ID: 954384510

View in Genome Browser
Species Human (GRCh38)
Location 3:50237165-50237187
Sequence TAGCCCAGCCCACTTGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954384510_954384520 5 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384520 3:50237193-50237215 CGGGAGCCCTGGGTTGGAGAGGG 0: 1
1: 0
2: 3
3: 41
4: 317
954384510_954384522 11 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384522 3:50237199-50237221 CCCTGGGTTGGAGAGGGCCTAGG 0: 1
1: 0
2: 3
3: 49
4: 472
954384510_954384517 -5 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384517 3:50237183-50237205 GGCTAGGAGGCGGGAGCCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 349
954384510_954384518 -1 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384518 3:50237187-50237209 AGGAGGCGGGAGCCCTGGGTTGG 0: 1
1: 0
2: 4
3: 64
4: 505
954384510_954384516 -6 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384516 3:50237182-50237204 GGGCTAGGAGGCGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 55
4: 563
954384510_954384519 4 Left 954384510 3:50237165-50237187 CCTGCACCAAGTGGGCTGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 954384519 3:50237192-50237214 GCGGGAGCCCTGGGTTGGAGAGG 0: 1
1: 0
2: 2
3: 45
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954384510 Original CRISPR TAGCCCAGCCCACTTGGTGC AGG (reversed) Intronic
900345790 1:2209712-2209734 TCGGCCACCCCACTTTGTGCAGG + Intronic
907844244 1:58189588-58189610 CAGCCCTGCCCACTGGTTGCAGG + Intronic
910332133 1:86086323-86086345 TAGGTCAGCCAACTTGGAGCTGG - Intronic
913084523 1:115424488-115424510 CAGCACAAACCACTTGGTGCAGG - Intergenic
918061368 1:181064172-181064194 TAGCCCAGCCCAGCGGCTGCAGG - Intergenic
921108734 1:212011603-212011625 TGGCATAGCCCATTTGGTGCTGG - Intronic
922291686 1:224213808-224213830 CAGCCCTGCCCATTTGCTGCTGG + Intergenic
922603955 1:226877456-226877478 TGGCCCAGGCCACTGGGGGCTGG - Intronic
922755997 1:228097275-228097297 CAGCCCAGCCCACTCCCTGCTGG - Intronic
1067715958 10:48691321-48691343 GAGCCCAGCACCCTTGGTGTGGG + Intronic
1067723069 10:48744172-48744194 TACCCCAACCCACTTGGGGTGGG + Intronic
1068283917 10:54910281-54910303 TAACTCTCCCCACTTGGTGCAGG - Intronic
1069954480 10:72041621-72041643 CAGCCCAGCCTGCTGGGTGCTGG + Intergenic
1070469697 10:76766588-76766610 TTGCCCCCCTCACTTGGTGCAGG + Intergenic
1070704279 10:78626493-78626515 TAGCTCTGCCCACCTGGTGCTGG + Intergenic
1070999436 10:80816146-80816168 TAGCCAAGGCCACATGGAGCAGG + Intergenic
1071617969 10:87094211-87094233 CAGCCCAGCCCAGCTGGAGCGGG - Intronic
1072861757 10:99013664-99013686 CAGCCCAGCCAACATGGTGAAGG - Intronic
1073105477 10:101030210-101030232 TAGCCCAGCCGCCATGGCGCAGG - Exonic
1075040615 10:119104351-119104373 GAGCCCGGCCTCCTTGGTGCAGG + Intronic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1078467119 11:11558647-11558669 TATCCCAGCCCTCTGGCTGCAGG - Intronic
1080674993 11:34417782-34417804 TAGCCCAGACCACTTTCTCCAGG - Intergenic
1083660368 11:64249237-64249259 CACCCGAGACCACTTGGTGCAGG + Intergenic
1084268168 11:68015450-68015472 AACCCCAGCCCACCTTGTGCAGG - Exonic
1084312320 11:68324294-68324316 TATCCCACCCCACTAGGTCCCGG - Intronic
1084592417 11:70098333-70098355 CAGTCCAGGCCACTGGGTGCAGG - Intronic
1089194734 11:116687576-116687598 TGGCCCATCCCCCTTGGTGTAGG - Intergenic
1090258478 11:125302475-125302497 TGGCCCAGCTCACCTGCTGCTGG + Intronic
1090996558 11:131871252-131871274 TCGCCCAGCCCAGGTGGTGCTGG + Intronic
1094166684 12:27450310-27450332 CAGCCCAGCCTAGTTGGTGGGGG - Intergenic
1100990690 12:100248306-100248328 TTGCCCAGACAATTTGGTGCTGG + Intronic
1103855168 12:123963086-123963108 TGGCCCTGCCCACTAGATGCTGG - Intronic
1105844536 13:24282695-24282717 TAGCCCAGCCCTCATCGTGCGGG + Intronic
1108103493 13:46983475-46983497 CAGCACAGCCCACTGGGTGCTGG + Intergenic
1111510112 13:89250215-89250237 TAGCCCACCCCATTTGGTCATGG - Intergenic
1112282248 13:98073307-98073329 TAGCCATGCCCACTGGGTGATGG - Intergenic
1113829948 13:113287858-113287880 ATGCCCAGCCCCCTTGGTGCTGG - Intergenic
1114765100 14:25361818-25361840 TAGGCAAGCCCAGTTGCTGCTGG - Intergenic
1117605400 14:57423498-57423520 TAGCCCTGCCGTATTGGTGCTGG + Intergenic
1121442946 14:93960100-93960122 TTCCCCAGTCCACTTGGTGAAGG + Intronic
1122918245 14:104868624-104868646 GTGCCCACCCCACTTGCTGCAGG + Intronic
1123930170 15:25164922-25164944 TATCCCAGCCCAAATGGTGAGGG + Intergenic
1125599084 15:40906010-40906032 TAGCCAAGCCCTCTGGGAGCAGG - Intergenic
1126200133 15:45976072-45976094 TAGCCAACCCCACTTGTGGCTGG + Intergenic
1128081169 15:64857761-64857783 TGGCCCAGCCCACCTGAAGCAGG - Intronic
1129233345 15:74208926-74208948 GATCCCAGCCCAGCTGGTGCTGG - Intronic
1131229795 15:90651549-90651571 GAGCCCGGCCCACTGGGTTCAGG + Intergenic
1132555020 16:568542-568564 GGGCCCAGCCCAGGTGGTGCTGG - Exonic
1132935084 16:2475795-2475817 CAGCCCAGCCCAGGTGGGGCCGG - Intronic
1134403914 16:13938655-13938677 TGGCCCAGCCCACTCCGTCCAGG - Intronic
1135298931 16:21308316-21308338 TAGCCAGGCCCACGTGGTGGTGG + Intergenic
1135920569 16:26645509-26645531 TAGCCCTGGCCACGTGGAGCTGG + Intergenic
1136289262 16:29261752-29261774 GAGCACTGCCCCCTTGGTGCAGG - Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1148478298 17:47943421-47943443 CAGCCATGCCCACCTGGTGCAGG - Exonic
1152657328 17:81526076-81526098 GAGCCAGGCCCACTTAGTGCCGG + Intergenic
1152985363 18:315983-316005 TTACCCAGAGCACTTGGTGCAGG + Intergenic
1160718145 19:585669-585691 TACCCCTGCCCACTGGGAGCTGG - Intergenic
1162038963 19:7957916-7957938 TAGCTCAGCTCTCTGGGTGCTGG + Intergenic
1162961096 19:14127375-14127397 GGGCCCTGCCCACTGGGTGCTGG + Intronic
1162971395 19:14183305-14183327 TGGCCCAGCCGACTTGTTGGAGG + Intronic
925158216 2:1662993-1663015 TGGCCCAGCCCCCGTGTTGCAGG - Intronic
925444431 2:3915616-3915638 GAGCCCAGCCCTCTAGTTGCTGG - Intergenic
925638991 2:5969432-5969454 TGGCCCTGCCCACTGGGGGCAGG + Intergenic
927783023 2:25954539-25954561 TAGCCCAGCCCAATTCGTGGTGG - Intronic
928329496 2:30346857-30346879 CTGCCCAGCCCACGTGGGGCTGG - Intergenic
928930322 2:36617500-36617522 TAGCACAGCCCACTTGATGAGGG - Intronic
929194078 2:39166975-39166997 TAACCTATTCCACTTGGTGCTGG + Intergenic
929576866 2:43057484-43057506 ATGCCCAGCCCCCTTGGGGCAGG - Intergenic
931281880 2:60801591-60801613 TAGCCAGGCCCACATGGTGGCGG - Intronic
938162098 2:128995240-128995262 TAGCCAAGCTCACATGGTGGCGG - Intergenic
941986409 2:171515803-171515825 CAGCCCTGCCCACGTGGGGCAGG + Intergenic
948452144 2:238082424-238082446 GTGCCCAGCCCACATGGGGCAGG + Intronic
1170674533 20:18467050-18467072 GCGCCCCGCCCACTGGGTGCTGG + Exonic
1170880643 20:20294176-20294198 CAGCCCTGCCCACATGGTGCAGG - Intronic
1171278905 20:23880331-23880353 TTGCCCAGACTGCTTGGTGCAGG - Intergenic
1172275629 20:33677387-33677409 CAGCCCAGCCCAGTTGGGCCCGG + Intronic
1173025735 20:39305813-39305835 TACCCCAGCACCCTGGGTGCCGG + Intergenic
1173126985 20:40346190-40346212 TAGCCCAGCCCCAGTGGTGGTGG + Intergenic
1175490364 20:59376379-59376401 TGGGCCAGGCCACTTGCTGCTGG + Intergenic
1175522261 20:59609445-59609467 GAGCCCACCCCACTTGTTTCAGG + Intronic
1175998672 20:62822327-62822349 TAGGCCAGCCAACTTGGGGATGG + Intronic
1176126156 20:63475790-63475812 TAACCCTGCCCATATGGTGCTGG + Intergenic
1181809223 22:25393226-25393248 TGTCCCAGCCCACTAGGTCCCGG + Intronic
1183778883 22:39985728-39985750 TAGCCCAGGCCTCTTGGTTGGGG + Intergenic
1184936638 22:47728855-47728877 CAGAACAGCCCACTTGGAGCTGG - Intergenic
1184987648 22:48146406-48146428 GAGGCCACCCCACCTGGTGCAGG - Intergenic
1185079711 22:48702848-48702870 CACCCCAGCCCACTTCCTGCTGG - Intronic
949719302 3:6970045-6970067 TGGCCCAGTTCACTTAGTGCAGG - Intronic
949731407 3:7117515-7117537 TAGCTTAGACCACTTGATGCAGG - Intronic
952945395 3:38475403-38475425 GAGCCTAGGCCACCTGGTGCAGG + Intronic
953383726 3:42492908-42492930 TAGCCCAGCCTGCATGGTCCTGG - Intronic
954070019 3:48136127-48136149 TAGCCCATGCCATTTGGTGGAGG + Intergenic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
961145839 3:124592644-124592666 TATTCCAGCCCCCATGGTGCTGG + Intronic
962848440 3:139290219-139290241 TAGCCTAGCCCAGTAGGTCCTGG - Intronic
964291917 3:155190843-155190865 AAGCCCAGCCCACAATGTGCTGG + Intergenic
973779838 4:54277992-54278014 GAGCCCACCTGACTTGGTGCAGG - Exonic
975721828 4:77255688-77255710 TATCCCAGGCCACTTGTTTCAGG + Intronic
978373736 4:108053713-108053735 TAGGCCAGACCTCCTGGTGCAGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
982674159 4:158356704-158356726 TACTCCAGCACACTTGGGGCTGG - Intronic
983142730 4:164172829-164172851 TAGCCGGGCCCACGTGGTGGCGG + Intronic
984130383 4:175867857-175867879 TATCCCAGCACATTTGGTTCTGG + Intronic
987152547 5:15057078-15057100 TAGCTCAGGCCCCTAGGTGCAGG + Intergenic
988497530 5:31757861-31757883 TAGCCCAGCACAGCTGGTGCGGG - Intronic
988870497 5:35384634-35384656 GAGCCCAGAGCATTTGGTGCGGG + Intergenic
989650582 5:43684603-43684625 TAGCCCGACCCAGTTGGTCCAGG + Intronic
996393178 5:122985901-122985923 CAGCCCTGCCCTCTTGGAGCTGG + Intronic
997526228 5:134554995-134555017 TGGCCCAGCCCACTAGGCCCCGG - Intronic
1001482814 5:172100219-172100241 CAGACCAGCCTACCTGGTGCAGG - Intronic
1005359244 6:25015324-25015346 AAGCCCAGGCCAATTGCTGCTGG + Intronic
1013006483 6:106079108-106079130 TAGCCAGGCCCACGTGGTGGCGG - Intergenic
1020271691 7:6600370-6600392 TGGCCCAGGCCTCCTGGTGCGGG + Intronic
1020821116 7:12969086-12969108 TAGCCAGGGCCACTTGCTGCTGG - Intergenic
1023930105 7:44700305-44700327 TGGCCCTGCCCTGTTGGTGCAGG + Intronic
1024012373 7:45279918-45279940 TAGGCCAGCCCACCTGTGGCAGG - Intergenic
1028620452 7:92821181-92821203 AAGCCCAGGCCACCTGGTGTAGG + Intronic
1028710683 7:93904273-93904295 CAGCCCAGCCCCCTTGCTTCTGG - Intronic
1034496242 7:151424598-151424620 TGGCCCAGCCCACATGTGGCAGG + Intergenic
1036643671 8:10599321-10599343 AAGCCCAGCCCAGGGGGTGCAGG + Intergenic
1037587448 8:20287946-20287968 TAGCCCAGCCCACCTGCAGATGG + Intronic
1039878514 8:41608291-41608313 TGGCCCAGGGCACATGGTGCGGG - Intronic
1039985689 8:42445795-42445817 CAGCCCAGCCCACCTGCGGCAGG + Intronic
1043350385 8:79353426-79353448 AAGCCCAGCCCTCTTGCTTCAGG + Intergenic
1048150576 8:131889603-131889625 GACTACAGCCCACTTGGTGCAGG + Intergenic
1049018123 8:139935980-139936002 TGGCCCTCCCCACATGGTGCAGG - Intronic
1053453731 9:38214692-38214714 TACCCCTTCCCACTTGGTGAGGG - Intergenic
1056814358 9:89791014-89791036 AAGTCCAGCCCACTTTGTGAGGG - Intergenic
1057303520 9:93899809-93899831 TAGCCCAGCCCACTCAAGGCAGG + Intergenic
1061379591 9:130246093-130246115 AAGCTTAGCCCACTTTGTGCTGG - Intergenic
1185747181 X:2583196-2583218 TTGCCCGGCACACTTGGTGTAGG + Intergenic
1187628357 X:21141806-21141828 AGGCCTAGCCCACTTGCTGCTGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1195093367 X:101484991-101485013 TTCCACAGCCCATTTGGTGCAGG + Intronic
1199815267 X:151391941-151391963 CTGCCCCGCCCACTTGGCGCTGG + Intergenic
1199902428 X:152189631-152189653 TAGCCCTGCCCAGTTCTTGCAGG + Intronic
1201713569 Y:17018417-17018439 TTGCCAAGCCCTCATGGTGCGGG + Intergenic