic
1160239371 18:77112254-77112276 GCGTTTGGTTTCACCCAGGCGGG + Intronic
1161622260 19:5304445-5304467 GAGTTTCTTTTCGCCCAGGCTGG - Intronic
1163832710 19:19554650-19554672 GCCTTTGGGGACACCCAGGCTGG - Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
930533380 2:52617336-52617358 CAGTATGTTTACACCCTGGCTGG + Intergenic
931634966 2:64332708-64332730 GCCTTTGATTACACCCCAGCTGG - Intergenic
934764983 2:96875632-96875654 ACGTTTGTTTGGACCCAGTCTGG - Intergenic
940417970 2:153443891-153443913 GAGTTTCTTGTCACCCAGGCTGG - Intergenic
1169123313 20:3110178-3110200 GCGTTGCTTCTCACCCAGGCAGG + Exonic
1173732842 20:45340543-45340565 ACCTTTGTTTACTCCTAGGCAGG - Intronic
1175107963 20:56627922-56627944 GCATTTATTTAGACCCAGGTGGG - Intergenic
1178485723 21:33019195-33019217 AAGTTTGTATACAACCAGGCTGG + Intergenic
1180025976 21:45162344-45162366 GCCATTGTGTACAGCCAGGCAGG - Intronic
1182530719 22:30954262-30954284 TCTTTTTTTTTCACCCAGGCTGG - Intronic
1183556450 22:38531038-38531060 TTGTTTGTTGTCACCCAGGCTGG - Intronic
1183862888 22:40682277-40682299 GGGTTTGTTTAAAGTCAGGCAGG + Exonic
953936825 3:47052198-47052220 TCGTTTTTTTGTACCCAGGCTGG + Intronic
954152744 3:48665794-48665816 GTGTTTGTCTACTCCCAGCCAGG + Intergenic
954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG + Intronic
962388932 3:134955718-134955740 TCCTTTCTTTACACACAGGCTGG + Intronic
976302487 4:83528464-83528486 GAGTTTCTTTATTCCCAGGCTGG - Intergenic
979660185 4:123244207-123244229 GCGTTTTCTTTCTCCCAGGCTGG - Intronic
985795617 5:1959759-1959781 GCCTTTGTTCAGCCCCAGGCGGG - Intergenic
990190091 5:53249743-53249765 GGGTTTATTTACATCCTGGCTGG - Intergenic
992483505 5:77174214-77174236 GAGTGTGTTGACACCCAGGAAGG - Intergenic
998163246 5:139825493-139825515 GTGTTTGTTTACATCCAGGTGGG + Intronic
998378308 5:141706136-141706158 GCATTTGCTTCCACCCAGGCTGG - Intergenic
1001785744 5:174411564-174411586 GCGTTTTCTTCCAGCCAGGCAGG + Intergenic
1002382891 5:178842852-178842874 GAGTTTGTTTAGAGCCTGGCTGG - Intergenic
1013087467 6:106868574-106868596 TCCTTTCTTTTCACCCAGGCTGG - Intergenic
1020042971 7:5018042-5018064 GAGTTTGCTGTCACCCAGGCTGG - Intronic
1023374381 7:39541369-39541391 GCCTTTTTTGTCACCCAGGCTGG - Intergenic
1023672034 7:42587333-42587355 GCTGTTGTTGTCACCCAGGCTGG + Intergenic
1026339475 7:69423048-69423070 GTGTTGGTTTAAACCCAGGTGGG + Intergenic
1030209682 7:106984046-106984068 GCATATGTATATACCCAGGCTGG + Intergenic
1030532531 7:110728918-110728940 TGTTTTGTTTTCACCCAGGCTGG + Intronic
1032689247 7:134266046-134266068 GCCTCTGTTGACACCCAGGGTGG - Intergenic
1038181333 8:25231017-25231039 GGGTATGTTTACATCCAGGGTGG - Intronic
1038923680 8:32114122-32114144 TTGTTTGTTTACACCTAGACAGG + Intronic
1045873478 8:106951145-106951167 GCATTTGTTTACTCCTTGGCAGG + Intergenic
1049184538 8:141242816-141242838 GTGTTTGTATAAACCCAGGATGG - Intronic
1055732304 9:79290918-79290940 GGGTGTGTTCACACCCAGGGTGG + Intergenic
1059603245 9:115804287-115804309 TTGTTTGTTTTCACCCTGGCTGG - Intergenic
1062576296 9:137210061-137210083 GTGCATGTTTTCACCCAGGCTGG - Intronic
1062612728 9:137382284-137382306 GCGCTTGTTTATACACAGACAGG - Intronic
1189495988 X:41509195-41509217 GGTTTTGTTGTCACCCAGGCTGG + Intergenic
1190229779 X:48573471-48573493 TGTTTTGTTTTCACCCAGGCTGG + Intergenic
1191016295 X:55813539-55813561 GAGTATGTGTACACCCAGCCAGG - Intergenic
1192271339 X:69582571-69582593 ATGTTTGTTGAAACCCAGGCTGG - Intergenic
1198073631 X:133173968-133173990 GGCTTGGTTTTCACCCAGGCTGG + Intergenic