ID: 954380151

View in Genome Browser
Species Human (GRCh38)
Location 3:50215033-50215055
Sequence GCCCACACAAGGCCTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954380151_954380156 -3 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380156 3:50215053-50215075 GGCACACGTGTCCTTTGGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 78
954380151_954380155 -4 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380155 3:50215052-50215074 GGGCACACGTGTCCTTTGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
954380151_954380158 -1 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380158 3:50215055-50215077 CACACGTGTCCTTTGGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 144
954380151_954380154 -8 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380154 3:50215048-50215070 GTGTGGGCACACGTGTCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 139
954380151_954380160 21 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380160 3:50215077-50215099 GCTCTGCCCTGAAGCCAGAATGG 0: 1
1: 1
2: 2
3: 29
4: 264
954380151_954380157 -2 Left 954380151 3:50215033-50215055 CCACGGCCAGGCCTTGTGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 954380157 3:50215054-50215076 GCACACGTGTCCTTTGGCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954380151 Original CRISPR GCCCACACAAGGCCTGGCCG TGG (reversed) Intronic
900609461 1:3538345-3538367 GAGCACACAGGGCCTGGCAGGGG + Intronic
901642318 1:10698999-10699021 CCCCACCCATGGCCTGGCCTGGG + Intronic
901789574 1:11647252-11647274 CCCCACACATGACCTGGCCTGGG + Intergenic
901868748 1:12125311-12125333 GCCCAGGCCAGGCCAGGCCGGGG - Intronic
902768318 1:18631284-18631306 GCCCGCACAACTTCTGGCCGAGG + Exonic
902799663 1:18821372-18821394 GCCCACACCAGGCCTTGCCCTGG + Intergenic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903850420 1:26302492-26302514 CCCCACACAGGGCCTGGCCCAGG + Intronic
905486552 1:38301289-38301311 ACAAACAGAAGGCCTGGCCGGGG - Intergenic
906116544 1:43360805-43360827 GCCCACACACTTCCTGGCTGTGG - Exonic
907399870 1:54218420-54218442 GCCCACACAAGTCCAAGCCCTGG + Intronic
908012304 1:59791083-59791105 GCCCACCCAAGGCCTGCCACTGG + Intergenic
915543122 1:156581476-156581498 GCCCTCACCAGGGCTGGCCATGG + Exonic
916138850 1:161676061-161676083 GGCCACCCAAGCCCTGGCCCAGG + Intronic
916515572 1:165513353-165513375 GCACACACAGGGCTTGGCAGCGG + Intergenic
920627026 1:207612589-207612611 GCCCAAGCAAGGCCTGGGCAGGG - Intronic
922722162 1:227904697-227904719 CCCCACAGAAGGGCTGGCTGTGG - Intergenic
923243480 1:232108801-232108823 GCCCACACCAGGTTTGGCTGTGG + Intergenic
923492557 1:234497135-234497157 GCTCACACAAAGCCTGTTCGTGG + Intergenic
1063401709 10:5752451-5752473 GCCGACACACGGCCTGCACGTGG - Intronic
1064249428 10:13695671-13695693 GCACACACACGGACTGGGCGAGG + Intronic
1065819989 10:29516722-29516744 GCTCACCCAACGCCTGGCCCAGG + Intronic
1065952929 10:30668163-30668185 GCTCACCCAACGCCTGGCCCTGG - Intergenic
1066370652 10:34815580-34815602 GCCCCCACCAGCCCTGGCCCAGG + Intergenic
1070778449 10:79123840-79123862 GCTCACAGCAGGCCTGGCCAGGG + Intronic
1072782396 10:98259640-98259662 CCCCACTCTAGGACTGGCCGAGG - Intronic
1072884287 10:99260283-99260305 GCCCACACAAAGCCTGTTGGTGG + Intergenic
1073472406 10:103731087-103731109 GCCCACACAGGGCCCAGCTGAGG + Intronic
1074111212 10:110423856-110423878 GCCCACCCAGGGCCTGCCCCTGG - Intergenic
1076207453 10:128614419-128614441 GCCCACCCGAGGCCTCACCGGGG - Intergenic
1077108076 11:850456-850478 CCGCACCCAACGCCTGGCCGGGG - Intronic
1078428295 11:11268731-11268753 GCCCCCATAAGGCCCGGCCCAGG - Intergenic
1080742495 11:35079392-35079414 TCCCACACATGGCCTGGAGGAGG + Intergenic
1081323330 11:41717044-41717066 GCCCACCCAGGGCCAGGCAGAGG - Intergenic
1081636684 11:44726759-44726781 CCCCAGACAAGGCCTGGACGCGG + Intronic
1083479405 11:62933981-62934003 GCCCACCCAAGGCCTGCTCTGGG - Intergenic
1083593800 11:63909721-63909743 GCCCACAGTGGGCCTGGCGGAGG - Exonic
1084191352 11:67500374-67500396 GCCAGCACCAGGCCTGGCGGTGG + Exonic
1084454166 11:69257827-69257849 GCCCAGACAAAGCTTGGCCAAGG - Intergenic
1085208179 11:74749431-74749453 CCCCTCACCAGGCCGGGCCGGGG - Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089456958 11:118631335-118631357 GCCCTCACGAGGCCTTGCAGGGG + Exonic
1090256231 11:125286605-125286627 GGCGACACCAGGCCTGGCAGTGG - Intronic
1091197507 11:133744590-133744612 GCCCACTCAAGCCATGGCTGGGG - Intergenic
1091288034 11:134419673-134419695 GGCCACACCAGGCCAGGCCTAGG - Intergenic
1092226815 12:6753159-6753181 GCCCACCCGGGGCCGGGCCGTGG + Exonic
1097140651 12:56900130-56900152 GCCCACAAAAGCCCTGGGCTTGG + Intergenic
1099709698 12:86207451-86207473 TCACACACAAGGCCTGTCGGGGG - Intronic
1102235166 12:111289917-111289939 GCCTACAGAAGTGCTGGCCGAGG + Intronic
1104981317 12:132574203-132574225 GCCCGCACAGGGCCCGGCCGGGG - Intronic
1105604233 13:21913445-21913467 GCCCACAGAAGGGCTGGCGAGGG - Intergenic
1111220852 13:85204852-85204874 GCCCTCTCTGGGCCTGGCCGAGG + Intergenic
1111607921 13:90564316-90564338 GCCCACACCTGGTCTGGCTGCGG + Intergenic
1112764881 13:102730595-102730617 GCACACACAAGGGTTGGCTGTGG + Exonic
1113695927 13:112345364-112345386 GGCCACATCAGGCCTGCCCGGGG + Intergenic
1113892495 13:113743765-113743787 GCTCACACAGGGACTGGCCTGGG - Intergenic
1115851667 14:37594732-37594754 GCCCGGCCAAGGCCCGGCCGGGG + Intronic
1116769983 14:49116319-49116341 GCAAACACAATGCCTGGCAGTGG - Intergenic
1119555477 14:75549210-75549232 GCCCACAAGAGGCCAGGCCCTGG - Intergenic
1119726191 14:76923076-76923098 GCCCTCACCAGGCCTGGTCTGGG + Intergenic
1120162890 14:81164434-81164456 GCCCACACATTGCCTGGCAGTGG - Intergenic
1122174815 14:99909049-99909071 GCCCACCCCATGCCTGGCCCTGG + Intronic
1123056040 14:105571334-105571356 GCCCACCCAAGGCCTGGCTCAGG + Intergenic
1123056601 14:105573922-105573944 GCCCACCCAAGGCCTGGCTCAGG + Intergenic
1123057344 14:105577609-105577631 GCCCACCCAAGGCCTGGCTCAGG - Intergenic
1123080472 14:105691459-105691481 GCCCACCCAAAGCCTGGCTCAGG + Intergenic
1123081608 14:105697863-105697885 GCCCACCCAAGGCCTGGCTCAGG - Intergenic
1127448638 15:59093171-59093193 GGCCACACAAGGTTTGGCCAGGG + Intronic
1128687634 15:69698650-69698672 GCCCAAAGAAGGCCTGGAAGAGG + Intergenic
1129522130 15:76192598-76192620 GCCCAAACAAGTCCAGGCCCGGG + Intronic
1132661369 16:1062934-1062956 GACCACAGGAGGCCTGGCCTGGG - Intergenic
1133140057 16:3737036-3737058 GCACACACAGGGCAGGGCCGAGG + Intronic
1135657009 16:24259022-24259044 GCCTACAGAATGCCTGGCTGGGG - Intronic
1136334976 16:29605317-29605339 GGCCACGCAAGGCCTGCCCATGG + Intergenic
1136551821 16:30986039-30986061 ACCCTCACAGGCCCTGGCCGGGG - Exonic
1138556947 16:57776297-57776319 GCCCACAGAAGGCCTGATCCTGG + Intronic
1139275478 16:65723846-65723868 GCCCAGATAATGCCTGGCAGGGG + Intergenic
1142124681 16:88404324-88404346 GGCCTCTCAAGGCCTGGCTGTGG - Intergenic
1142978671 17:3659320-3659342 GCCCCCCACAGGCCTGGCCGGGG - Intronic
1143524267 17:7463210-7463232 CCCCCCACAGGGGCTGGCCGGGG - Exonic
1143780231 17:9225445-9225467 GCCCCCACAGGGGCTGGCGGGGG + Intronic
1145981216 17:29012858-29012880 GGCCACCCAAGGCCTGTCAGGGG + Intronic
1146904412 17:36608849-36608871 GCCCACACACGGCCCCGCCCTGG + Exonic
1147890537 17:43713744-43713766 GCCCCCACGCGGGCTGGCCGGGG + Intergenic
1148219055 17:45849533-45849555 GTCCACCCCAGGCCTGGCCTTGG - Intergenic
1148558274 17:48591536-48591558 GGCCCCACAAGGCCTGGTCTGGG - Exonic
1149922161 17:60670129-60670151 GACCACACTTGGCCTGGCTGTGG + Intergenic
1150236022 17:63593240-63593262 GCCCAGCCAGGGCCTGGCCCAGG - Exonic
1150653506 17:67024850-67024872 GCTCGCACGATGCCTGGCCGGGG - Exonic
1151357277 17:73567378-73567400 GCCCAGACAAGGCCTGCCACGGG + Intronic
1151938943 17:77281153-77281175 GACCAGACCAGGCCAGGCCGGGG - Intronic
1152374705 17:79913161-79913183 CCACACAGGAGGCCTGGCCGGGG - Intergenic
1152695569 17:81742079-81742101 TCCCCCAGAAGGCCTGGCCAGGG - Intergenic
1152708961 17:81860693-81860715 ACTCACACCAGGCCTGGCCCCGG + Exonic
1157477391 18:48032007-48032029 TCCCTCACCAGGCCTGGCAGAGG + Intronic
1157551256 18:48583173-48583195 CCCCACACATGACCTGGCCATGG + Intronic
1160942675 19:1627720-1627742 GCCCACAGAAGCCCTGCCCAGGG + Intronic
1161487712 19:4544517-4544539 GCCCGCAGGAGTCCTGGCCGGGG + Exonic
1162951772 19:14075217-14075239 GGCCAGACACGGCCTGGCCCAGG + Intergenic
1163525155 19:17816458-17816480 GCCCACACAGGGACTGACTGAGG + Intergenic
1165153916 19:33776449-33776471 GCCCACACCCGGCATGGACGCGG - Intergenic
1165154055 19:33776967-33776989 GCCCATACAGGGCCTGTCCAAGG + Intergenic
1166821253 19:45581600-45581622 GCCAGCACAAGGCCTGGCACAGG + Intronic
1167569281 19:50276850-50276872 GCTCCCCCAGGGCCTGGCCGTGG - Exonic
1167618653 19:50549523-50549545 GCCCCCACAGGGCCTGGACAGGG - Intronic
925182198 2:1824572-1824594 ACCCTCGCATGGCCTGGCCGGGG - Intronic
926314923 2:11702446-11702468 TCACAGACAAGGCCTGGCCCTGG + Intronic
926727951 2:16013195-16013217 GCACCCACAAAGCCCGGCCGTGG + Intergenic
926794016 2:16604008-16604030 CCCCACACAAGGCATAGCCCAGG - Intronic
932475560 2:72003663-72003685 ACCCTGACAAGGCCTGGCTGTGG + Intergenic
933584108 2:84161342-84161364 GCCCACACAAAGTCTAGTCGTGG - Intergenic
936116977 2:109710508-109710530 GCCAACACTAGGCTTGGCCCAGG - Intergenic
936526825 2:113247037-113247059 GGGCCCACAGGGCCTGGCCGTGG - Intronic
937914721 2:127093163-127093185 GCCCCCACAAGGCCCTGTCGGGG + Intronic
938661361 2:133490255-133490277 GACCACACTTGGCCTGGCTGGGG - Intronic
940326886 2:152434811-152434833 TCCCACCCAAGTCCTGGCCCTGG - Intronic
941928304 2:170917181-170917203 GCCCAAGCAAGGCCTGGGCAGGG - Intergenic
942095608 2:172534379-172534401 GCCCAAACGAGGCCTGGGTGGGG + Intergenic
946427171 2:219605598-219605620 GCTCACACAAATCCTGGCAGGGG - Exonic
948099796 2:235364741-235364763 GCCCAGACAAGGCCCAGCCTTGG - Intergenic
948902367 2:240963118-240963140 GCCCACACTAGGACAGGCAGCGG + Intronic
1169244637 20:4015729-4015751 GGCCGCACCAGGCCTGGCCAGGG - Intergenic
1175224990 20:57439518-57439540 GCCCACACCAGGCGGGGCCATGG - Intergenic
1175804360 20:61819197-61819219 GTCCCTACAGGGCCTGGCCGTGG - Intronic
1176117791 20:63440547-63440569 GCCCTCACAGGGCCTGTCCTGGG - Intronic
1177644534 21:23884867-23884889 GCCCACAGAAAGCCTGACCTTGG - Intergenic
1178293709 21:31391042-31391064 GCCCCTAGAAGGCCTGGACGTGG - Intronic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1179724082 21:43332064-43332086 GCCCACACAAAGCCCTGCCTGGG - Intergenic
1180174802 21:46082336-46082358 GCCCCCACCTGGCCTGGCCTCGG - Intergenic
1180188873 21:46153407-46153429 GCCCCCTCTTGGCCTGGCCGGGG - Intronic
1180746436 22:18092222-18092244 ACCCACCCACGGCCTGGCCAAGG + Exonic
1181041629 22:20195139-20195161 GGCCATACAGGGCCTGGCCAGGG - Intergenic
1181053489 22:20248615-20248637 GCCCATACAAGACCAGGCCGAGG + Intronic
1181310605 22:21942688-21942710 ACCCAGACAATGCCTGGCCAAGG + Intronic
1181626271 22:24124341-24124363 GCCCTCAGAGGGCCTGGCAGAGG - Intronic
1183374468 22:37454899-37454921 GCCCACTCCAGGTCTGGCAGAGG - Intergenic
1183483176 22:38075862-38075884 CCCCACACAGGGCGTGGCCTTGG - Intergenic
1183692733 22:39399994-39400016 GCGCACACACGCCCTGGCCTCGG - Intronic
950965436 3:17142736-17142758 GCCCACAGCAGGGCTGGACGGGG - Intergenic
952966428 3:38623763-38623785 GCACAGACCAGGCCTGGCTGCGG + Intronic
953833890 3:46326763-46326785 GCCCACACAAAGCCTGTTGGTGG - Intergenic
954380151 3:50215033-50215055 GCCCACACAAGGCCTGGCCGTGG - Intronic
954748960 3:52803053-52803075 GCCCACACTGGGCATGGCCCAGG + Intronic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
961746782 3:129068699-129068721 GCCCAGAAAGGGGCTGGCCGGGG + Intergenic
961829599 3:129616680-129616702 GGCCACCCAAGGTCAGGCCGAGG - Intergenic
962282877 3:134065528-134065550 GCCCGCACAGTGCCTGGCCCTGG + Intronic
968730342 4:2266438-2266460 GCCCCCAAGAGGCCTGGCCTGGG - Intergenic
968968107 4:3779599-3779621 GCCCACAGGAGGCATGGCCTTGG - Intergenic
968978591 4:3834741-3834763 GCCCTCACCTGGCCTGGCCTCGG - Intergenic
970729885 4:19090323-19090345 GCCCACACAAGGCCTTGGGCAGG - Intergenic
984821920 4:183889672-183889694 GCCCTGAAAGGGCCTGGCCGGGG + Intronic
985546755 5:513814-513836 CGCAACACAAGGGCTGGCCGTGG - Intronic
985883496 5:2658142-2658164 GCCCAGACAAGGCCAGGGTGGGG - Intergenic
986136528 5:4985002-4985024 GCCCACAAAAGAGGTGGCCGAGG + Intergenic
988268233 5:28979342-28979364 GCCCATACAAGGCCTTACCCAGG - Intergenic
988712151 5:33789333-33789355 GCCCACACATGGCCTCCCCCAGG + Intronic
997475663 5:134140943-134140965 GCCCACACAAGGCCATGCCCAGG + Intronic
999199534 5:149806019-149806041 GCCAACACATGACCAGGCCGAGG - Intronic
999495963 5:152097224-152097246 CCCCACAAAAGGCCTGGGCAGGG + Intergenic
1002428646 5:179190652-179190674 GCTCACACAAAGCCTGGTGGTGG + Intronic
1002679754 5:180951904-180951926 GCCCAGCCAAGGCGTGGCCAGGG + Intergenic
1003630400 6:7781447-7781469 GCACACAGCAGGCCTGGCTGTGG + Intronic
1005379566 6:25219122-25219144 GGCCACACTAGGCATGGCCCAGG + Intergenic
1006303757 6:33207380-33207402 GCCCACATAAGGACTGGCCACGG + Intergenic
1006796715 6:36736876-36736898 GCCCAGATAAGGCCTGTCCTTGG - Intergenic
1006906452 6:37536635-37536657 ACCCACACAGGGCCTGCCCAGGG + Intergenic
1007730647 6:43943402-43943424 GCACACCCAAGGCCTGGTCTGGG - Intergenic
1007809661 6:44476929-44476951 GCACACACTGGGCCAGGCCGAGG + Intergenic
1017725483 6:157273812-157273834 GCCCACCCGAGGCCTGGCCAGGG - Intergenic
1018443501 6:163834535-163834557 GGCCACCCATGGCCTGGCAGAGG + Intergenic
1019597139 7:1863391-1863413 GCCGTCACAAGGCCTGGGCGGGG + Intronic
1019885009 7:3896352-3896374 GCCCACACAAGGCCAGGAAGAGG - Intronic
1020125348 7:5530187-5530209 GCCCCCACCGGGCCTGGCGGGGG + Intronic
1020127946 7:5543515-5543537 ACCCACACAGGGCCTTGCTGAGG - Intronic
1020147985 7:5659789-5659811 GCCAACACCAAGCCTGGCAGGGG + Intronic
1026930271 7:74219869-74219891 CCCCACATCAGGCCTGGCCACGG - Intronic
1026982766 7:74536304-74536326 GCCCAGAGCAGGGCTGGCCGCGG - Intronic
1029098242 7:98106295-98106317 GTCCACACAGGGCCAGGGCGGGG + Intergenic
1029676812 7:102075411-102075433 GCACACACACACCCTGGCCGGGG + Intronic
1034983552 7:155493913-155493935 GGCCCCACATGGCCTGGTCGTGG - Intronic
1035022722 7:155808759-155808781 GCCGACACAAAGCCCGGCCCCGG - Intronic
1036613051 8:10366401-10366423 GCCTGCACAAGGCCTGGCTCAGG - Intronic
1038052386 8:23826161-23826183 GACCACATGAGGCCTGGCCAAGG - Intergenic
1043031618 8:75141010-75141032 TCACACACAGGGCCTGTCCGGGG + Intergenic
1045397000 8:101771178-101771200 GCCCACACAAGGCAGAGCCTTGG + Intronic
1046660416 8:116942708-116942730 GCACACGCAAGGGCTGGGCGCGG + Exonic
1047338717 8:123959559-123959581 GCACCTACAAGGCCTGGCCTAGG + Intronic
1049276223 8:141721373-141721395 ACCCAAAGCAGGCCTGGCCGTGG - Intergenic
1049783352 8:144439010-144439032 TCCCACAGAAGGCCTGCCCGAGG + Intronic
1056481686 9:87012575-87012597 GCCCACACACTTCCTGGCTGTGG - Intergenic
1059447509 9:114347884-114347906 GCTCACAGATGGCCTGGCTGGGG + Exonic
1060966164 9:127713383-127713405 GCCCACACATGCCCTGGGAGGGG + Intronic
1061386170 9:130290507-130290529 CCCCTGACAAGGCCTGGCCCGGG + Intronic
1062519596 9:136952149-136952171 GCCCACACCAAGCCTGCCCTGGG + Intronic
1203441680 Un_GL000219v1:15574-15596 GCCCACTGAAGCCCTGGCGGGGG - Intergenic
1185450582 X:278934-278956 GCTCACACAAAGCCTGTTCGGGG - Intronic
1190333603 X:49250005-49250027 CACCACACGAGGCCTGGCCATGG + Intronic
1192316307 X:70054478-70054500 TGCCAGACAAGGCCTGGCTGTGG - Intergenic
1192504001 X:71670004-71670026 GCCCTCCCAGGGCCTGGCTGTGG + Intergenic
1192509973 X:71715881-71715903 GCCCTCCCAGGGCCTGGCTGTGG - Intronic
1192516724 X:71765672-71765694 GCCCTCCCAGGGCCTGGCTGTGG + Intronic
1192529106 X:71871005-71871027 GCCCTCCCAGGGCCTGGCTGTGG - Intergenic
1196778215 X:119360214-119360236 GCCCAGACAGGGCCTTGCCAGGG - Intergenic