ID: 954384250

View in Genome Browser
Species Human (GRCh38)
Location 3:50236154-50236176
Sequence CACCGACGGCGGGGCGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954384250_954384263 14 Left 954384250 3:50236154-50236176 CCCGGCCCGCCCCGCCGTCGGTG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 954384263 3:50236191-50236213 AGGCGCCTCCCGCAGTCGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 126
954384250_954384262 -6 Left 954384250 3:50236154-50236176 CCCGGCCCGCCCCGCCGTCGGTG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 954384262 3:50236171-50236193 TCGGTGCGCGGCGGTAGGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 75
954384250_954384260 -10 Left 954384250 3:50236154-50236176 CCCGGCCCGCCCCGCCGTCGGTG 0: 1
1: 0
2: 1
3: 24
4: 281
Right 954384260 3:50236167-50236189 GCCGTCGGTGCGCGGCGGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954384250 Original CRISPR CACCGACGGCGGGGCGGGCC GGG (reversed) Exonic
900175076 1:1287977-1287999 CACCGCCGGCGGGGAAGGCGTGG + Exonic
900694090 1:3999566-3999588 CACTGCCGACGGGGCGGGCATGG + Intergenic
900694106 1:3999625-3999647 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694120 1:3999684-3999706 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694151 1:3999802-3999824 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694165 1:3999861-3999883 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694178 1:3999920-3999942 CACTGCCGACGGGGCGGGCCTGG + Intergenic
900975524 1:6013812-6013834 AACCGACTGCTGGGGGGGCCCGG - Intronic
901030639 1:6305219-6305241 CCCGGACGGGGCGGCGGGCCGGG + Intronic
901242631 1:7704241-7704263 CCCCGACGGCGCGGGGAGCCAGG + Intronic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903597131 1:24503156-24503178 CACCCAGCGCGGGGCGGGGCGGG + Intronic
903633957 1:24799568-24799590 CCCCGACGGGGCGGCTGGCCGGG - Intronic
903633982 1:24799617-24799639 CCCCGACGGGGCGGCTGGCCGGG - Intronic
903855747 1:26336804-26336826 CTCCGGGAGCGGGGCGGGCCCGG - Intronic
904560738 1:31395514-31395536 GACAGAAGGCGGGGCGGGCGCGG - Intergenic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
905517173 1:38570273-38570295 CACCCACCGCGGGGCAGGCCGGG + Intergenic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
906256573 1:44355141-44355163 CGCCGACTGCGGCGCCGGCCAGG + Exonic
906640589 1:47438464-47438486 CCCCGACGGCGGTCCCGGCCCGG - Exonic
906740113 1:48174376-48174398 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
907402523 1:54233556-54233578 CCCCGACGGGGCGGCTGGCCGGG - Intronic
907905666 1:58782485-58782507 CTCCTACGGCGCGGCCGGCCTGG - Exonic
907920014 1:58903661-58903683 CAGTGGCGGCGGGGCGGGGCAGG + Intergenic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
914825901 1:151137970-151137992 CTCCGAGGTCAGGGCGGGCCTGG - Exonic
915253501 1:154608025-154608047 TGCCGCCGGCGGGTCGGGCCGGG - Exonic
915748238 1:158181522-158181544 CACCGACGGCTTGGCGTGGCTGG + Exonic
916233343 1:162561653-162561675 CCGCGGCGGCGGGGCGGGCCGGG - Exonic
916694351 1:167221205-167221227 GAGCGGCGGCGGGGTGGGCCGGG - Intronic
920152404 1:203919743-203919765 CACGGACGGGGCGGCTGGCCGGG + Intergenic
920367725 1:205456916-205456938 CGCGGAGGGCGGGGTGGGCCGGG - Intergenic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
923566994 1:235083721-235083743 CCCAGATGGCGGGGCGGGGCTGG + Intergenic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
1063443081 10:6089172-6089194 CAGAGTCGGCCGGGCGGGCCGGG + Intronic
1063744998 10:8869313-8869335 CACGGACGGGGCGGCTGGCCGGG - Intergenic
1067025072 10:42837207-42837229 CCCCGGCTGCTGGGCGGGCCGGG + Intergenic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1069052549 10:63811296-63811318 CCCGGACGGGGGGGCTGGCCCGG + Intergenic
1072151714 10:92689776-92689798 CTTGGCCGGCGGGGCGGGCCGGG + Intergenic
1075000709 10:118795143-118795165 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1075128910 10:119722372-119722394 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1075871274 10:125774020-125774042 CCCCGACGGCGGAGCTGCCCAGG - Exonic
1076776484 10:132700641-132700663 CACAGAGGGAGGGGCGGGCCCGG - Intronic
1076895460 10:133309186-133309208 CTACGACTGCGGGGCGGGGCCGG + Intronic
1077060330 11:615065-615087 CACCCGGGGCGGGGCGGGGCTGG + Intronic
1077204654 11:1336683-1336705 CGGCGAGGGCGGGGCGGGGCGGG + Intergenic
1079451754 11:20604446-20604468 CGCCTGCGGCGGGGCGGGGCGGG + Intronic
1080595999 11:33774606-33774628 CCCTGAGGGCGGGGCTGGCCCGG - Intergenic
1080802071 11:35618556-35618578 TCCCGGCGGCGAGGCGGGCCCGG - Exonic
1083342654 11:61968298-61968320 CAACAAAGGCTGGGCGGGCCGGG + Intergenic
1084005782 11:66322857-66322879 GCCCGGCGGCAGGGCGGGCCGGG + Intergenic
1084265612 11:68003869-68003891 CGGCGGGGGCGGGGCGGGCCGGG - Intronic
1085111885 11:73896948-73896970 CCCCGACGGGGCGGCTGGCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1089242974 11:117097987-117098009 CAGCCGCGGCGGGGCGGGCGCGG - Intronic
1089420689 11:118330933-118330955 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1089421037 11:118331733-118331755 CCCGGACGGCGCGGCTGGCCGGG + Intergenic
1089543574 11:119206005-119206027 CCCCTACGCCGGGGCGGGGCGGG - Intergenic
1089585511 11:119507768-119507790 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1089632851 11:119794311-119794333 CCCCAACGGCGGGGAGGGCTGGG - Intergenic
1090832327 11:130428184-130428206 CCCCGGCTGCGGGCCGGGCCGGG + Exonic
1091144074 11:133261971-133261993 CACCCACGGCAGGGCAGGACAGG - Intronic
1092140595 12:6180708-6180730 CACCCACTGCGGGGCAGGCCTGG + Intergenic
1094087395 12:26608639-26608661 CACAGACTGTGGGGCGGGCCAGG - Intronic
1094466103 12:30754997-30755019 GGCCGAGGGCGGAGCGGGCCGGG - Intergenic
1097028475 12:56075756-56075778 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1097664789 12:62466715-62466737 GGCCGTCGGCGGGGCGGGGCTGG - Intergenic
1100166589 12:91923998-91924020 CACGGACGGTGGGGAGGCCCAGG + Intergenic
1100468824 12:94873129-94873151 CGCCGTCGGCGGGCCGTGCCTGG + Intergenic
1103479619 12:121242519-121242541 CACCCAAGGCGGGGCTGCCCAGG + Intronic
1103704735 12:122865402-122865424 CAGCGACGGCGAGCCCGGCCAGG + Exonic
1112420346 13:99242476-99242498 CCCCGACGGGGCGGCTGGCCGGG + Intronic
1112420448 13:99242702-99242724 CCCCGACGGGGCGGCTGGCCTGG + Intronic
1112438478 13:99408326-99408348 CACCACCGGCGGGGCAGCCCAGG - Intergenic
1115689340 14:35826844-35826866 TCCCGGCGGCGGGGCGGGGCGGG + Intronic
1117716658 14:58588494-58588516 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1118312513 14:64704373-64704395 GAGCGAGGGAGGGGCGGGCCAGG - Intronic
1119254418 14:73184410-73184432 CTCCGACGGGGCGGCTGGCCTGG + Intronic
1121042138 14:90758317-90758339 CCAGGACGGCGGGGCGGGGCGGG + Intronic
1123019661 14:105391721-105391743 CACCGACGGGGAGGAGGGCGGGG - Exonic
1124765365 15:32483579-32483601 CACAGACGGCAGGGGGGCCCAGG - Intergenic
1125659273 15:41382750-41382772 CCCCGACGGGGTGGCTGGCCGGG - Intergenic
1125868590 15:43076997-43077019 CCCCGACGGGGCGGCTGGCCAGG - Intronic
1126295723 15:47133346-47133368 CCCCGACGGGGCGGCCGGCCGGG - Intergenic
1127588404 15:60398566-60398588 CTCGGAGGCCGGGGCGGGCCAGG - Intronic
1128071267 15:64799020-64799042 CCCGGACGGCGTGGCTGGCCGGG + Intergenic
1131215081 15:90529847-90529869 CACCCTCGGCGGGGCCCGCCCGG - Intergenic
1131215091 15:90529859-90529881 CGCCGAGGGTGGGGCGGGGCCGG + Intergenic
1132498441 16:274586-274608 AACCGACGGCAGGTCGGCCCGGG + Intronic
1132560074 16:589603-589625 CGCCGGCGACGGGGCGGGCGAGG + Intronic
1132641607 16:980872-980894 CCCCTCCGGCGGGGCGGCCCTGG - Intronic
1132679863 16:1135251-1135273 CACAGACGGCTGGGCAGGGCAGG + Intergenic
1132805563 16:1773580-1773602 CCCCGACTGGGAGGCGGGCCCGG - Intronic
1132841321 16:1979699-1979721 CACCGCGGGCAGGGCGGGCCAGG - Exonic
1132933827 16:2471391-2471413 CACCGAGGGCCGGGCGGAGCAGG - Intergenic
1133231945 16:4371079-4371101 CACCGTCGGTGGGTGGGGCCTGG - Intronic
1134134048 16:11668341-11668363 CTGGGACGGCGGGGCGGGGCGGG - Intergenic
1135639640 16:24109177-24109199 CCCCGACGGGGCGGCTGGCCGGG + Intronic
1139750409 16:69106366-69106388 CGCCGAGGCCGGGGCGCGCCGGG + Intronic
1140427744 16:74875034-74875056 CCCCGACGGCTGGCAGGGCCTGG + Intronic
1142349887 16:89575195-89575217 CCCCGAGGCCGGGGCGGGGCGGG - Intergenic
1143283391 17:5771487-5771509 CACGGAGGTCGGGGCGGGCGGGG - Intergenic
1143527000 17:7478945-7478967 CCCCGACGGCGCGGCGGTTCCGG + Intronic
1143527302 17:7479829-7479851 CACCGAGCGGGGCGCGGGCCGGG + Intronic
1143904684 17:10198901-10198923 CACTGGCGAGGGGGCGGGCCGGG + Intergenic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1145941216 17:28744278-28744300 CAGCGGGGGCGGGGCGGGGCGGG + Intronic
1146716348 17:35089482-35089504 TCCCGACGGCGGGGCCGGGCTGG + Intronic
1147150309 17:38510360-38510382 CACTGAGGGCGCGGCGGGCGCGG + Exonic
1147852385 17:43452439-43452461 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1148110956 17:45144459-45144481 CCCCGACGGGGCGGCGGGCTGGG - Intergenic
1148664063 17:49361817-49361839 CGCCGCCCGCGGGGCCGGCCCGG - Intronic
1148760499 17:49997275-49997297 CACAGTCTGCGGGGCGGGGCAGG - Intergenic
1148830176 17:50426116-50426138 CTCCGCCGGCGGGGCGGGGCGGG - Intergenic
1150060549 17:62065282-62065304 CACAGACACCGGGGAGGGCCGGG + Exonic
1150488790 17:65560928-65560950 CCCCGACGCCGCGGCCGGCCCGG - Intronic
1151662383 17:75525686-75525708 CACCTCCGGCGCGGCGAGCCTGG - Intronic
1152222272 17:79075251-79075273 CGAGGACGGCGGGGCGGACCGGG - Intronic
1152225405 17:79090467-79090489 CAGCGGCGGCGGAGCAGGCCCGG - Intronic
1152226303 17:79094419-79094441 CACCCAGGGCTGGGCGGGCCTGG + Intronic
1152697492 17:81804305-81804327 CAGAGACCGCGGGGCGGGCGCGG + Intronic
1152785397 17:82245344-82245366 CACCGACGGCGGGGAGTGAGTGG + Intronic
1152861456 17:82698742-82698764 CACCAATGGCGGGGCCGGGCGGG - Intergenic
1153006275 18:500805-500827 GGCCGAGGGCGGGGCGGGCGCGG - Intergenic
1153040884 18:812236-812258 CAACGACGGCAGAGCCGGCCCGG + Intronic
1157492791 18:48136138-48136160 CAGCGGCCGCGGGGCTGGCCTGG - Intronic
1158934780 18:62354497-62354519 CACCGAGTGCGCGCCGGGCCTGG + Exonic
1158976820 18:62716854-62716876 CCGGGACGGCGGGGCTGGCCCGG - Exonic
1160930503 19:1567761-1567783 CGCGGACGGCGGGGCGGCTCCGG - Exonic
1161454264 19:4362296-4362318 CACTGAGGTCGAGGCGGGCCTGG + Intronic
1162373692 19:10293116-10293138 CTCCGACGGCGGGGCCGTGCTGG + Exonic
1162398310 19:10430676-10430698 CCCCCAGGGCGGGGCGGGTCTGG - Intronic
1162935336 19:13979011-13979033 CTCCGGCGGCGGCGTGGGCCGGG + Intronic
1164081687 19:21865749-21865771 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1164105913 19:22107467-22107489 CCCCGACGGGGCGGCTGGCCAGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165922447 19:39307558-39307580 CACGGACGCTGGGGCGGGACTGG - Exonic
1165956321 19:39504015-39504037 CACCAACGTCGGGGAGGGCCAGG - Intronic
1166206693 19:41274523-41274545 GACAGACAGCAGGGCGGGCCAGG - Intronic
1166547048 19:43639899-43639921 CGCCGAGGCCGGGGCGGGGCCGG + Intergenic
1166857918 19:45792475-45792497 CACGGCGGGCAGGGCGGGCCCGG + Exonic
1167071728 19:47226130-47226152 CCCGGGCGCCGGGGCGGGCCGGG - Intronic
1168272632 19:55258483-55258505 CGCCGGCGGCGGGGCGGGGGGGG - Exonic
1168307317 19:55442650-55442672 CCCCGCGGGCGGGGCGGGCGCGG - Exonic
925406489 2:3608798-3608820 CATCCACGGCGGGGCTGCCCTGG - Intronic
926268120 2:11344484-11344506 CCCAGAGGGCGGGGCGGTCCGGG - Exonic
926703682 2:15821321-15821343 CAGCCACGGGTGGGCGGGCCTGG - Intergenic
927216626 2:20671068-20671090 CAGCGGCGGGGGCGCGGGCCGGG + Exonic
928558011 2:32447624-32447646 CCCGGACGGCGCGGCTGGCCGGG + Intronic
929516123 2:42605938-42605960 CCCCGACGGGGCGGCTGGCCGGG + Intronic
929604665 2:43226554-43226576 CTCCGCGGGGGGGGCGGGCCGGG - Exonic
929614606 2:43297615-43297637 CCCGGACGGGGGGGCTGGCCGGG - Intronic
931877156 2:66526383-66526405 CACCCATGGCAGGCCGGGCCTGG + Intronic
934031859 2:88055592-88055614 CCCCGGCGGCGGGGGCGGCCCGG - Intronic
934717025 2:96550283-96550305 GAGGTACGGCGGGGCGGGCCCGG + Exonic
936038326 2:109129651-109129673 CACCGCCGCGGGGGCGGGCGAGG + Exonic
937283505 2:120736134-120736156 CAGCCGGGGCGGGGCGGGCCAGG - Intronic
939969661 2:148644965-148644987 CGGCGGCGGCGGGGCGGGCGGGG - Exonic
942754167 2:179319779-179319801 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
943297119 2:186154029-186154051 CCCAGACGGCGCGGCTGGCCGGG + Intergenic
944582122 2:201140146-201140168 CGGCAGCGGCGGGGCGGGCCAGG + Intronic
944585108 2:201166230-201166252 CCCCGACGGGGCGGCTGGCCGGG + Exonic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
948115772 2:235493827-235493849 CGCCCCCGGCGGGCCGGGCCAGG - Intergenic
948467416 2:238159013-238159035 CTCCGGCGGGGCGGCGGGCCGGG - Exonic
948854753 2:240724925-240724947 CACCGGCGGCGGGGGGGGGGGGG + Intronic
948894554 2:240922129-240922151 CACTGACGGCTGGGCTGCCCAGG + Intronic
1170578349 20:17681193-17681215 GGCCGCGGGCGGGGCGGGCCGGG + Intronic
1172006693 20:31823016-31823038 CACCCATGGCGGGGCGGGACCGG - Intronic
1172101219 20:32484584-32484606 GACCGGCGGCGGGGCGGGGGCGG - Intronic
1172907308 20:38379073-38379095 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1173273025 20:41555127-41555149 CCCCGACGGGGCGGCTGGCCGGG + Intronic
1173279838 20:41618250-41618272 CCCGGCCGGCGGGGCGGGGCCGG + Intronic
1174494558 20:50930746-50930768 CACTGGCGGCCGCGCGGGCCGGG + Intronic
1175199117 20:57266158-57266180 CACCTGGGGCGGTGCGGGCCCGG - Exonic
1175220109 20:57411918-57411940 CAACGACGGCAGCGTGGGCCAGG + Intergenic
1175368367 20:58470716-58470738 CACCGGCGGCTGGGGAGGCCGGG - Exonic
1175429502 20:58891621-58891643 CAGCGCCGGGCGGGCGGGCCGGG - Intronic
1175926545 20:62474236-62474258 CGCCGGCGCCGGGCCGGGCCTGG - Intronic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176084021 20:63287783-63287805 CAGCGACGGCGGGGAGGGCGGGG + Exonic
1176242127 20:64080027-64080049 CGCGGCGGGCGGGGCGGGCCCGG - Intergenic
1178075735 21:29011959-29011981 CCCGGACGGCGCGGCTGGCCGGG - Intronic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1179162950 21:38912893-38912915 TGCAGACGGCGGGGAGGGCCTGG + Intergenic
1179437177 21:41369846-41369868 CAGCCACGGCGGGGCGGGAGCGG - Intronic
1179810201 21:43865234-43865256 CCCCGACGCAGGGCCGGGCCGGG + Intronic
1179888255 21:44323709-44323731 CACCGAGGCCAGGGTGGGCCGGG - Intronic
1179968274 21:44818882-44818904 CATGGAGGCCGGGGCGGGCCAGG - Intergenic
1180064247 21:45404941-45404963 CTGCGAGGACGGGGCGGGCCGGG - Intergenic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183780260 22:39994897-39994919 CCCCGACGGCGGGGCGGGGCGGG + Intergenic
1184086836 22:42270469-42270491 GGCCGGCGGCGGGGCGGGCCGGG + Intronic
1184356215 22:43981142-43981164 CACCGAAGGCGAGCAGGGCCCGG - Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185255402 22:49828344-49828366 CACAGGCGGGGGGACGGGCCGGG + Intergenic
1185317683 22:50186023-50186045 CACCGAGCGGGGGGCGGGCCCGG + Intronic
950770705 3:15308575-15308597 CACGGACGGACGGGCTGGCCTGG + Intronic
953596325 3:44318155-44318177 CACCTACTGAGGGGCGGGCATGG + Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
955239042 3:57164232-57164254 CACCGAGGCCCGGGTGGGCCCGG - Intronic
956270420 3:67444078-67444100 CCCGGACGGCGCGGCTGGCCAGG - Intronic
959419218 3:106111529-106111551 CACAGACGGGGCGGCTGGCCGGG + Intergenic
963904451 3:150762651-150762673 CGGCGGCGGCGGGGCCGGCCCGG - Exonic
966696209 3:182793343-182793365 GAACGGCGGCGGGGCGCGCCAGG + Intergenic
966724670 3:183099055-183099077 CAGCGACGGCGAGGGGAGCCTGG + Intronic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968625132 4:1623551-1623573 CACCGCAGGAGGGGCCGGCCAGG - Intronic
968642526 4:1721700-1721722 GGCCGAGGGCGGGGCGGGGCGGG - Intronic
968660021 4:1794997-1795019 GACCGCGGGCGCGGCGGGCCGGG + Intronic
968729123 4:2261535-2261557 CGGCGAGGGCGGGGCCGGCCGGG + Intronic
969213974 4:5708577-5708599 GCTCGGCGGCGGGGCGGGCCTGG - Intronic
969344642 4:6563353-6563375 CACCGACCCCGGGGCGGTCCTGG - Intronic
969620005 4:8274126-8274148 CACCGAGGGTGATGCGGGCCAGG - Intronic
969651134 4:8469015-8469037 CACCGACGGAGGGGCCGGGAGGG - Intronic
973552634 4:52051330-52051352 CACCCAGGGCGGGGCGGCGCGGG + Exonic
981524329 4:145694665-145694687 CCCCGACGGGGCGGCTGGCCGGG - Intronic
982615924 4:157637151-157637173 CCCGGACGGCGCGGCTGGCCGGG + Intergenic
983906010 4:173183794-173183816 CCCTGACGGCGCGGCTGGCCGGG + Intronic
984995451 4:185426038-185426060 CGCGGACGGCGAGGCGGGGCGGG + Intergenic
985129220 4:186724441-186724463 CGCCCGCGGCGGGGAGGGCCTGG - Intronic
985657176 5:1138248-1138270 CACTGCCGGCGGGGTGGGGCAGG + Intergenic
985678453 5:1244100-1244122 CTCGGACAGCGGGGAGGGCCAGG - Intronic
986330595 5:6713875-6713897 CACGGACGGACGGACGGGCCTGG - Intergenic
988823845 5:34915287-34915309 AGGCGATGGCGGGGCGGGCCCGG + Intronic
989211313 5:38861844-38861866 CACAGACGGGGCGGCTGGCCGGG + Intronic
990458920 5:56014746-56014768 CCCGGACGGCGTGGCTGGCCCGG + Intergenic
993162689 5:84312207-84312229 CCCCGACGGGGCGGCTGGCCGGG + Intronic
993162737 5:84312304-84312326 CCCCGACGGGGCGGCTGGCCGGG + Intronic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
997549385 5:134738641-134738663 TACCGACGGCGGGGAGAGGCCGG + Exonic
998157698 5:139795890-139795912 CGGCGGCGGCGGGGCGGGACAGG + Exonic
1001296712 5:170503958-170503980 CAACTACGGAGGGGCGGGGCGGG - Intronic
1002670480 5:180861837-180861859 CACCGGCGGTGGGGTGGGCAGGG - Intergenic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1006141339 6:31931912-31931934 CCCGGACGGCGCGGCTGGCCGGG + Intronic
1006920634 6:37625132-37625154 CACAGCCGGCGGAGCGGGGCGGG - Intergenic
1012983549 6:105853756-105853778 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1015024853 6:128520422-128520444 CCACGACGGAGGAGCGGGCCGGG + Exonic
1018295417 6:162339309-162339331 CCCAGACGGCGCGGCTGGCCGGG - Intronic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1020616428 7:10465803-10465825 CCCGGACGGAGGGGCTGGCCGGG + Intergenic
1025000646 7:55312149-55312171 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1025239124 7:57256843-57256865 CACCGACCGCGAGGAGGCCCGGG + Intergenic
1025738958 7:64181639-64181661 AACCCACCGCGGGGCCGGCCCGG - Intronic
1027211215 7:76150348-76150370 CAGCCACGGCGGCGGGGGCCTGG - Intergenic
1029270846 7:99375513-99375535 CGCCTAGGGCGGGGCGGGGCCGG + Intronic
1029525737 7:101092593-101092615 CCCGGACGGCGCGGCTGGCCGGG - Intergenic
1029746411 7:102517781-102517803 CGCCGCAGGGGGGGCGGGCCGGG + Intronic
1029764348 7:102616760-102616782 CGCCGCAGGTGGGGCGGGCCGGG + Intronic
1034234146 7:149554713-149554735 CCCGGACGGCGCGGCTGGCCGGG - Intergenic
1034361850 7:150506358-150506380 CCCGGACGGGGCGGCGGGCCGGG + Intergenic
1035361762 7:158318144-158318166 CACGGACGGTGGGGGGCGCCGGG - Intronic
1035470219 7:159104702-159104724 CACCGTCGGTGGTGAGGGCCTGG - Intronic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1041070876 8:54125637-54125659 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1045298426 8:100892071-100892093 CCCCGACGGGGCGGCTGGCCGGG + Intergenic
1045305370 8:100952581-100952603 CACGGAGGGTGGGGCGGGCCGGG - Intronic
1045336243 8:101206096-101206118 CACCGACTGAGGCGCTGGCCCGG + Intronic
1049166383 8:141128576-141128598 CGCCGTCTGCGGGGCGGGGCTGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049585089 8:143429312-143429334 CGGCGACGGCGGCGCGGGCTCGG + Exonic
1049694773 8:143977778-143977800 CACCGACAGGGAGGCGCGCCTGG + Exonic
1049998379 9:1051717-1051739 CGCCGGCGGCGGGCTGGGCCCGG - Exonic
1056166873 9:83948445-83948467 CCCCGACGGGGCGGCTGGCCGGG - Intronic
1056747766 9:89318876-89318898 CCCCGACTGCGGGGAGCGCCGGG - Intronic
1057076580 9:92141333-92141355 CACCGACGGCGCAGCCCGCCGGG + Intergenic
1057627045 9:96686996-96687018 TGCCGAGGGCGGGGCGGGGCGGG - Intergenic
1058019091 9:100068537-100068559 CCCCGACGGGGCGGCTGGCCGGG - Intronic
1058866606 9:109167027-109167049 CGCGGACGACGGTGCGGGCCCGG - Exonic
1060818826 9:126650211-126650233 CACCGACTTCGGGGCAGGGCAGG - Intronic
1060945912 9:127569198-127569220 GACCGAGGGCGGGGCGGGGCGGG - Intronic
1061000452 9:127899500-127899522 CACCTCCGGCGGGGAGCGCCCGG + Exonic
1061879660 9:133562447-133562469 CGCCCACGGCGGTGCGAGCCTGG - Intronic
1061879674 9:133562492-133562514 CGCCCACGGCGGTGCGAGCCTGG - Intronic
1061879689 9:133562537-133562559 CGCCCACGGCGGTGCGAGCCGGG - Intronic
1061879704 9:133562582-133562604 CGCCCACGGCGGTGCGAGCCGGG - Intronic
1061879734 9:133562671-133562693 CGCCCACGGCGGTGCGAGCCTGG - Intronic
1061879747 9:133562716-133562738 CGCCCACGGCGGTGCGAGCCTGG - Intronic
1061917704 9:133763780-133763802 CACCGACAGCGCTGCGAGCCAGG - Exonic
1062499094 9:136844728-136844750 CACCGGCGGCGAGGCGGGCGCGG - Exonic
1185468291 X:368441-368463 CACTGACGGGGGGGAAGGCCGGG + Intronic
1185584710 X:1235748-1235770 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1185584809 X:1235945-1235967 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1185584833 X:1235994-1236016 CCCCGACGGGGCGGCTGGCCGGG - Intergenic
1185615598 X:1419781-1419803 CACCCACGCAGGGGAGGGCCGGG - Intronic
1186874591 X:13804408-13804430 CATGGACGGCGGGGGGGGCGGGG + Intronic
1189160383 X:38804103-38804125 CAGCGGGGGCGGGGCGCGCCGGG - Exonic
1190171641 X:48115743-48115765 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1190337262 X:49270029-49270051 TACCGGCCGTGGGGCGGGCCCGG + Exonic
1190505164 X:51119436-51119458 CCCCGACGGGGCGGCTGGCCAGG + Intergenic
1191618041 X:63189490-63189512 CCCGGACGGGGGGGCTGGCCGGG + Intergenic
1192212520 X:69136953-69136975 CACTGGGGGCGGGGCGGGGCCGG - Intergenic
1193114808 X:77766289-77766311 CCCCGACGGGGCGGCTGGCCGGG + Intronic
1195370262 X:104166469-104166491 CGCAGTGGGCGGGGCGGGCCTGG + Intergenic
1195639984 X:107162808-107162830 CACAGATGGCGGGAGGGGCCTGG + Intronic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic
1200093119 X:153644901-153644923 CCCCCACGGCAGGGCGGGCCGGG + Intronic
1200238106 X:154478861-154478883 CGCTGACGGCGGGGATGGCCGGG - Exonic