ID: 954384319

View in Genome Browser
Species Human (GRCh38)
Location 3:50236355-50236377
Sequence CTCGGCCGCCGCCTTGTCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954384319_954384326 23 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384326 3:50236401-50236423 CCTGCGGGAGGACGGAGAGAAGG 0: 1
1: 0
2: 1
3: 37
4: 306
954384319_954384323 11 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384323 3:50236389-50236411 GATCGACAAGAACCTGCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 35
954384319_954384324 15 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384324 3:50236393-50236415 GACAAGAACCTGCGGGAGGACGG 0: 1
1: 0
2: 0
3: 15
4: 163
954384319_954384327 26 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384327 3:50236404-50236426 GCGGGAGGACGGAGAGAAGGCGG 0: 1
1: 0
2: 11
3: 211
4: 1905
954384319_954384321 7 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384321 3:50236385-50236407 AGATGATCGACAAGAACCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
954384319_954384322 8 Left 954384319 3:50236355-50236377 CCGAGGACAAGGCGGCGGCCGAG 0: 1
1: 0
2: 5
3: 18
4: 163
Right 954384322 3:50236386-50236408 GATGATCGACAAGAACCTGCGGG 0: 1
1: 0
2: 1
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954384319 Original CRISPR CTCGGCCGCCGCCTTGTCCT CGG (reversed) Exonic