ID: 954380808

View in Genome Browser
Species Human (GRCh38)
Location 3:50218058-50218080
Sequence TGTGGTCCTGAATGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954380803_954380808 2 Left 954380803 3:50218033-50218055 CCTGAGCTGGTTTGGGGAGAATG 0: 1
1: 0
2: 4
3: 16
4: 310
Right 954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 267
954380802_954380808 3 Left 954380802 3:50218032-50218054 CCCTGAGCTGGTTTGGGGAGAAT 0: 1
1: 0
2: 2
3: 19
4: 608
Right 954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954380808 Original CRISPR TGTGGTCCTGAATGTGGAGA GGG Intronic
900400797 1:2472113-2472135 TGGGGTCCTGCCTGTGGGGAGGG + Intronic
901805508 1:11736223-11736245 TGTGAACCTGAAGGTGGCGACGG + Exonic
902934450 1:19754724-19754746 TATGGTCAAGAATGTGTAGAAGG - Intronic
903817522 1:26075630-26075652 TGTGGACATGAAAGGGGAGATGG - Intergenic
904897569 1:33828432-33828454 TGTGGTCAGGTCTGTGGAGATGG + Intronic
906400286 1:45499525-45499547 TGTGGTCCGGAATAAGGTGAGGG - Exonic
906465010 1:46070639-46070661 TGAGCTGCTGAATGTGGAGAAGG - Intronic
906864707 1:49405147-49405169 TGAGGTTCTGAATTTGGAGAAGG - Intronic
907771267 1:57466841-57466863 TGTTGACTTGAAGGTGGAGAGGG - Intronic
909208415 1:72791037-72791059 TGTGGGGCAGAATGTGAAGAGGG - Intergenic
909493925 1:76256897-76256919 AGTAGCCCTGAATGTGGACAGGG - Intronic
909842109 1:80340134-80340156 TGTGGTACTGAATGAACAGAAGG + Intergenic
910213793 1:84821303-84821325 TGTGGACGTGTATGGGGAGAGGG - Intronic
911154030 1:94622058-94622080 CCTGGTCCTGATTCTGGAGATGG + Intergenic
912159688 1:106966696-106966718 TGTGGTAATGAAGGTGGATAAGG - Intergenic
915128244 1:153680220-153680242 AGTGGAGCTGAAGGTGGAGAAGG - Intronic
916559909 1:165925737-165925759 TATGCTCCAGACTGTGGAGAGGG + Intergenic
917186521 1:172362722-172362744 TGAGGTGCAGAATGTGGAAAGGG - Intronic
917208067 1:172598941-172598963 TGTGTACCTGTGTGTGGAGAGGG - Intronic
918988577 1:191666360-191666382 TGTTGTCTTGAATTTGGAGGGGG + Intergenic
923451973 1:234126536-234126558 TGTGGTCTTGACTGTAGTGATGG - Intronic
923522370 1:234745424-234745446 TGTGGGCCTGACTGTGGTGAGGG - Intergenic
923773899 1:236961286-236961308 TGTGCTGCTGGCTGTGGAGATGG - Intergenic
924933597 1:248749618-248749640 TGATGTCATGAATGTGGAGGTGG - Intronic
924940488 1:248810057-248810079 TGTGAGCATGAATGTAGAGAAGG - Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1063029202 10:2214776-2214798 TGGGGTCCTGCATGTGCAGCTGG + Intergenic
1063922819 10:10948934-10948956 CCTGCTCCTGAGTGTGGAGAAGG + Intergenic
1065398731 10:25271510-25271532 TGTGCTCCTGGAAGTGGTGATGG + Intronic
1068045065 10:51876171-51876193 TGTGTTCATGGATGTGGGGAGGG - Intronic
1069109423 10:64427072-64427094 TGTGGTTGTTTATGTGGAGAGGG - Intergenic
1069117337 10:64524088-64524110 TGTGGTAATAAATGTGAAGAAGG + Intergenic
1069663897 10:70142502-70142524 TGTTCTCCTGATGGTGGAGAGGG - Intronic
1069859339 10:71460769-71460791 CCTGCTCCTGAATGTGGAGTTGG + Intronic
1070313369 10:75289418-75289440 TGTGGTCAGGAATTTGGATAGGG + Intergenic
1070826053 10:79391237-79391259 GCTGATCCTGAATGTGGAGATGG + Intronic
1070962012 10:80505786-80505808 TGTGGCCCTGAGTGTGGAGCTGG + Intronic
1071532973 10:86402910-86402932 TAAGGACCTGAATGTGGTGATGG + Intergenic
1074687113 10:115971510-115971532 TTTGGTCCTGTAGGTGGGGATGG + Intergenic
1074737476 10:116451478-116451500 TGTGGTCATCAATTTGGAGGTGG + Intronic
1076483280 10:130799044-130799066 ACTGGTCCTGAGTGAGGAGACGG + Intergenic
1076562275 10:131375043-131375065 TGTGGGCCTGAATAGGGTGAAGG + Intergenic
1078093185 11:8280273-8280295 TGAGGGCCTGCATTTGGAGAGGG + Intergenic
1078489135 11:11753200-11753222 TGTGGTCCTGAGACTGGAGTGGG - Intergenic
1079239829 11:18714532-18714554 TGTAGTGCTGAATGACGAGAAGG - Exonic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1080003180 11:27374558-27374580 TGTGTTCCTGAATACGGAGCTGG - Intronic
1080397614 11:31904307-31904329 TGTGCTCCTGTCTGTGGAGGAGG + Intronic
1081867233 11:46366595-46366617 TGTGGGCATGAATGAGGAGGAGG + Exonic
1082979624 11:59107500-59107522 GGTGTTCCTGAATCTCGAGAGGG + Intronic
1083697139 11:64450356-64450378 TGGGGCCCTGACTTTGGAGAAGG - Exonic
1085112500 11:73900329-73900351 TGTGGTCCTGAGTGGGGGAATGG + Exonic
1085359651 11:75875793-75875815 TGTGGTCCTCAGTGTGGAGAGGG + Intronic
1087551391 11:99654913-99654935 AGTGTCCCTGAATGAGGAGATGG + Intronic
1088122155 11:106382559-106382581 CCTGGTCCAGAATGTGGACATGG - Intergenic
1089004279 11:115077959-115077981 TGTGGTAGTGAAAGTGGAGGAGG - Intergenic
1091625058 12:2115389-2115411 CGTGGAGCTGACTGTGGAGATGG - Exonic
1092763060 12:11826822-11826844 TGTGGCCCTGGAAGGGGAGACGG + Intronic
1093593558 12:20936046-20936068 TATGCTCCTGAATGAGCAGAGGG - Intergenic
1094007431 12:25770284-25770306 TGTTGTTCTGAATGCAGAGATGG - Intergenic
1095662736 12:44756581-44756603 TGAGATTCAGAATGTGGAGATGG - Intronic
1095981685 12:47977966-47977988 GGTGGCCCTGATTGGGGAGAGGG - Intronic
1096599458 12:52718962-52718984 TGTGGTCCTGAAGAAGGTGAGGG - Intergenic
1098244224 12:68499819-68499841 TGTGTGCCAGAATGTGGAAAAGG + Intergenic
1100871299 12:98913322-98913344 TATGGTCCTGAATGTCAAGGAGG - Intronic
1102536864 12:113588258-113588280 GGTGGTGTTGAAAGTGGAGATGG + Intergenic
1102698368 12:114817627-114817649 GGTGATTCTGAATGAGGAGATGG + Intergenic
1103536513 12:121637412-121637434 TGTGGTCCTGACTGCATAGAGGG + Intronic
1103915161 12:124372347-124372369 TGTGGTCCCCAAGGAGGAGAAGG - Exonic
1104398445 12:128455442-128455464 TGTGGTCCTGAAAGATGACAAGG + Intronic
1108302769 13:49096128-49096150 TGTGCTCCTGACTGTGGTTATGG + Intronic
1108375766 13:49812757-49812779 TGTGGTCCTACAAGAGGAGAGGG + Intergenic
1111675184 13:91377743-91377765 TGTTTTCCACAATGTGGAGATGG + Intergenic
1113763655 13:112867475-112867497 TGTGCTCCTGAATGAGGTGCTGG + Intronic
1114316039 14:21510974-21510996 TCTGCTGCTGAAGGTGGAGAGGG + Intronic
1114476092 14:22995996-22996018 TCTGGTCCTGCATGGGGAAACGG + Exonic
1114678705 14:24464142-24464164 AGTGGTCCTGTATGTGAGGAAGG + Intergenic
1116553889 14:46278530-46278552 TATGGTACTGATTGTGGTGATGG - Intergenic
1117066496 14:52017121-52017143 TGGAGTTCTGAATGTGGAGCAGG - Intronic
1117730986 14:58721463-58721485 TTGGGTCCTAAATGCGGAGAAGG + Intergenic
1117976903 14:61307956-61307978 TGTGGTTCTGACTGTTCAGAAGG - Intronic
1119177749 14:72581709-72581731 TTTGGTCTTGTAGGTGGAGAAGG - Intergenic
1121877016 14:97462300-97462322 TGTGGTCAGGAATTTGGATAAGG - Intergenic
1122208739 14:100161211-100161233 TGTTGTCCTGAGGGTGGAGCTGG - Intergenic
1123198251 14:106637770-106637792 TTTGGACCCGAATTTGGAGATGG + Intergenic
1127005988 15:54570623-54570645 TATGGTCATGAATATTGAGATGG - Intronic
1129935119 15:79440701-79440723 TGTGGTCCTGAAGGAGGCAATGG - Intronic
1130105791 15:80927669-80927691 TGTGGTCCTACGTGTGGACAAGG + Intronic
1132497149 16:269279-269301 TGTGGCCCTGGGGGTGGAGATGG - Exonic
1134428323 16:14175246-14175268 TGTTGTCTTGATTGTGGTGATGG - Intronic
1135768486 16:25198315-25198337 TTTGCTCGTGAATGTGGACAGGG - Intergenic
1136183580 16:28571759-28571781 AGTGGACCTAACTGTGGAGATGG + Intronic
1137684192 16:50374434-50374456 TGTGGTCTTCAAAGGGGAGATGG + Intergenic
1137809404 16:51338559-51338581 TGGGGTCCTGTAGGTGGAGACGG - Intergenic
1138598781 16:58043088-58043110 TGTTGTCTTGAATATGTAGAGGG + Intronic
1140859142 16:79004202-79004224 TGTGGTTCTGAAGGTGCACAGGG - Intronic
1143576122 17:7794348-7794370 TGAGGTCCTCACTGTGGGGAAGG - Exonic
1145866935 17:28247683-28247705 TGTGGCCAGGAATGTGGAGTGGG - Intergenic
1146932590 17:36788155-36788177 TGTTGTCAGGAATTTGGAGAAGG + Intergenic
1147925152 17:43941393-43941415 TGTGGCCAGGAATGTGGAGTGGG + Intronic
1152638414 17:81439577-81439599 GGTTGTCCCGACTGTGGAGAGGG + Intronic
1152797325 17:82314750-82314772 TGTGGCCTTGAAGGTGGGGAAGG - Intergenic
1156385575 18:36601865-36601887 AGTGGTCCTGAATGTGAATGCGG + Intronic
1158060120 18:53330425-53330447 TGTGGTGGTGGGTGTGGAGAAGG - Intronic
1158626877 18:59079238-59079260 TGTGGAGCAGGATGTGGAGAAGG + Intergenic
1162426371 19:10598915-10598937 TGTGGGCATGAATGTGGTCATGG - Intergenic
1162848416 19:13412096-13412118 TGTGGTCATGGAGGTGGGGAGGG - Intronic
1163544339 19:17932175-17932197 ACTGGTCCTGACTGTGGAGAGGG - Intergenic
1163790819 19:19305260-19305282 ACTCGTCCTGAATGTGGACAGGG + Intronic
1165386420 19:35513018-35513040 TGTGGGGCTGCATGTGGAAATGG - Intronic
1165473564 19:36016939-36016961 TGGGGTCCGGACTGTGGTGAAGG + Exonic
1167233306 19:48298395-48298417 TGAGGACCTGAGTGGGGAGAGGG - Intronic
1167792273 19:51689762-51689784 CGGGGTCCAGAATCTGGAGAAGG + Intergenic
1167793754 19:51695828-51695850 TGGGGCCGTGAAGGTGGAGAAGG + Intergenic
924966503 2:81314-81336 TGGGGGCCTGAATGGGTAGATGG - Intergenic
926453092 2:13030629-13030651 TGAAGTCCTGAATGTGAAAATGG + Intergenic
927991316 2:27449332-27449354 TTTGGACCTGTATGTGGAGCAGG - Exonic
929869506 2:45746377-45746399 TCTGGTCCTCACTGTTGAGAAGG + Intronic
931493401 2:62774721-62774743 TGTGGTCCTGACTGTTCAGGAGG + Intronic
932816719 2:74867709-74867731 TGGGCTCCAGAAGGTGGAGATGG + Exonic
933005268 2:76984595-76984617 TATGGTGCTGGAGGTGGAGAAGG + Intronic
933577602 2:84087396-84087418 TGTGTTCCTGGAGATGGAGAGGG - Intergenic
934691635 2:96365200-96365222 TGTGTCCCTGTATGTGGAAAGGG + Intronic
935837845 2:107074836-107074858 TGTGCTCCTGACTGTGGTGTGGG + Intergenic
938948552 2:136236482-136236504 TGGGGGCCTGAATGAGCAGAGGG + Intergenic
939526523 2:143302262-143302284 GGTGGTACTGATTGTGGAGGGGG - Intronic
942153275 2:173100246-173100268 TGTGAGCCTGAATTTGGTGAAGG + Intronic
942571564 2:177320787-177320809 TGTGGGCAGGAGTGTGGAGAGGG - Intronic
942677147 2:178439339-178439361 AGGGGACCTGAAGGTGGAGAAGG - Intronic
944451591 2:199849790-199849812 TGAGGTCCTGAACTTGAAGAGGG - Intronic
944786805 2:203079799-203079821 TGCTGTCCTGAATGTAGACAAGG - Intronic
944977738 2:205076362-205076384 TGTGATGCTAAATGTGGAAAGGG - Intronic
945785783 2:214234780-214234802 TGTGGTCATGAATAAGGAAAAGG + Intronic
946088646 2:217199451-217199473 TCTGTTCCTGAATCTGGTGAAGG + Intergenic
946237425 2:218332677-218332699 GGGGGTGCTGAAGGTGGAGAGGG - Intronic
947128936 2:226901986-226902008 TGTGGTCATGGATGTAGAGTTGG + Intronic
947688925 2:232116681-232116703 TGTGGCTCTGAATGGGGAGAGGG + Intronic
948532026 2:238615163-238615185 TGTGGCCCAGGATGTGTAGAGGG + Intergenic
1170946779 20:20898391-20898413 TGTGATCTTTAATGAGGAGAGGG + Intergenic
1171454529 20:25260100-25260122 TGAGGTCCTGCAGGGGGAGACGG - Intronic
1173125701 20:40334058-40334080 AGTGGTGTGGAATGTGGAGATGG - Intergenic
1174168970 20:48604589-48604611 TGTGGTCCTTAAAGTGGGGACGG - Intergenic
1178775638 21:35547845-35547867 TGTGGTCCTAAATGAGGGGGTGG - Intronic
1179253763 21:39697505-39697527 TGTGGCCCTAAATTTGGACAGGG - Intergenic
1180006311 21:45022603-45022625 TGTGGTTCTTTATGTGGACAGGG - Intergenic
1180230526 21:46424354-46424376 CCTGGTCCTGAGTGTGGAGATGG + Intronic
1182008940 22:26984404-26984426 GGTGGTCTTGAAGGTTGAGAGGG + Intergenic
1182966287 22:34524550-34524572 TGTGCTCCAGTGTGTGGAGAAGG - Intergenic
1184132690 22:42526907-42526929 TCTGCTCCTGAATTAGGAGAAGG + Intergenic
1185004992 22:48270542-48270564 TGCTGGCTTGAATGTGGAGAGGG + Intergenic
949634054 3:5963060-5963082 GGAAGTCCTGAAGGTGGAGAAGG + Intergenic
950656668 3:14440972-14440994 TGGGGTCCTGAGTGTGGAAGGGG + Intronic
951535259 3:23734670-23734692 CCTGGACCTGAATGTTGAGAAGG + Intergenic
952139522 3:30462766-30462788 TATGTTCTTGCATGTGGAGAGGG - Intergenic
954080007 3:48208019-48208041 TCTGGACATGAATATGGAGAGGG - Intergenic
954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG + Intronic
958024050 3:88029108-88029130 AGTGGTCATGATGGTGGAGATGG - Intergenic
960922658 3:122763341-122763363 TGTCATCTTGAATGTGGTGATGG + Intronic
961088438 3:124090067-124090089 TAAGGTCCTGAAGGAGGAGAGGG + Intronic
965924149 3:173957713-173957735 TATGGTCCTGAATGTAGATTTGG + Intronic
966135478 3:176693520-176693542 TGTGGTGCTGGTGGTGGAGAGGG - Intergenic
967174982 3:186854569-186854591 TGTGCTCCTGCATCTGGAGGTGG + Exonic
968768594 4:2488582-2488604 TGTGGGGCTGAGTGTGGTGATGG + Intronic
968880312 4:3295135-3295157 TGAGGTCCTGGAGGTGGTGAGGG + Intronic
969426112 4:7124956-7124978 TGTGGTCCTGAGGTAGGAGACGG - Intergenic
969888542 4:10238481-10238503 TGTGGACCTGGGTGTGGAGCAGG - Intergenic
970222692 4:13826520-13826542 AGTGGTGATGAATGTGGGGAAGG - Intergenic
970888026 4:21008941-21008963 TGTGATCCTGAATTTGGGGGAGG - Intronic
970924413 4:21434499-21434521 AGTGGTCCTGGGTGGGGAGAGGG - Intronic
972683379 4:41328535-41328557 TGTGAAGATGAATGTGGAGAAGG + Intergenic
974242848 4:59274115-59274137 TGTGGTCCTGATGCTGGGGAAGG - Intergenic
974266878 4:59597489-59597511 TGTGTTCCTGTGTGTGGAGGTGG - Intergenic
975721342 4:77251434-77251456 TGTGGTGCCAAATATGGAGACGG + Intronic
975724571 4:77279418-77279440 TGTGGTGCCAAATGTGGAGACGG + Intronic
976665815 4:87589874-87589896 CAGGGTGCTGAATGTGGAGATGG - Intergenic
979007892 4:115325967-115325989 TCTGGTCCTGAATGTGGCAGTGG - Intergenic
983332740 4:166352321-166352343 AGGGTGCCTGAATGTGGAGAGGG + Intergenic
983417380 4:167475950-167475972 TGTGGTTCTGGATCTTGAGAAGG - Intergenic
983611218 4:169647266-169647288 TGTGGTCCTCAATATGCAGGAGG + Intronic
984342861 4:178481393-178481415 TGTTTTCTTGTATGTGGAGATGG + Intergenic
985131648 4:186744640-186744662 TGTGCTCCTGAATGTCCTGAAGG - Intergenic
985223477 4:187732866-187732888 TGTTGACTTGAATGTGCAGAAGG + Intergenic
988293695 5:29326164-29326186 TGTGTTACTGAATGTATAGAAGG - Intergenic
990115270 5:52382036-52382058 TGTGGTAGTGTATCTGGAGAAGG - Intergenic
990546565 5:56827503-56827525 TGTGGTCCTGAATGTGGTTTTGG + Intronic
990810677 5:59719293-59719315 GATGGCCCTGAATGTGGAGTTGG + Intronic
992180735 5:74195839-74195861 TGTGGTCCTGAAGATGTGGATGG + Intergenic
996127265 5:119740736-119740758 TGTGGGGCTGAAGCTGGAGATGG + Intergenic
997814247 5:137000609-137000631 TGGGAGCATGAATGTGGAGAAGG + Intronic
998065988 5:139159121-139159143 TGTGCTGCTAAATGAGGAGATGG - Intronic
999194036 5:149769924-149769946 TGTGGTTCAGAATACGGAGATGG - Intronic
1002613928 5:180438668-180438690 TGTGTTCCCCAGTGTGGAGACGG + Intergenic
1003023920 6:2536602-2536624 TGTGGTCTTGAAGGTCGAGAGGG + Intergenic
1003564656 6:7213045-7213067 TGAGGTCCTGTATGAGCAGAGGG - Intronic
1004074572 6:12333244-12333266 TGTGGTTCAAAATATGGAGATGG - Intergenic
1005074751 6:21896150-21896172 TGGGGACCTGGATGTGGGGAAGG + Intergenic
1005310910 6:24557941-24557963 TGTCATCCTGATTGTAGAGATGG + Intronic
1006288725 6:33117514-33117536 TGTGGAGATGAAGGTGGAGATGG + Intergenic
1007753805 6:44085946-44085968 TGTGGTCCTCATTGTGGACCGGG - Intergenic
1008215361 6:48781765-48781787 TGTGCTCCTGAATGGAGAGTAGG + Intergenic
1013958248 6:115866122-115866144 TGGTGACCTGAATTTGGAGAAGG - Intergenic
1014576021 6:123073908-123073930 TGTGGTTCTGACTGTGGGTAAGG - Intergenic
1015062621 6:128985133-128985155 CATGGTCCTGAATGTGGAATGGG + Intronic
1015496608 6:133889690-133889712 GGTGGTCTTGAGTCTGGAGAAGG - Exonic
1016701129 6:147055410-147055432 CGTGTTCTTCAATGTGGAGAAGG - Intergenic
1017505638 6:155066255-155066277 TGTGAGGCTGAAAGTGGAGATGG - Intronic
1019093565 6:169560578-169560600 TGTGGCTCTGAATTTGAAGATGG + Intronic
1019430065 7:994965-994987 AGTGCTCCTCACTGTGGAGAGGG - Intergenic
1021901608 7:25291142-25291164 TGTGGCCCTGAAGTTGGTGATGG + Intergenic
1022226898 7:28372298-28372320 TGTTTTCCTGAATTTGGGGAGGG + Intronic
1022232047 7:28423635-28423657 TGTGGTGCTGAATTGGGGGATGG + Intronic
1024323023 7:48088739-48088761 GGTGGTCGGGAATGTGGAGCTGG - Exonic
1024395341 7:48859800-48859822 TGAGGCCTTAAATGTGGAGATGG - Intergenic
1024399895 7:48912486-48912508 TGAGGCCTTAAATGTGGAGATGG + Intergenic
1024895696 7:54259364-54259386 AGTTGTCCTGAATGGGGTGAAGG + Intergenic
1027359696 7:77395301-77395323 TGTGTTCCTGGAGGTGGTGAGGG - Intronic
1027647519 7:80821946-80821968 TGTGGTCTTGTGTGTGGGGAGGG - Intronic
1029732286 7:102446472-102446494 AGTGGTGCTGGGTGTGGAGAGGG - Intronic
1030599334 7:111575162-111575184 TGTGCTCCTGAATGATGAGCAGG + Intergenic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1031991691 7:128202867-128202889 GGTGGTCCTGTCTGTGCAGAGGG + Intergenic
1033369925 7:140698224-140698246 CTTGGTCCTGCATGAGGAGATGG + Intronic
1034252643 7:149704774-149704796 TGTGGCCTTGGCTGTGGAGATGG - Intergenic
1034434894 7:151058721-151058743 TGTGGTCTTGTCTGTGGAGGGGG - Exonic
1034736851 7:153437282-153437304 TGTGGTGCTGGATTTGGAGTTGG - Intergenic
1035352064 7:158253989-158254011 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352078 7:158254063-158254085 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352092 7:158254137-158254159 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352109 7:158254214-158254236 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352124 7:158254288-158254310 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352139 7:158254362-158254384 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352156 7:158254436-158254458 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352171 7:158254510-158254532 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352185 7:158254584-158254606 GATGCTCCTGAACGTGGAGATGG - Intronic
1035352200 7:158254658-158254680 GATGCTCCTGAACGTGGAGATGG - Intronic
1035400653 7:158563184-158563206 TGTGGTCCTGCCTTGGGAGAAGG - Intronic
1036083728 8:5589641-5589663 AGTGGGACTGGATGTGGAGATGG - Intergenic
1036579244 8:10057275-10057297 TCTTGCCCTGTATGTGGAGATGG + Intronic
1037989433 8:23309879-23309901 CCTGGTCCTCAATGCGGAGATGG - Exonic
1038883872 8:31641138-31641160 TGGAGTCCAGAGTGTGGAGATGG + Intronic
1038932921 8:32215271-32215293 TGTGGTCCCAAAAGTTGAGAAGG + Intronic
1041360464 8:57047452-57047474 TGGGATCCTAAGTGTGGAGAGGG - Intergenic
1041694170 8:60718089-60718111 AGTGGCACAGAATGTGGAGATGG + Intronic
1042715744 8:71770492-71770514 TTTGGTCCTGAAACTGGAAATGG - Intergenic
1044699243 8:94950787-94950809 CTTGGTTCTGAATGTGGAGATGG - Intronic
1049364438 8:142230196-142230218 TCAGGTCCTGAATGTGGGGTGGG + Intronic
1050027589 9:1351801-1351823 TGTGGTCTTGAATGTTAAAAGGG - Intergenic
1050514259 9:6426393-6426415 TGTGCTCCTAAATGGGGAAAGGG - Intronic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1053668285 9:40333351-40333373 TGTGGACCAGAATTTGGAGCAGG + Intergenic
1053918090 9:42959644-42959666 TGTGGACAAGAATTTGGAGAAGG + Intergenic
1054379427 9:64473403-64473425 TGTGGACCAGAATTTGGAGCAGG + Intergenic
1054516327 9:66042942-66042964 TGTGGACCAGAATTTGGAGCAGG - Intergenic
1055122524 9:72678341-72678363 TGTTGTCTTCAATGTGGAAATGG - Intronic
1056733455 9:89184939-89184961 TTTGGTCCTGGAGCTGGAGATGG - Intergenic
1057262482 9:93592908-93592930 TGTGGTCCTCCAGTTGGAGAGGG - Intronic
1057969134 9:99536607-99536629 TGTCTGCCTGAATGGGGAGAGGG - Intergenic
1059283794 9:113155953-113155975 TTTGGTCCTAACTGTTGAGAGGG + Intronic
1060934456 9:127507192-127507214 TGTGGTCCAGGATGAGGAGGTGG - Exonic
1062598603 9:137310164-137310186 TGTGGCCCTGAAAGTGGCGAGGG + Intronic
1203549163 Un_KI270743v1:153824-153846 TGGGGCCCGGCATGTGGAGAGGG + Intergenic
1185431258 X:13410-13432 TGTGGTCCAGAGGGTGGAGCAGG - Intergenic
1185440525 X:225807-225829 TGTGGTCCAGAGGGTGGAGCAGG - Intergenic
1188389734 X:29604918-29604940 TGTTGGCCTGGGTGTGGAGAAGG - Intronic
1188518202 X:31010231-31010253 TGTGTTCCTGGAATTGGAGAAGG - Intergenic
1188964165 X:36530269-36530291 TGCTGTCCTAAAGGTGGAGATGG + Intergenic
1189059758 X:37740016-37740038 TATGGTCCTGAATGAGTAGTGGG + Intronic
1190517687 X:51242141-51242163 TGTGATCCTCAAAGTGGAGGTGG + Intergenic
1191924325 X:66293204-66293226 TGTGCTCCTGAATGACCAGAGGG - Intergenic
1192184508 X:68937759-68937781 TGTGATGCTGAAGGTGGTGATGG + Intergenic
1192636007 X:72818703-72818725 TGTGTTCCTGAATGAGCAGTGGG - Intronic
1192645707 X:72902102-72902124 TGTGTTCCTGAATGAGCAGTGGG + Intronic
1192699439 X:73452211-73452233 GGTGTTCCTGAATGTAAAGAGGG + Intronic
1193360541 X:80574286-80574308 TGGGCTCCAGAAGGTGGAGATGG - Intergenic
1193848101 X:86499965-86499987 TGAGGTCCTCAATGTGAAGTTGG + Intronic
1194368248 X:93035924-93035946 TGTGACCCTAAATGTGGATAAGG + Intergenic
1195851598 X:109288295-109288317 TGATGTCCAGGATGTGGAGATGG - Intergenic
1196882501 X:120211474-120211496 TGTGGGCCTCAATGTGAACAAGG - Intergenic
1198639533 X:138741539-138741561 TGGGGTACTGAGGGTGGAGAGGG - Intronic
1199755930 X:150865137-150865159 AGTGGTGCTTAATGAGGAGAGGG + Intronic
1199813270 X:151371661-151371683 TGTGGCCCTGGTCGTGGAGAGGG - Intergenic
1200676458 Y:6152189-6152211 TGTGACCCTAAATGTGGATAAGG + Intergenic
1200924293 Y:8640654-8640676 TGTTGGCCTGTAAGTGGAGATGG + Intergenic