ID: 954385930

View in Genome Browser
Species Human (GRCh38)
Location 3:50243843-50243865
Sequence GGACAGCAGGCAGACGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954385919_954385930 25 Left 954385919 3:50243795-50243817 CCATGGCCCTTTGGGAGTCTGTG 0: 1
1: 0
2: 4
3: 41
4: 609
Right 954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 235
954385921_954385930 19 Left 954385921 3:50243801-50243823 CCCTTTGGGAGTCTGTGCTGGCT 0: 1
1: 0
2: 2
3: 19
4: 351
Right 954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 235
954385922_954385930 18 Left 954385922 3:50243802-50243824 CCTTTGGGAGTCTGTGCTGGCTG 0: 1
1: 0
2: 3
3: 25
4: 409
Right 954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954385930 Original CRISPR GGACAGCAGGCAGACGGTGT GGG Intronic
900956537 1:5889603-5889625 GTAAAGGAGGCAGGCGGTGTGGG - Intronic
902185634 1:14723247-14723269 AGACAGCAGGTAGAAGGTCTGGG - Intronic
902623584 1:17664331-17664353 GGAGAGCGGGGAGAGGGTGTGGG + Intronic
902944358 1:19824051-19824073 GGACAGCAGGCAGAGGTAGGGGG + Intergenic
903660553 1:24974839-24974861 GGACAGCTAGCAGAGAGTGTAGG - Intergenic
904159084 1:28509245-28509267 GGCCAGAAGGCACACTGTGTTGG + Intronic
905629305 1:39510090-39510112 GGGCAGCAGGGAGGCGGCGTGGG - Intronic
905668453 1:39776103-39776125 GGGCAGCAGGGAGGCGGCGTGGG + Intronic
905924649 1:41740904-41740926 GGACAGCTGGCAGGGGGTGGGGG + Intronic
907710949 1:56880927-56880949 GGGCAGCAGCCAGACAGTCTGGG - Intronic
916202061 1:162281596-162281618 GTTCACCAGGCAGATGGTGTGGG + Intronic
917453646 1:175167640-175167662 GGACAGATGGGAGAGGGTGTAGG + Intronic
919050681 1:192507472-192507494 GGACAACAGGGAGATGGTGGAGG + Intergenic
919899308 1:202032284-202032306 GGAGAGAAGGCAGAGGGTTTAGG - Intergenic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
922605968 1:226890168-226890190 GGTCAGCAGGCAGCCTGTGGGGG + Intronic
922896089 1:229101605-229101627 GGACAGCAGGCAGAAAGGGTTGG + Intergenic
923024849 1:230196167-230196189 GGACGGCAGGCAGGAGGTGAGGG - Intronic
924599409 1:245475250-245475272 GGCAAGGAGGCAGCCGGTGTTGG - Intronic
1063110972 10:3037275-3037297 GGTCAGGAGGCAGAAGGGGTTGG + Intergenic
1064029265 10:11873417-11873439 GAAGAGCAGGCAGGCAGTGTAGG - Intergenic
1064146949 10:12833287-12833309 GAACACCAGGCACACGGGGTGGG + Exonic
1067143179 10:43673251-43673273 GGCCAGAAGGCAGAGGGTTTTGG - Intergenic
1068423171 10:56822225-56822247 GGACACCAGGCAGGCAGTCTTGG - Intergenic
1069774252 10:70917674-70917696 GGACAGCAGGCAGAGGGTCTTGG + Intergenic
1070186784 10:74071415-74071437 GGCCAGCTGGCAGACAGTGAAGG - Intronic
1070547268 10:77462704-77462726 AGACACCAGGCAGATGCTGTGGG - Intronic
1070973982 10:80590101-80590123 GGTCAGGAGGCAGAGGGAGTGGG + Intronic
1072742063 10:97915479-97915501 GGAAAGCAGGCAGAAGGGGCAGG - Intronic
1074096513 10:110318151-110318173 GGCCAGGAGGGAGATGGTGTGGG - Intergenic
1074546000 10:114403204-114403226 CGACAGCAGGGAGCCGGCGTGGG - Intronic
1074770863 10:116732855-116732877 GGAAAGCATGCAGAGGGAGTCGG + Intronic
1076840701 10:133043835-133043857 GGACAGCAGCCAGGCGGTGGGGG + Intergenic
1077208209 11:1354189-1354211 GGGCAGCAGGCAGGTGGTGAAGG - Intergenic
1078430158 11:11282119-11282141 GGACAGGAGGAAGACAGTGCTGG - Intronic
1083886933 11:65577495-65577517 GCACAGCAGGCTGAGGGTGCCGG + Intronic
1084319108 11:68363738-68363760 TGACTGCAGGCAGAAGGTGGTGG + Exonic
1084770768 11:71341632-71341654 GGAGAGCAGGCAGACGGGTAAGG - Intergenic
1085044842 11:73346774-73346796 GGAGGGCAGGGAGAGGGTGTGGG + Intronic
1088834524 11:113566757-113566779 AGACAGCAGGCAGCCTGGGTGGG - Intergenic
1088953959 11:114599408-114599430 GGATAACAGGCAGAGGGTGGAGG - Intergenic
1089159192 11:116424494-116424516 GCACAGCAGGGAGACGGGGCAGG + Intergenic
1089305290 11:117522634-117522656 GGAGAGCAGGCAGAGGCTCTGGG - Intronic
1091271103 11:134312494-134312516 GGCCAGCAGGCTGTCTGTGTGGG + Intronic
1091382104 12:68292-68314 GGACAGTTGGCAGATGGAGTTGG + Intronic
1093502457 12:19828116-19828138 GGACGGCATGCTGATGGTGTCGG - Intergenic
1095817315 12:46438890-46438912 TCACAGCAGCCTGACGGTGTAGG + Intergenic
1096758097 12:53816877-53816899 GGACAGCAGGCAGAGGAGGCGGG - Intergenic
1097638586 12:62151304-62151326 GGACAGCAGGCAGTCACTGTGGG - Intronic
1098444242 12:70550100-70550122 GGAATGTAGGCAGACGGTGATGG + Intronic
1104292041 12:127479248-127479270 GGACAGGAGGCCCACGGTGCTGG - Intergenic
1104359619 12:128120568-128120590 GGCCTTCAGGCAGACGGTCTGGG + Intergenic
1108121788 13:47195658-47195680 GGACATGAGGCAGAAAGTGTTGG + Intergenic
1108991073 13:56659094-56659116 GGAGTGCGGGCACACGGTGTGGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112125787 13:96466435-96466457 GGACAGCAGGTAGATGGAGGGGG - Intronic
1113263982 13:108595969-108595991 GGACAGCAGCCAACCGCTGTGGG + Intergenic
1114705926 14:24726674-24726696 GGACAGCAGGCAGGCGCAGCCGG - Intergenic
1115522853 14:34250866-34250888 GGGCAGCAGACAGATGGTGCAGG - Intronic
1116356728 14:43939144-43939166 GGACGGCATGCTGACGGTGGTGG + Intergenic
1117768404 14:59107396-59107418 GGAGAGCAGCCAGACGTTCTGGG + Intergenic
1119391806 14:74295997-74296019 GGAGAGAAGGGAGAGGGTGTGGG + Intronic
1119544730 14:75463438-75463460 AGAGGGCAGGCAGGCGGTGTCGG + Intronic
1121406990 14:93725160-93725182 GGAAAGCAGGCAGAGGGGCTTGG + Intronic
1122241106 14:100368086-100368108 GGGAAGCAGGCAGAAGGTTTTGG + Intronic
1122577383 14:102750865-102750887 GGACAGCCGGCAGATGGTGGGGG + Intergenic
1122624073 14:103075360-103075382 GGACTGCAGCCAGGCGGTCTGGG - Intergenic
1122973808 14:105162982-105163004 GGGCAGCAGGGAGGCTGTGTTGG - Intronic
1123412884 15:20073981-20074003 GGGCACCAGGTAGACGCTGTCGG + Intergenic
1123522226 15:21081094-21081116 GGGCACCAGGTAGACGCTGTCGG + Intergenic
1124809213 15:32917462-32917484 GGACAGCAGGCAGACTTTATTGG + Intronic
1127784420 15:62343255-62343277 CGGCAGCAGCCAGAGGGTGTGGG - Intergenic
1128133862 15:65248701-65248723 GGGAAGGAGGCAGACAGTGTGGG - Intronic
1128932575 15:71718608-71718630 AGACATCAGGCAGACTGTGACGG - Intronic
1130885278 15:88087508-88087530 GGACAGGAGGAAGAGAGTGTAGG + Intronic
1130916441 15:88308793-88308815 GAACAGCTGGCAGATGGTGAGGG + Intergenic
1132597429 16:759714-759736 GGACAGAAGGCAGCCGGCTTGGG - Intronic
1132626063 16:892216-892238 CGGCAGCAGGCAGACGATGATGG + Intronic
1132877770 16:2148045-2148067 GCACAGCAGGCAGAAGCTGTGGG + Intronic
1132884799 16:2177929-2177951 GGACCGCAGGCAGACAGCCTGGG + Exonic
1133131761 16:3680495-3680517 GGACACCAGGAAGCAGGTGTTGG + Intronic
1133916585 16:10114433-10114455 GCAAAGCAGGCAGATGCTGTAGG + Intronic
1134209042 16:12260610-12260632 GGAGAGCAAGCAGACGGAGAAGG - Intronic
1135864650 16:26090236-26090258 GGACTGCAGGCAGATGGAGTGGG - Intronic
1137589484 16:49684976-49684998 GGACAGCCATCAGCCGGTGTTGG - Intronic
1138561031 16:57801295-57801317 GGAGAGCAGGCAGAAGGTCAAGG + Intronic
1141098093 16:81177163-81177185 TGAAAGCAGGGAGACTGTGTAGG + Intergenic
1141245297 16:82301683-82301705 GCACAGCAGCCAGACAGGGTTGG + Intergenic
1141697483 16:85626913-85626935 GGACAGCAGGCAGACCGGTTTGG + Intronic
1141820131 16:86440114-86440136 GGGCAGCCGGCAGGTGGTGTTGG - Intergenic
1143126158 17:4641956-4641978 GTACAGCAGGCAGGCGAGGTGGG + Intronic
1143402463 17:6655407-6655429 GTACAGCAGGCAGGCGAGGTAGG - Intergenic
1147718436 17:42523070-42523092 GGAGAGCAGGCAGACCGTCCAGG + Intergenic
1147991147 17:44334318-44334340 GGGCAGCAGGTAGACAGTTTGGG - Intergenic
1149541549 17:57471705-57471727 GGGCAGCACGCAGGCGGGGTGGG - Intronic
1150463630 17:65373098-65373120 GGACGGCAGGGACACGGAGTTGG + Intergenic
1151149988 17:72076787-72076809 GGACAGCAGGTAGAAGGTCAGGG - Intergenic
1151369427 17:73638580-73638602 GAACAACAGGCAGTCAGTGTGGG + Intronic
1151756702 17:76079350-76079372 GGACAGCAGCCAGTAGGTGGAGG + Exonic
1152537786 17:80960479-80960501 GGACTGGAGGCAGAGGCTGTCGG + Intronic
1152739715 17:82013599-82013621 AGGCAGCAGGCAGCCGGAGTGGG - Intronic
1153536485 18:6107468-6107490 GGACAGCATGCAGGCGGTCTGGG + Intronic
1154334709 18:13456276-13456298 GGAAGGCAGGCAGACGGCGGGGG - Intronic
1155087579 18:22473048-22473070 GGACATCTGGGAGATGGTGTAGG + Intergenic
1155506779 18:26541154-26541176 GGGCAGCAGGAAGATGGTGCAGG - Intronic
1156310533 18:35918338-35918360 TGACTGCAGGCAGAGGTTGTAGG - Intergenic
1156464001 18:37337179-37337201 GGACAGGAAGCTAACGGTGTGGG + Intronic
1159679270 18:71326923-71326945 TGACAGCAGGCTGGCGCTGTGGG + Intergenic
1159990273 18:74899069-74899091 AGACAGCAGGAAGTCTGTGTGGG + Intronic
1161159674 19:2754965-2754987 GGACAGCAGGCAGCCTGTCTGGG - Exonic
1161260552 19:3335533-3335555 GGACAGCAGGCAGCCAGGCTGGG + Intergenic
1161527444 19:4765548-4765570 GGACCACAGGGAGAGGGTGTGGG - Intergenic
1161535558 19:4816854-4816876 GGAGAGCAGGCTGGCCGTGTCGG + Exonic
1162307626 19:9884950-9884972 AGAGAGCAGACAGAGGGTGTTGG - Intronic
1162531457 19:11238479-11238501 GGACAGAGGGCAGAGGGTGGGGG + Intronic
1163281901 19:16323633-16323655 GGCCAGCAGGGATATGGTGTGGG + Intergenic
1163418358 19:17200608-17200630 GGACAGGAAGCAGCCGGTGAGGG - Intronic
1164855278 19:31516357-31516379 GGGCAGCAGGCAGTGGGTGCAGG + Intergenic
1165728892 19:38131514-38131536 GGTGACCAGGCAGGCGGTGTGGG + Intronic
1165940047 19:39410373-39410395 GAACAGAAGGCAAAGGGTGTAGG - Intergenic
1166305591 19:41935357-41935379 AGACGGCAGGCAGAGGGTGAGGG + Intergenic
1167159420 19:47757284-47757306 AGACAGCAGGCAGAGGGCGCAGG + Intergenic
1167748673 19:51367427-51367449 GGACAGCGGGAAGAGGGTGGAGG - Intronic
925897766 2:8486734-8486756 GGACATCAGGCATATGGAGTCGG - Intergenic
927517261 2:23679770-23679792 GGGCAGAGGGCAGAGGGTGTGGG + Intronic
928899801 2:36304733-36304755 GGACATCAAGCAGAGGGTGAAGG - Intergenic
933918332 2:87019012-87019034 GGGCTGCAGGCAGAGGGAGTGGG + Intronic
934004664 2:87750901-87750923 GGGCTGCAGGCAGAGGGAGTGGG - Intronic
935767621 2:106384934-106384956 GGGCCGCAGGCAGAGGGAGTGGG - Intergenic
938377774 2:130819855-130819877 GGACAGCATGCAGAGGGAGATGG + Intergenic
940345017 2:152619950-152619972 GGAAGGCAGGAAGATGGTGTAGG - Intronic
940667854 2:156630982-156631004 AGTCAGGAGGCAGACGGAGTGGG + Intergenic
941731284 2:168921173-168921195 AGTCAGGAGGCAGACGGTGAAGG - Intergenic
945058111 2:205885696-205885718 GGAAAACCGGCAGAGGGTGTGGG - Intergenic
945519457 2:210805730-210805752 GGCCAGCAGGTAGACAATGTAGG + Intergenic
946396204 2:219444910-219444932 GGGCAGCGGGCAGACGGTCCTGG + Exonic
947968424 2:234301785-234301807 GGACTGCATCCAGACGCTGTGGG - Intergenic
948371772 2:237494200-237494222 GGACAGAGGGCAGAGGGTGGAGG + Intronic
948606751 2:239140804-239140826 GGGCAGCAAGCAGACCGTGGAGG - Intronic
948879993 2:240851763-240851785 GAACAGCAGGCAGAACGTGCGGG - Intergenic
1170196363 20:13693357-13693379 GGAACCCAGGCAGACTGTGTAGG - Intergenic
1171178625 20:23074755-23074777 GGACAGGTGGCAGATGGTGGAGG + Intergenic
1171386101 20:24770325-24770347 AGACAGGAGGCAGACAGAGTTGG + Intergenic
1172240282 20:33408427-33408449 GGTGAGCAGGCAGTCGGTGGAGG + Exonic
1172701431 20:36855822-36855844 GGACAGCATGCACACGGAGGAGG + Intronic
1173222317 20:41140173-41140195 GGAGAGTAGGCAGAGGATGTAGG + Intronic
1173849718 20:46210265-46210287 GGATAGCAGGCAGCAGGCGTCGG + Intronic
1175778965 20:61670278-61670300 GGACAGAAGTCAGAAGCTGTTGG - Intronic
1176283098 20:64326541-64326563 GGACAGTTGGCAGATGGAGTTGG - Intergenic
1177247751 21:18551856-18551878 GGACAGAGGGCAGTGGGTGTTGG + Intergenic
1179472421 21:41620547-41620569 GGACAGCAGGCTGAGGGCCTTGG - Intergenic
1179892008 21:44340126-44340148 GGATAGCAGGAAGATGGGGTGGG - Intergenic
1180023328 21:45143238-45143260 GGAGAGCAGGGGGAAGGTGTGGG - Intronic
1181482261 22:23207756-23207778 GGATAGCTGGCATATGGTGTTGG + Intronic
1181555737 22:23670830-23670852 GGACAGCATGCACACGTTCTGGG - Intergenic
1181622019 22:24097871-24097893 TGACACCAGGCAGATGGGGTGGG + Intronic
1182900509 22:33894498-33894520 GGACAGCAGTGGGACAGTGTCGG - Intronic
1183484299 22:38081159-38081181 GGACAGCAGGAAGGCGGCGTCGG + Exonic
1184476605 22:44725389-44725411 GAACTGCAGGCAGACAGTGGGGG - Intronic
1184737792 22:46409441-46409463 TGACAGGAGGCAGACGGGGGCGG + Intronic
1184786892 22:46676363-46676385 GGCCAGCTGGCCGACGGTCTGGG + Intronic
1185266534 22:49907002-49907024 GGACTGCAGGCAGCAGGTGATGG - Intronic
1185380584 22:50505919-50505941 GGACAGCTGGCAACCGCTGTTGG - Intronic
949444130 3:4115248-4115270 GGACAGAAGGGAGATGGAGTGGG - Intronic
949935046 3:9110004-9110026 GGTCAGCAGGCAGACCTTGAAGG + Intronic
952341929 3:32454378-32454400 GGAGAGCAGGAAGAGGGTGCAGG - Exonic
954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG + Intronic
955357273 3:58241449-58241471 GGACAGCACTCAGGAGGTGTGGG + Intronic
959447416 3:106457425-106457447 GGGCTGCTGGCAGAAGGTGTTGG - Intergenic
960058311 3:113292763-113292785 GGAGAAGAGGCAGAGGGTGTTGG - Intronic
960949946 3:122992856-122992878 AGACAGCAGGCTGATGGTGCTGG - Intronic
961045601 3:123705647-123705669 GGTCGGCAGGCAGACTGTCTGGG - Intronic
961369438 3:126420384-126420406 GGCCAGGAGGCAGAGGGAGTAGG + Intronic
962758319 3:138485026-138485048 GGAGTGCAGGCACACGGCGTGGG + Intergenic
963121189 3:141778319-141778341 GGCCTGCAGGTAGGCGGTGTTGG - Exonic
964545719 3:157831041-157831063 GAACAGCAGGCAGAGGCTGCAGG - Intergenic
964635435 3:158853194-158853216 ATACTGCAGGCAGCCGGTGTGGG - Intergenic
967348695 3:188488125-188488147 GGACAGCAGGAAGAAGGTCAAGG - Intronic
968120562 3:196123033-196123055 GGGCAGCAGGGAGATGGTGAGGG - Intergenic
968835553 4:2962049-2962071 GGACAACAGCCAGACTGTGCGGG + Intronic
968950823 4:3690499-3690521 GGAGAGCAGGCTGAGGTTGTGGG + Intergenic
968970978 4:3793732-3793754 GGTCACCAGGCAGAGGGTGGAGG - Intergenic
970019678 4:11553928-11553950 GGACAGCAGGAAGGGAGTGTGGG - Intergenic
971813284 4:31455746-31455768 GGACAGCAGGATGCCAGTGTGGG + Intergenic
972551333 4:40137716-40137738 GGTCAGGAGGCAGAAGGAGTAGG + Intronic
974479474 4:62424497-62424519 ATAAAGCAGGCAGAAGGTGTTGG - Intergenic
975681850 4:76885297-76885319 GGTCAGTAGGCAGAGGGAGTGGG - Intergenic
979378873 4:119984550-119984572 GGTCAGAAGGCAGAGGGAGTGGG + Intergenic
980706660 4:136505342-136505364 GCACAGAAGGCAGATGGAGTAGG + Intergenic
983541024 4:168910414-168910436 GCACAGGAGGCAGACTATGTGGG - Intronic
983583308 4:169330257-169330279 GGAAGGCAGGCAGACTGTGAGGG - Intergenic
985641317 5:1064710-1064732 GGACAGCGAGGAGACGGTGAAGG + Intronic
985641332 5:1064765-1064787 GGACAGCAAGGGGACGGTGAGGG + Intronic
986610315 5:9560639-9560661 GGTCAGCAAGCAGATGGAGTTGG + Intergenic
992563065 5:77971904-77971926 GGAGAGCAGGCAAACGGAGGAGG - Intergenic
993253384 5:85556540-85556562 GGACAGCAGGCAGCCATAGTGGG - Intergenic
995111045 5:108428848-108428870 AGACAGCAGACAGCCGGTGCTGG + Intergenic
996955492 5:129178551-129178573 AGACAGCAGGCAAGCTGTGTGGG + Intergenic
999855214 5:155586735-155586757 GGAGTGCGGGCACACGGTGTGGG - Intergenic
1001401898 5:171450965-171450987 GAACAGCACGCAGACGGCGAGGG - Intronic
1001950097 5:175810330-175810352 AGACAGCAGCCAGAAGGTCTGGG - Intronic
1003014175 6:2454686-2454708 GGACAGCTGACAGACGGGGAGGG - Intergenic
1003631368 6:7790663-7790685 GGACAGCAGGTTGATGGTGTTGG + Intronic
1005110918 6:22280588-22280610 GCACAGCAGGCAGAAGGGGATGG + Intergenic
1005412622 6:25566303-25566325 AGACAGAAGGCAGACCATGTAGG - Intronic
1007429241 6:41767206-41767228 GGGCTGCAGGGAGACTGTGTTGG - Intergenic
1007652724 6:43433206-43433228 GTACAGCAGGTAGAGGGTGATGG - Exonic
1008230958 6:48984282-48984304 GGAGTGCAGGCACACAGTGTGGG + Intergenic
1008270118 6:49481809-49481831 GGAGTGCTGGCACACGGTGTGGG - Intronic
1018128454 6:160705062-160705084 GGGCCGCAGGCAGAGGGGGTGGG - Intronic
1018343395 6:162876306-162876328 GGACAGCAGGAAGAGAGTGATGG - Intronic
1018646734 6:165955505-165955527 TGGTAGCAGGCAGACGGTGGAGG - Intronic
1019479105 7:1258073-1258095 GCACAACAGGCAGACGGGGTGGG - Intergenic
1019923888 7:4179921-4179943 GAACTGCAAGCAGAAGGTGTGGG + Intronic
1020194439 7:6026296-6026318 GAACAGCAGGCAGGTGGTGAAGG + Intronic
1021520646 7:21536571-21536593 GGAGTGCAGGCACATGGTGTGGG - Intergenic
1021663717 7:22950114-22950136 GGACAGCAGTAAGACAGTGTGGG - Intronic
1023033633 7:36111904-36111926 GGACACCAGCCAGAAGCTGTTGG - Intergenic
1026912464 7:74099109-74099131 GGACACCAGGGTGACGGTGTGGG - Exonic
1028329500 7:89572060-89572082 GTACATCTGGCAGATGGTGTTGG - Intergenic
1029620588 7:101688014-101688036 GGACAGGAGGCACAGGCTGTGGG - Intergenic
1032806954 7:135364699-135364721 GTAGAGCAGGCAGACTGTGTTGG - Intronic
1033641362 7:143265224-143265246 AGACAGCAGGAAGGCGGTGCGGG - Exonic
1035050410 7:155995563-155995585 GGACACCAGGCAGCCACTGTGGG - Intergenic
1036194989 8:6706556-6706578 GGTAAGGAGGCAGAGGGTGTGGG + Intergenic
1036915044 8:12796641-12796663 GGAGCGCAGGCACACGGTGCAGG + Intergenic
1048945908 8:139446931-139446953 GGAAAGGAGGCAGAAGGTATAGG + Intergenic
1049433065 8:142574211-142574233 GGGCAGAAGGCAGAGGGTGGTGG - Intergenic
1049477968 8:142805693-142805715 GGCCAGGAGGCAGGGGGTGTGGG - Intergenic
1049578006 8:143398426-143398448 GGACAGCAGGGAGGAAGTGTGGG + Intergenic
1049811923 8:144579496-144579518 GCACACCGGGAAGACGGTGTTGG - Intronic
1051314113 9:15810381-15810403 GGAGTGCAGGCACACAGTGTGGG - Intronic
1053073022 9:35111977-35111999 AGACAGCAGGCAGACTTTGAGGG - Intronic
1053379391 9:37636317-37636339 GGACAGCAGGAAGAAGGGGAAGG + Intronic
1054803611 9:69377407-69377429 GGCCACCAAGCAGACGGTGGTGG - Exonic
1054809363 9:69422563-69422585 AGCCAGCAGGCAGAGGGTGGTGG - Intergenic
1057024475 9:91724871-91724893 GCCCAGCAGGCAGACGACGTTGG + Exonic
1057867310 9:98691774-98691796 GGACAGGAGGTAGAAGATGTGGG - Intronic
1058414639 9:104774968-104774990 AGAAAGCGGGCAGACGGGGTGGG - Intronic
1059711737 9:116873825-116873847 GAACAGCAGGAAGACAGTGAAGG - Intronic
1060103777 9:120861230-120861252 GGATAGGAGGCAGCCTGTGTGGG - Intronic
1060749032 9:126156564-126156586 GGACAGTTGGCAGATGGTGGGGG + Intergenic
1060881114 9:127118756-127118778 TGACAGCAGGCAGATGGGGGAGG - Intronic
1061326199 9:129866225-129866247 GGACAGCAGGCAGGGGGTAGAGG - Intronic
1061798076 9:133100108-133100130 GGACAGCAAGCAGACAATGGGGG + Intronic
1062009593 9:134259862-134259884 GGACAGCAGCCAGCAGGGGTGGG + Intergenic
1062583431 9:137238132-137238154 GGACAGCAGGCAGACAGTATTGG - Intergenic
1062639718 9:137512439-137512461 GGACGGCAGGCAGCCGTGGTGGG + Intronic
1187467990 X:19543209-19543231 GGACAGGATGCAGAGGGTGGAGG + Intronic
1189284207 X:39840156-39840178 GGAGAGCAGGCTGGGGGTGTGGG + Intergenic
1190708447 X:53049041-53049063 GGCCAGCAGGCAGACGGAGGGGG + Intergenic
1197593662 X:128441083-128441105 GCACAGCAGGCAGCTCGTGTGGG + Intergenic
1200139059 X:153888603-153888625 TGCCAGCAGGCAGGCGGGGTGGG + Intronic
1200234388 X:154461233-154461255 GGACACCCAGCAGACGCTGTTGG + Exonic
1200312293 X:155089864-155089886 GAACAGTGGGCAGAGGGTGTGGG + Intronic