ID: 954379696

View in Genome Browser
Species Human (GRCh38)
Location 3:50213028-50213050
Sequence CCTCATAACCAGAGGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954379696_954379706 11 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379706 3:50213062-50213084 TGGACCCAGTGATGGGAGAGAGG 0: 1
1: 0
2: 4
3: 43
4: 334
954379696_954379712 30 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379712 3:50213081-50213103 GAGGGGCCAGTGAGTTGTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 216
954379696_954379703 3 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379703 3:50213054-50213076 GCAATTCCTGGACCCAGTGATGG 0: 1
1: 0
2: 1
3: 16
4: 169
954379696_954379704 4 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379704 3:50213055-50213077 CAATTCCTGGACCCAGTGATGGG 0: 1
1: 0
2: 1
3: 13
4: 155
954379696_954379702 -9 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379702 3:50213042-50213064 GTTATGAGGTAGGCAATTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 129
954379696_954379707 12 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379707 3:50213063-50213085 GGACCCAGTGATGGGAGAGAGGG 0: 1
1: 0
2: 4
3: 44
4: 431
954379696_954379708 13 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379708 3:50213064-50213086 GACCCAGTGATGGGAGAGAGGGG 0: 1
1: 0
2: 2
3: 43
4: 591
954379696_954379711 29 Left 954379696 3:50213028-50213050 CCCAGCCACCTCTGGTTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 954379711 3:50213080-50213102 AGAGGGGCCAGTGAGTTGTCTGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954379696 Original CRISPR CCTCATAACCAGAGGTGGCT GGG (reversed) Intronic
905302576 1:36995832-36995854 CCTCACAAACAGAGCTGGCAAGG + Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906104265 1:43282684-43282706 CCTCAGGGACAGAGGTGGCTGGG - Exonic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
906699740 1:47849256-47849278 CCTTATAAAAAGAGGTGGATTGG + Intronic
914234247 1:145793798-145793820 GCTCAGAACCAGTGCTGGCTTGG - Intronic
916290878 1:163165047-163165069 CCTGATAACCAGTGGTGACCTGG + Intronic
917581631 1:176384438-176384460 CCTCATCCCCACAGGTAGCTGGG + Intergenic
919636338 1:200006971-200006993 CCTGATAACCAGAGGTGTGTAGG - Intergenic
921551305 1:216538520-216538542 CCGCACAGCCAGAGGTGACTCGG + Intronic
923177851 1:231485600-231485622 CCTCTTAACCACAGCTGACTGGG + Intergenic
923402423 1:233628166-233628188 CCTCATAACCATCACTGGCTTGG + Intronic
924418816 1:243887825-243887847 CCTTAAAACTAGAGGCGGCTGGG + Intergenic
1065972803 10:30818530-30818552 CCTCAGCTCCAGAGGTGGCGGGG + Intergenic
1067087813 10:43252133-43252155 CCCCAGAAGCAGAGGGGGCTTGG + Intronic
1067363454 10:45602594-45602616 CCTCATAAGAAGAGGTGATTAGG + Intergenic
1068112412 10:52695298-52695320 CCTCAAAAGCAGAGTTGACTTGG + Intergenic
1072959253 10:99914393-99914415 TCTCATCACAAGAGATGGCTGGG - Intronic
1075970690 10:126649804-126649826 CCTGAGACCCAGAGGTTGCTGGG + Intronic
1076946580 10:133655899-133655921 CCTCACAACCAAAGGAGACTGGG + Intergenic
1077908060 11:6548920-6548942 GCTCCTCACCAGAAGTGGCTAGG - Exonic
1079579394 11:22044220-22044242 CCTCATAAAAAGAGTTGGGTTGG + Intergenic
1084149193 11:67280276-67280298 CCTCACAGCCAGAGTTGGCGCGG + Intronic
1087809090 11:102590856-102590878 CCTCATGACTCGAGGTGGCCAGG - Intronic
1088336725 11:108713637-108713659 CATCATAACCAGACATGGCAGGG - Intronic
1088844231 11:113651530-113651552 CTTAATAACCAGAGGAGCCTAGG + Intergenic
1090516856 11:127437908-127437930 CCTCATTAGCAGAGGTGGAAGGG - Intergenic
1094806663 12:34100746-34100768 CCTTGTAGCCACAGGTGGCTAGG - Intergenic
1097198136 12:57255797-57255819 CCTCAGAATCTGAGATGGCTTGG + Intronic
1098816238 12:75167605-75167627 GCTAATAACCAGAGCTGACTTGG + Intronic
1099503909 12:83448564-83448586 CCTCATAACCAGTGGGAGATAGG + Intergenic
1101902795 12:108803498-108803520 CCTCAGGACCAGGGGTGGCAGGG + Intronic
1103097206 12:118141616-118141638 CCTCAGCCCCACAGGTGGCTGGG - Intronic
1105979979 13:25509088-25509110 CCTCAGATGCAGAGGTGGCCAGG - Intronic
1114539950 14:23447729-23447751 GCTCCAAACCAGAAGTGGCTGGG + Intergenic
1117347094 14:54843735-54843757 CCAGATAACCAGAGGGGCCTGGG - Exonic
1117830625 14:59746258-59746280 CCTCCTTACCAGATGTGCCTGGG - Exonic
1118675085 14:68175453-68175475 CCTCACAAGCATAGCTGGCTGGG + Intronic
1119403144 14:74378094-74378116 CCCCATAAGCAGAGGCTGCTGGG - Intergenic
1119895793 14:78219015-78219037 CCTTATAACAAGTGGTGACTTGG - Intergenic
1123015155 14:105369981-105370003 CGGCAGAACCAGAGGTGGCCCGG - Intronic
1202920686 14_KI270723v1_random:28521-28543 CCTCACAACCAAAGGAGACTGGG + Intergenic
1202924245 14_KI270724v1_random:9128-9150 CCTCACAACCAAAGGAGACTGGG - Intergenic
1124429181 15:29591596-29591618 CCTCATAAAAAGAGAAGGCTGGG + Intergenic
1127819896 15:62645562-62645584 CGTCCTAACGACAGGTGGCTGGG - Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1128905365 15:71463295-71463317 CCTCATTACCATATGTGACTTGG - Intronic
1128946572 15:71826825-71826847 CCTCATTACCTGAGGCAGCTCGG + Exonic
1129152846 15:73699805-73699827 CCTGCTAGCCAGAGCTGGCTTGG - Intronic
1130654693 15:85784231-85784253 CCTTAAAAGCAGAGTTGGCTGGG + Intronic
1132929673 16:2452421-2452443 CCCCATAAGCAAAGGTGGGTGGG - Intronic
1133693121 16:8235378-8235400 CCTTATAACCAGAGGAGTCAAGG + Intergenic
1135961288 16:26996431-26996453 CCTGATGACCAGGGTTGGCTCGG + Intergenic
1137744036 16:50807826-50807848 CCTCCCAAGCAGAGGTGGATGGG - Intergenic
1138539295 16:57678890-57678912 CCTCTTAACTAGAGGGGGCATGG - Intronic
1139674976 16:68517429-68517451 CCACATTCCCAGAGCTGGCTGGG - Intergenic
1139850561 16:69949671-69949693 CTCCATAAACACAGGTGGCTTGG + Intergenic
1139879545 16:70172583-70172605 CTCCATAAACACAGGTGGCTCGG + Intergenic
1140372979 16:74422965-74422987 CTCCATAAACACAGGTGGCTCGG - Intergenic
1140849375 16:78920428-78920450 CCAAAGAACCATAGGTGGCTGGG - Intronic
1144387685 17:14764857-14764879 CCTCATCACCATTGGTTGCTTGG + Intergenic
1151206506 17:72512108-72512130 TCTCAGGCCCAGAGGTGGCTTGG + Intergenic
1151868807 17:76822616-76822638 GCTCATACCCAGAGGGTGCTAGG - Intergenic
1152907724 17:82978028-82978050 CCACGTAACCAGAGGTGGCCCGG - Intronic
1155529780 18:26755134-26755156 CCTCATAAGAAGAGGAGGTTAGG + Intergenic
1161604328 19:5206446-5206468 CCCCAGAACCAGAGGAGGGTGGG - Exonic
1163328099 19:16618239-16618261 CCTCATGACCACAGGAGGCCTGG + Intronic
1163677232 19:18661170-18661192 CCAGCTAACCAGAGCTGGCTTGG + Intronic
1163846726 19:19642403-19642425 CCTAATAACCAGAGAAGTCTAGG - Intronic
1164485657 19:28653647-28653669 CCTCATTACCAGAGGTCTCTTGG - Intergenic
1164490869 19:28713311-28713333 CCTCACAAAAAGAGATGGCTAGG - Intergenic
926805781 2:16709613-16709635 CCTCATAAGAAGAGGAGACTGGG - Intergenic
926931856 2:18048905-18048927 CCTCATCAGAAGAGGAGGCTAGG - Intronic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
944492273 2:200269575-200269597 CCTTCTCACCAGAGGTGGATTGG - Intergenic
945128385 2:206539001-206539023 CTTCCTAACCAGAAATGGCTGGG - Intronic
947181609 2:227416357-227416379 CCTCATAACCACAATGGGCTGGG - Intergenic
1168741191 20:192909-192931 CCTTATAGCCACAGGTGGCGAGG + Intergenic
1170992173 20:21312962-21312984 CCTCAGAACCAGAAGAGGTTTGG + Intronic
1171133589 20:22677286-22677308 CCTTATAAACAGGGGAGGCTGGG + Intergenic
1172242447 20:33422482-33422504 CTTCAAACCCAGAGTTGGCTGGG + Intronic
1173252096 20:41369275-41369297 CCTTATAAGAAGAGGAGGCTGGG - Intergenic
1173390263 20:42625563-42625585 CCTCAACTCCAGAGGTAGCTGGG + Intronic
1173702375 20:45084328-45084350 CATCAGAACAAGATGTGGCTGGG - Intergenic
1173706353 20:45113228-45113250 TCTTATAAACAGAGGCGGCTGGG + Intronic
1175206702 20:57316905-57316927 CTTCGTAAACAGACGTGGCTCGG - Intergenic
1176386447 21:6140527-6140549 CCCCAGAACCACAGGTGGCCTGG - Intergenic
1179181977 21:39053447-39053469 CCTCAGCAGCAGAGGGGGCTGGG - Intergenic
1179737026 21:43397725-43397747 CCCCAGAACCACAGGTGGCCTGG + Intergenic
1182221771 22:28764381-28764403 CCTCATAACTCGGGGTGGTTTGG - Intergenic
1182561791 22:31165646-31165668 CCACATGGCCAGAAGTGGCTGGG - Intronic
949691327 3:6643258-6643280 CCTCATAAGCAGTGGTGAATGGG - Intergenic
950266050 3:11573863-11573885 CCTCATAACCACAGCTTACTTGG - Intronic
951650160 3:24942407-24942429 CCTCATCTGAAGAGGTGGCTTGG + Intergenic
952775983 3:37047160-37047182 CCTCATAACCAAAGCTGGGCGGG - Intronic
952878113 3:37965186-37965208 CTTCATGACAAGAAGTGGCTGGG + Intronic
953644632 3:44742683-44742705 CTTAATAGCCATAGGTGGCTAGG + Intronic
954379696 3:50213028-50213050 CCTCATAACCAGAGGTGGCTGGG - Intronic
954614763 3:51964041-51964063 CCTGCTGACCAGAGGGGGCTGGG - Intronic
957080891 3:75634578-75634600 CCTCACAACCAAAGGAGACTGGG - Intergenic
958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG + Intergenic
960005874 3:112780793-112780815 CCTGAGCACCTGAGGTGGCTGGG - Intronic
960370901 3:116837815-116837837 ACTCATAACTACAGATGGCTTGG + Intronic
960938454 3:122917919-122917941 TCTCAAAACCACAGGTTGCTGGG - Intronic
961365825 3:126398607-126398629 CCTCATAGCCAGAACTGGCAGGG - Intronic
971209494 4:24602131-24602153 CCTTATACCCACGGGTGGCTAGG - Intergenic
971478548 4:27094281-27094303 TCTCATCCCCAGAGATGGCTGGG + Intergenic
974123008 4:57662807-57662829 CCAGAAAAGCAGAGGTGGCTGGG - Intergenic
978432755 4:108650781-108650803 CCTCATCACCGGAGGTAACTCGG + Exonic
982783012 4:159510715-159510737 TCTCCTAAAGAGAGGTGGCTGGG - Intergenic
984892418 4:184505452-184505474 CCTTATAAGAAGAGGAGGCTAGG + Intergenic
985449998 4:190056560-190056582 CCTCACAACCAAAGGAGACTGGG + Intergenic
992674214 5:79089498-79089520 CTTCATAATCATAGGTAGCTAGG + Intronic
995181557 5:109235036-109235058 ACTCATCTCCAGATGTGGCTTGG + Intergenic
995203591 5:109453962-109453984 TCTCATAACAAGAAGTGGCGTGG - Intergenic
996368965 5:122733185-122733207 CCTCACAACCAGATCTGGTTGGG + Intergenic
998936320 5:147234217-147234239 CCTAATAACCGGAGGTGGATAGG + Intergenic
1000397679 5:160792688-160792710 CCTCACATCCAAAGGTGGGTAGG - Intronic
1001535888 5:172497573-172497595 CTTTATAGCCAGGGGTGGCTTGG + Intergenic
1002834306 6:853001-853023 CCTCATAAGCAGAGGAGATTAGG + Intergenic
1006437286 6:34032677-34032699 CTTCATAATCAGGGCTGGCTGGG + Intronic
1006807087 6:36795555-36795577 CCTCATATGAAGAGGTGACTAGG + Intronic
1007162622 6:39804125-39804147 TCCCATAAACAGAGGAGGCTGGG - Intronic
1007363473 6:41374219-41374241 CCTCATCCCCAGTGGTGGCCTGG - Intergenic
1007775311 6:44221728-44221750 CCTCCCAAGCAGAGGTTGCTGGG - Intronic
1009226511 6:61024812-61024834 CCTAATATCCAGAGGTGGGGAGG + Intergenic
1015457248 6:133440566-133440588 CCTCAAAACCAGAAGTGACCTGG - Intronic
1018830864 6:167442488-167442510 CCACATAACAAAAGATGGCTGGG - Intergenic
1019046044 6:169146974-169146996 CCTCATTACCTGAGCTGGGTGGG - Intergenic
1022500446 7:30879255-30879277 CCTCCTAAGCAGAGGAGGTTAGG + Intronic
1023814291 7:43937897-43937919 CCACATAACCAGTGGTGACTAGG + Intronic
1028263021 7:88686968-88686990 CCTGGGAACCAGAGGAGGCTTGG - Intergenic
1030004054 7:105097681-105097703 CCTAATAAAAATAGGTGGCTGGG - Intronic
1030738371 7:113078525-113078547 CCTCAAAGCCACAGGTGGTTTGG - Intronic
1034458194 7:151183154-151183176 CTTCAGAAACAGAGCTGGCTAGG + Intronic
1035226261 7:157434535-157434557 CCTCATAAGTAAAGTTGGCTTGG + Intergenic
1035477069 7:159151376-159151398 CCCCACTGCCAGAGGTGGCTGGG - Intergenic
1039629219 8:39090600-39090622 CCCCATTAAAAGAGGTGGCTTGG - Intronic
1041614707 8:59892893-59892915 CTTCATAATCACAGGTAGCTAGG - Intergenic
1043633525 8:82365472-82365494 CCTAATATCCAGAGGGGGATAGG + Intergenic
1044700075 8:94957775-94957797 CCTCATTCCAAGAGGTGGCCCGG - Intronic
1045833455 8:106492153-106492175 CCTGATACCCTGAGGTGCCTGGG + Intronic
1047351951 8:124082592-124082614 CCACATCAGCAGAGCTGGCTTGG + Intronic
1049450754 8:142660216-142660238 CCTCGAACCCAGAGGGGGCTGGG + Intronic
1051938872 9:22480027-22480049 CCCCATAACCAGTGGAGGCCAGG - Intergenic
1052821025 9:33137986-33138008 CCTCAGAACCAAAGGTGGGGTGG - Intronic
1192682791 X:73268892-73268914 CCTGACAGACAGAGGTGGCTGGG - Intergenic
1195201010 X:102550078-102550100 CCTGAGAGCCAGAGGTGGGTAGG + Intergenic
1200891244 Y:8326494-8326516 CCTCTTAATCACAGGTGGTTTGG + Intergenic