ID: 954389581

View in Genome Browser
Species Human (GRCh38)
Location 3:50261584-50261606
Sequence CTACCTGCTGGGACAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 298}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954389581_954389589 -3 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389589 3:50261604-50261626 TAGGTGCAGACCTAGATGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 438
954389581_954389592 7 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389592 3:50261614-50261636 CCTAGATGCCAGGTGCAGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 196
954389581_954389590 6 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389590 3:50261613-50261635 ACCTAGATGCCAGGTGCAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 180
954389581_954389598 26 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389598 3:50261633-50261655 AGGGGGAAAGGGCCCTCTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 264
954389581_954389597 15 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389597 3:50261622-50261644 CCAGGTGCAGAAGGGGGAAAGGG 0: 1
1: 0
2: 7
3: 110
4: 641
954389581_954389595 14 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389595 3:50261621-50261643 GCCAGGTGCAGAAGGGGGAAAGG 0: 1
1: 0
2: 1
3: 54
4: 626
954389581_954389599 27 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389599 3:50261634-50261656 GGGGGAAAGGGCCCTCTCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 246
954389581_954389594 9 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389594 3:50261616-50261638 TAGATGCCAGGTGCAGAAGGGGG 0: 1
1: 0
2: 1
3: 35
4: 255
954389581_954389593 8 Left 954389581 3:50261584-50261606 CCACCCCCTGTCCCAGCAGGTAG 0: 1
1: 0
2: 2
3: 37
4: 298
Right 954389593 3:50261615-50261637 CTAGATGCCAGGTGCAGAAGGGG 0: 1
1: 1
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954389581 Original CRISPR CTACCTGCTGGGACAGGGGG TGG (reversed) Intergenic
900433037 1:2611864-2611886 CCACCAGCTGGCACAGGGGTGGG - Intronic
900551809 1:3260164-3260186 CTCCCTGCTAGGCCAGGGTGTGG - Intronic
900597052 1:3484942-3484964 CTGCCTGCTGGGGCGGTGGGGGG + Intergenic
901464578 1:9413128-9413150 CTCCCTGCTGGGTCAGGGTGAGG - Intergenic
901497601 1:9630851-9630873 CTCCCTGCTGGGCCAGGAGCCGG - Intergenic
901738459 1:11327138-11327160 CCACCTGGAGGGCCAGGGGGAGG - Intergenic
901743493 1:11357474-11357496 CTATTTGCAGGGATAGGGGGTGG - Intergenic
902036942 1:13464753-13464775 CTTCCTCCAGGGACAGGTGGTGG + Intergenic
902080078 1:13814755-13814777 CTGCCTGCGGGAACAGGAGGCGG - Intronic
902374291 1:16023021-16023043 TTAGCTGCTGGGACAGCTGGGGG + Intronic
903683294 1:25112013-25112035 CTGCCTGCTGGGACAGGCCAAGG - Intergenic
905495317 1:38380411-38380433 CTCCCTGCAGGGGCAGGAGGTGG - Intergenic
905803851 1:40862141-40862163 CTGCCTGCGGGGACAGCGCGCGG + Exonic
906637631 1:47419764-47419786 CTACCTGCTGGGGCTAGGGAGGG - Intergenic
907126723 1:52056626-52056648 CTGCCTCCTGGGACAGGGTCTGG - Intronic
908825362 1:68127873-68127895 CAGCCTGCTGGGCCAGTGGGTGG - Intronic
908977873 1:69920148-69920170 GGACCTGGTGGGACATGGGGCGG - Intronic
910761925 1:90741434-90741456 CCTCCTGCTGGGAAAGGGGAAGG + Intergenic
912706833 1:111920888-111920910 CTCCCTGCTGGGGCCAGGGGAGG - Intronic
915731957 1:158060184-158060206 CTCCCTGCTGGGAAAGGCGAAGG - Intronic
915831713 1:159137364-159137386 CTACGTGCTGGGGCTGGGCGTGG + Intronic
916047193 1:161008928-161008950 CTTCCTGGTGGGAGAGAGGGAGG - Intronic
917569603 1:176251431-176251453 CTCCCTTCAGGGACAGGGGAGGG + Intergenic
919118647 1:193312676-193312698 CCGCCTGCTGGGAGAGGAGGAGG + Intergenic
919733201 1:200927786-200927808 CTACCTGCTAGGCCAGGGGAAGG - Intergenic
922035835 1:221846928-221846950 CTACCTTCTGGGAGAGGGGAGGG + Intergenic
922599468 1:226838633-226838655 CAACCTCCTGGGAGAGGGGAGGG - Intergenic
922606156 1:226891209-226891231 CTGCCTGCAGGGCCTGGGGGAGG - Intronic
923460480 1:234205824-234205846 CTATCTGCTCAGGCAGGGGGAGG - Intronic
924227247 1:241932262-241932284 TTACCTGCAGGGACAGGGGTGGG + Intergenic
1064222210 10:13450970-13450992 CTTGCTGGTGGGACAGGGGAAGG + Intronic
1064259561 10:13774305-13774327 CTGCCTGCTGGGAAAGAGAGAGG + Intronic
1068182400 10:53537674-53537696 TTTCCTGCTTGGACAGGGGAGGG - Intergenic
1069295076 10:66833923-66833945 CTACTTACTGGGACAAAGGGCGG - Intronic
1069744842 10:70708610-70708632 CAACCTGCTGGGCCTGGTGGGGG + Exonic
1069831498 10:71284879-71284901 GTTCCTGCAGGGACAGGGTGGGG - Intronic
1069842168 10:71346786-71346808 CTGCCTGCAGGGGCAGGGGTGGG - Intronic
1070550226 10:77485415-77485437 CAGCCTGCAGGGGCAGGGGGTGG - Intronic
1070591389 10:77804392-77804414 CTATCAGCTGGGACAAGGGTTGG - Intronic
1070871852 10:79761525-79761547 CTACCCACTGGAACAGGGAGTGG - Intergenic
1071525553 10:86355968-86355990 CCAGCTACGGGGACAGGGGGAGG + Intronic
1071638772 10:87283697-87283719 CTACCCACTGGAACAGGGAGTGG - Intergenic
1071656468 10:87454255-87454277 CTACCCACTGGAACAGGGAGTGG + Intergenic
1072611226 10:97018769-97018791 GTAACTCCTGGGACAGGGAGAGG - Intronic
1073650564 10:105354174-105354196 CTACCTTCTGTGGCAGGGTGGGG - Intergenic
1075037339 10:119080481-119080503 CCACCGGCTGGGACAGCGGCGGG + Intronic
1075432761 10:122402716-122402738 TTACCTGCTGGGACAGAAGAAGG - Intronic
1075679452 10:124322018-124322040 CCATCTGCAGGGACAGGGTGTGG - Intergenic
1076474867 10:130744797-130744819 CCACCTGCTGGGCCAGATGGGGG + Intergenic
1076711949 10:132341257-132341279 CTACCTGCGGGGACTGAGGCGGG + Intronic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG + Intergenic
1077360964 11:2139910-2139932 CCTCCTGCTGGGGCAGGTGGCGG - Intronic
1077488229 11:2848755-2848777 CTGGCTGCTGGGACTGGGCGAGG - Exonic
1078595232 11:12680712-12680734 ATCCCTACTGGGATAGGGGGAGG + Intronic
1079090511 11:17476947-17476969 CCACCTGCGGGGCCGGGGGGCGG + Intergenic
1080735791 11:35012557-35012579 CAACCTGCTGGGGCATGGTGAGG - Intronic
1081630815 11:44688462-44688484 CAACCTCCTGGGGCAGGGAGGGG - Intergenic
1081773132 11:45661933-45661955 CTGCCTGCTGGGGCAGGGTGAGG - Intronic
1082823420 11:57560487-57560509 CTTGCTGCTGGGGCAGGGGGAGG - Intronic
1083335225 11:61917957-61917979 CTGCCTGCTGGGAAGGGGAGGGG + Intronic
1083592235 11:63902585-63902607 CCAGCTGCTGGGCCAGAGGGAGG - Exonic
1084556567 11:69879468-69879490 CCTCCTGCTGGCCCAGGGGGAGG + Intergenic
1085054112 11:73394162-73394184 TTCTCTGCTGGGGCAGGGGGTGG + Intronic
1085274387 11:75289002-75289024 CTACCGGCGGGGAGAGGGGACGG + Intronic
1085340357 11:75727400-75727422 CAACCTGCTGAGCCAGGGCGGGG - Intronic
1085400471 11:76232835-76232857 CTGCCTGCTGAGCCAGGAGGTGG - Intergenic
1085872376 11:80365795-80365817 ACACATGCTGGGACAGGGAGGGG + Intergenic
1089649354 11:119902241-119902263 CTAACAGCTGTGACATGGGGTGG - Intergenic
1091218398 11:133917365-133917387 CTGACTGCGGGGGCAGGGGGAGG + Intronic
1091546806 12:1506599-1506621 CTGCCTGCAGGGTCTGGGGGAGG + Intergenic
1091704082 12:2681931-2681953 TTCCCTGCTGGGACAGGGTCAGG - Intronic
1092201096 12:6583372-6583394 CTTCCTCCTGGGACAGAGGGAGG + Exonic
1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG + Intronic
1092937602 12:13378565-13378587 CTACCTGCTGGGCCAGGGTCAGG - Intronic
1094372227 12:29750944-29750966 TCCCCTGCTGGGACAGGGTGTGG - Intronic
1095131110 12:38543454-38543476 CTACCTGCTGGAACGAGAGGAGG + Intergenic
1096182658 12:49559184-49559206 CTTCCTGCTGGGGCAGGGGGTGG + Intronic
1096625427 12:52892540-52892562 CTACCTGTTGGGAAAGGAAGAGG - Intergenic
1097225853 12:57476451-57476473 CTTCCTGCGGGGACAGAGAGGGG + Exonic
1098579477 12:72082009-72082031 CAACCTGCTGGTCCAGGGGGTGG + Intronic
1099295516 12:80823456-80823478 CTAGGTGCTGGCACAGGGGCTGG - Intronic
1100454594 12:94740227-94740249 CTCCCAGATGTGACAGGGGGTGG + Intergenic
1101511803 12:105399879-105399901 CTTTTTGCTGGGACAGGAGGTGG + Intergenic
1101571478 12:105957850-105957872 CTACCTACTGTAACAGGGGGAGG - Intergenic
1101683039 12:106987564-106987586 CTAACTGCTGGGGTAGGGTGGGG - Intergenic
1103561074 12:121793580-121793602 CTTCCTGCCCGGACCGGGGGCGG + Exonic
1104539749 12:129652923-129652945 CTGCCTTCTGAGACAGTGGGTGG - Intronic
1105302842 13:19151171-19151193 CTGCCTTCAGGGACAGGGGAGGG - Intergenic
1106394681 13:29368272-29368294 CCACCTGCTGTCCCAGGGGGTGG - Intronic
1108601531 13:51999271-51999293 CTAGGTGCTGGGAGCGGGGGAGG + Intronic
1113786387 13:113004127-113004149 CTACTCGCTGGGCCGGGGGGAGG - Intronic
1114182860 14:20380353-20380375 CTGCCTGCTGGGGCAGGAGCCGG + Exonic
1114645324 14:24252828-24252850 CAGCCTTCTGGGACAGGGGCAGG - Intronic
1114672252 14:24417501-24417523 AGCACTGCTGGGACAGGGGGAGG - Exonic
1114924945 14:27384336-27384358 CTGCCTGCTGGGGTATGGGGGGG + Intergenic
1115814043 14:37143382-37143404 ATACCTGCTGTCACAGGGGCTGG + Intronic
1117600945 14:57373808-57373830 CTACATGCTGGGAGTGGGGGAGG - Intergenic
1119484528 14:74979101-74979123 CTACCTGCAGAGTCTGGGGGTGG - Intergenic
1121175349 14:91886933-91886955 CTACCTTCTAGGACAGAGGTGGG - Intronic
1121328269 14:93034275-93034297 CTTCCTGCTCCGACAGGGGGTGG - Intronic
1121874918 14:97442360-97442382 CTAGATGCTGAGACAGTGGGAGG - Intergenic
1122082348 14:99274485-99274507 CTTCCTGCTGGGAGTGGGGAGGG - Intergenic
1122203532 14:100136918-100136940 CCACCTTCTGGGACAGGCGCTGG - Intronic
1122306331 14:100769051-100769073 AGAGCTGCTGGGACAGGGAGTGG - Intergenic
1122362982 14:101178411-101178433 AGCCCTGCTGGGCCAGGGGGCGG - Intergenic
1122540204 14:102493738-102493760 CTCCCTGCTGTGACAGGGGCAGG + Intronic
1123033724 14:105463311-105463333 CCACCTGCTGGGAGAGGATGGGG - Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125678028 15:41512832-41512854 CTACCTGCGGGGCCAGCGGCCGG - Exonic
1127155257 15:56117629-56117651 CTAGGTGCTGGGAAAGGGGATGG - Intronic
1127816301 15:62612082-62612104 GTAGATGCTGGGTCAGGGGGCGG - Intronic
1127870743 15:63071290-63071312 ATACCAGCTAGGTCAGGGGGTGG + Exonic
1128113872 15:65093506-65093528 CTTTCTGCTGGGGCAGGAGGGGG + Intronic
1128254230 15:66185287-66185309 GTTCCTGCTGGAACAGGGGCGGG - Intronic
1128344676 15:66845960-66845982 GTACCTGCTGGGTCAGGGGGTGG - Intergenic
1129181660 15:73881761-73881783 GACCCTGCTGGGACAGGAGGGGG + Intronic
1129412045 15:75355563-75355585 TTACCTGCTGGCACAGGGGAGGG + Exonic
1129669618 15:77600015-77600037 CAATCAGCTGGGACTGGGGGAGG - Intergenic
1130349950 15:83082835-83082857 GGACCTGCTGGGAGAGGGTGAGG + Intergenic
1130650142 15:85757845-85757867 CTACATGCTGGGTCAGGGGTTGG - Intergenic
1131820272 15:96265374-96265396 CAATTTGCTGGGAAAGGGGGAGG + Intergenic
1132727055 16:1343444-1343466 CTACCTGCTGGGGCTGCTGGAGG + Exonic
1133045743 16:3087430-3087452 GGAGCTGCTGGGACAGGGGCTGG - Intergenic
1133130764 16:3674941-3674963 GTGGCTGCTGGGACTGGGGGAGG + Intronic
1135074896 16:19384760-19384782 CTGCAGGCTGGGACTGGGGGTGG - Intergenic
1136553173 16:30992628-30992650 CTACGTGCGGGGACGGGGGGGGG + Exonic
1138477387 16:57279894-57279916 CCACCTCCTGGGATTGGGGGTGG - Intronic
1138578527 16:57924210-57924232 CTCTCTGCTGGGACAGAGGGTGG - Intronic
1139071269 16:63386308-63386330 GTGCATGGTGGGACAGGGGGTGG + Intergenic
1139714472 16:68801875-68801897 ATACCTGATGGGGCGGGGGGCGG - Exonic
1141005712 16:80349694-80349716 ATACCTGGTGGGTCAGGGAGTGG - Intergenic
1141675415 16:85514811-85514833 ATCCCTGCAGGGACAGGGAGAGG - Intergenic
1142482581 17:227996-228018 GTCCCTGCTGGGACAGGGGACGG + Intronic
1142483507 17:232587-232609 CTCCCAGCTGAGACAGGGCGAGG - Intronic
1143373668 17:6455271-6455293 CTGCCTGCGGGGACGGGAGGGGG - Exonic
1143499776 17:7331913-7331935 CTTCCTTCTGGGGCTGGGGGAGG - Intergenic
1145019013 17:19415689-19415711 CTACGTCCTGTGACAGGGAGGGG - Exonic
1147190043 17:38733218-38733240 CCACCTGCTGGGGCAGGGCAGGG - Intronic
1147558855 17:41496843-41496865 CCACCTGCTGGGATACAGGGTGG - Intergenic
1147982396 17:44282584-44282606 CTTCCTGCTGGGATTAGGGGTGG - Intergenic
1149009116 17:51836571-51836593 CTACCTGGTGGGGAAGGGTGGGG - Intronic
1150330724 17:64292299-64292321 GTCCCTGGTGGGAGAGGGGGGGG + Intergenic
1150574294 17:66416357-66416379 CGACGTGCTGGAACAGGGAGAGG + Intronic
1151716599 17:75834321-75834343 GTACCTGCTCGGCCAGGGTGCGG + Exonic
1152555829 17:81052710-81052732 CCAGGTGCTGGGAGAGGGGGTGG + Intronic
1152841992 17:82575863-82575885 GAGCCTGCTGGGACAGAGGGTGG + Intronic
1152990207 18:356481-356503 CTACATGCTGGGAGAGAGGTGGG + Intronic
1153079940 18:1210648-1210670 CTACCTCATGGGACTAGGGGGGG - Intergenic
1155504703 18:26521805-26521827 CTGCCGGCTGGGACATGGGAGGG + Intronic
1157669622 18:49517371-49517393 CTACCTGCTGGGGAAAGGGTGGG - Intergenic
1159106035 18:64002758-64002780 CTACCTCCTGGGAGAGGCTGGGG - Intronic
1159916274 18:74190891-74190913 CTTCCTCCTCGGACAGAGGGAGG - Intergenic
1160251899 18:77210324-77210346 CTGCCTGCTTGTGCAGGGGGTGG + Intergenic
1160510530 18:79451083-79451105 CCACCTGCAGGGACAGCGTGCGG - Exonic
1160803060 19:979460-979482 CAACCGGCTGGGACAGGTGTGGG - Intergenic
1161042494 19:2117419-2117441 CCACCTTCAGGGACACGGGGTGG + Intronic
1161346680 19:3771799-3771821 CTACCGGCAGGGACAGGGCAGGG + Exonic
1161716817 19:5880837-5880859 CTCCCTCCTGGCCCAGGGGGAGG - Intronic
1162327066 19:10005812-10005834 TGACCTGCTGGGGGAGGGGGCGG + Exonic
1162364150 19:10237880-10237902 CTACCTGCTGGGGCAGAGATGGG - Intergenic
1163591184 19:18194939-18194961 CTGCCTGCGGGGAGAGGCGGGGG - Exonic
1163677894 19:18664478-18664500 CTGCCTGTTGGGACAGGGACAGG + Intronic
1164472545 19:28548115-28548137 CTACCTGCTGGGGCAGCTGTAGG + Intergenic
1164763535 19:30745740-30745762 CTCCCTGCAGGGACAGGCCGTGG - Intergenic
1164782832 19:30907094-30907116 CTGCCTGCTGGCACAGGTGCCGG - Intergenic
1165135449 19:33665679-33665701 CTTCCTGCTGGACCAGGGTGAGG + Intronic
1165749362 19:38250974-38250996 CTGCTTGCTGGGACTGGGGATGG + Intronic
1167101689 19:47407629-47407651 CTAATTGCTGGAACAGGCGGGGG - Intronic
1167594471 19:50419769-50419791 CCCCCTGCTGGGACAGGAAGTGG - Intronic
1168093339 19:54100226-54100248 CTGCCTACTGAGACAGGAGGAGG - Intronic
1168242526 19:55094613-55094635 CTCCCTGCTGGGGGCGGGGGCGG + Intronic
1168269596 19:55242276-55242298 CTGCCTGCGGGGGCAGGGGCAGG + Exonic
926216252 2:10907325-10907347 CCAGATGCTGGGACAGGTGGGGG - Intergenic
927678989 2:25127785-25127807 CAACTTGCGGGGGCAGGGGGAGG - Intronic
927864591 2:26580445-26580467 CTGCCTGCTGGGGCAGGGGTGGG + Intergenic
928017000 2:27666808-27666830 ATACTTGCAGGGACAGGGGGTGG - Intronic
928395183 2:30938105-30938127 CTACATTCTGGGACAGCAGGTGG + Intronic
930031081 2:47058441-47058463 CTGCCTACTGGGACAGGAAGAGG + Intronic
930736896 2:54788518-54788540 AGACCTGCTGGGGCGGGGGGCGG - Intronic
933686857 2:85148360-85148382 CCACCTGGAGGGACAAGGGGTGG - Intronic
933979852 2:87540625-87540647 CTACCTGCTGGAGCTGAGGGTGG + Intergenic
934538818 2:95158659-95158681 CTTCCTGCTGCGGCAGGGAGAGG - Intronic
935127568 2:100238013-100238035 CTATCTGCTGGGGAAGGGGGTGG + Intergenic
935976869 2:108586844-108586866 GTCCCTGCTGGGAATGGGGGAGG + Intronic
936081929 2:109438187-109438209 TTAGCTGATGGGACAAGGGGTGG + Intronic
936313968 2:111410166-111410188 CTACCTGCTGGAGCTGAGGGTGG - Intergenic
936600577 2:113890502-113890524 CTCCCTCCTGGGACTGGGGCGGG + Intronic
937129856 2:119501460-119501482 CCACCTGCTGGGAAGGGTGGGGG + Intronic
937239865 2:120453089-120453111 CTGCCTGCTGGGATAGGGGCTGG + Intergenic
938069410 2:128300540-128300562 CTACTTGCTGGGAGAGGGACTGG - Intronic
941125772 2:161581200-161581222 CTGCCTGCTGGAATATGGGGAGG + Intronic
941724070 2:168841992-168842014 CTTCCTGCTGGGAATGGGGCAGG + Intronic
946359099 2:219208330-219208352 CTACCTGCTGGGAGAGGTACAGG - Exonic
946414858 2:219534918-219534940 CAACCCCCTGGGACTGGGGGGGG - Intronic
947668491 2:231922400-231922422 CAAGCTGCTGGGAGAAGGGGAGG - Intronic
948610313 2:239162442-239162464 CTACTGGCTGGGGCAGGGCGTGG - Intronic
948935325 2:241160202-241160224 CTACCGGGTGGGAGAGGGTGGGG - Intronic
1170821408 20:19758353-19758375 CTAGGTGCGGGCACAGGGGGTGG - Intergenic
1171300246 20:24053318-24053340 TGACCTGCTGGGGCAGGGGTGGG + Intergenic
1172024159 20:31936643-31936665 CAACCTGCTGTGTCAGGGGGTGG - Intronic
1172120112 20:32593387-32593409 CTCCCTGGTGGGACATGGGGAGG + Intronic
1173607311 20:44340717-44340739 CTGCCTCCTGGTACAGTGGGAGG - Intronic
1175525614 20:59631415-59631437 CTTTCTGCAGGGACAGGGGAGGG + Intronic
1175840340 20:62022526-62022548 CTACCAGCTGGGACCAGTGGTGG + Intronic
1175928552 20:62482506-62482528 CTAGATGCGGGGACCGGGGGAGG + Intergenic
1176146070 20:63566091-63566113 CCACCAGCTGGGACTGGGCGCGG + Exonic
1176975161 21:15312593-15312615 CTACCAGCTGGGAGAGGCAGTGG + Intergenic
1179233469 21:39525757-39525779 ACACCTGCTGGGAAAGGGCGTGG + Intergenic
1179478867 21:41665369-41665391 AGACATGCTGGGACAGAGGGGGG + Intergenic
1179563424 21:42231666-42231688 CAACCTGCTAGAACAGGGAGGGG + Intronic
1179932376 21:44579168-44579190 CTCCCAGGTGGGACAGTGGGTGG + Intronic
1179937245 21:44613473-44613495 CTCCCAGGTGGGACAGTGGGTGG - Intronic
1181618423 22:24071064-24071086 ATACCTGCTGGGGCAGGGCAGGG - Intronic
1181781652 22:25198085-25198107 CCACCAGCTGGGACAGAAGGAGG - Intergenic
1182044381 22:27262820-27262842 CTACTTGATGGAAGAGGGGGAGG + Intergenic
1182275814 22:29188022-29188044 CCTCCTGCTGGGGCAGTGGGGGG + Intergenic
1183172369 22:36197791-36197813 CCAGCTGTAGGGACAGGGGGAGG + Intronic
1183180895 22:36258970-36258992 CCACCTGTAGGGACAGGGGGAGG - Intronic
1183379512 22:37484030-37484052 CAGCCTGCTGGGGCAGGGGAGGG + Intronic
1183469054 22:37996207-37996229 CTGCCTGCTGGGGGAAGGGGTGG - Intronic
1183726072 22:39590339-39590361 CTACCTGCAGGAAGAAGGGGAGG - Intronic
1184048662 22:41988407-41988429 CTTCCTGCAGAGACCGGGGGAGG + Intronic
1184262471 22:43326931-43326953 GTACCTGCTTGGGCTGGGGGAGG - Intronic
1184325740 22:43782939-43782961 CAAGCTGTTGGGGCAGGGGGAGG - Intronic
1185043717 22:48518437-48518459 ATCCCAGGTGGGACAGGGGGAGG - Intronic
1185279103 22:49962351-49962373 CTGCCTGCGGGAACGGGGGGAGG - Intronic
950069828 3:10142918-10142940 CTGCCTGCTGGGAGATGGAGGGG + Intronic
950425864 3:12924464-12924486 CTACTTGCTGGGACATGTGGTGG - Intronic
950428558 3:12937936-12937958 CTACATGCAGGGAGAGGGCGGGG + Intronic
951235131 3:20226207-20226229 CTAACTCCTGGGGCAGGGTGGGG - Intergenic
953211058 3:40875620-40875642 GTAGGTGCTGGGACAGGGTGGGG + Intergenic
953710467 3:45265502-45265524 CCACCTCCTGGGACAAGGGTTGG + Intergenic
954200456 3:49020774-49020796 CTTCCTCCTGGGACTGGGGATGG - Intronic
954389581 3:50261584-50261606 CTACCTGCTGGGACAGGGGGTGG - Intergenic
954596686 3:51830969-51830991 GTCCCTGCTGGGGCAGGGAGAGG - Intergenic
955141815 3:56277297-56277319 TCACTTGCAGGGACAGGGGGAGG + Intronic
957148075 3:76449463-76449485 CTACATGCTGGGGTAGGGGTAGG + Intronic
961451014 3:127002327-127002349 CTGTCGGCTGGGAGAGGGGGAGG - Intronic
961512477 3:127411538-127411560 CCACATGCTGGGAGAGGGTGGGG - Intergenic
962422159 3:135238332-135238354 CCACCTGCTGGGATGGAGGGGGG + Intronic
965969757 3:174540277-174540299 CTTCTTGCTGGGCCAGGTGGTGG + Intronic
966808941 3:183826680-183826702 CTGCCTGCTGGGACATGGCCTGG - Intergenic
967949307 3:194828674-194828696 CCAGCTGCTGGGAAAGGAGGTGG + Intergenic
968663883 4:1810351-1810373 TCACCTTATGGGACAGGGGGAGG - Intergenic
968961385 4:3746011-3746033 CTTCCTGCAGGGAGTGGGGGAGG + Intergenic
969128257 4:4970198-4970220 CTTCCTGCTGGGACTGAGGGTGG + Intergenic
969331897 4:6478634-6478656 CCACCAGCTGGCAAAGGGGGAGG - Intronic
969674644 4:8608036-8608058 CGACCTGCTGGGGGAGGGCGCGG + Intronic
970082351 4:12301835-12301857 CTTCCTGGTGGGTGAGGGGGTGG + Intergenic
973650191 4:52991456-52991478 CTACCAACTGGGCTAGGGGGAGG + Intronic
974014029 4:56633046-56633068 CTTCCTGCTGGCACTGGTGGGGG - Intergenic
975224678 4:71858042-71858064 CAACCTGATCGCACAGGGGGAGG + Intergenic
975839717 4:78460412-78460434 CTACCTGCTGTGACAGCGGTAGG + Intronic
976221190 4:82758139-82758161 TCACCTCCTGGGAGAGGGGGAGG + Intronic
981933903 4:150218645-150218667 CTAAGTGCTGGGAGAGGCGGTGG + Intronic
985493328 5:191661-191683 CTACCTGCTGGAGCAGGCGGAGG + Exonic
985883417 5:2657687-2657709 CTACCTGCTGGGGGTGGGTGAGG - Intergenic
986249993 5:6046543-6046565 GTATCTGCTGGGACACGTGGGGG + Intergenic
986338788 5:6773436-6773458 CTACCTGCGGGAACAGGAGCGGG - Intergenic
986396716 5:7337970-7337992 CTACCTGCAGAGTTAGGGGGAGG + Intergenic
988503133 5:31799738-31799760 ATGCCTGCTGGCACAGGGGCTGG + Intronic
992331030 5:75717566-75717588 CAACCTGCGGAGCCAGGGGGCGG - Intergenic
992944792 5:81799571-81799593 CTTCCTGCTGGAACAGGGAAGGG - Intergenic
993018032 5:82558715-82558737 CTTTCTGCTGGTCCAGGGGGAGG + Intergenic
994273247 5:97807138-97807160 CTACCTGTTTGCACAGGGAGAGG + Intergenic
995418653 5:111937764-111937786 TTACCTGGTGGGACAGGAAGAGG - Intronic
996822280 5:127643616-127643638 ATAGCTGCTGGGACAGGTGGTGG - Intergenic
997589163 5:135062431-135062453 CTCCCTGCTGGGGTAGGGAGAGG + Intronic
998447663 5:142211094-142211116 CTGCCTGCTGTGGTAGGGGGAGG + Intergenic
999778384 5:154829224-154829246 CTAACTGCTGGCAGAGGGAGGGG - Intronic
1001021118 5:168183247-168183269 CTGCCTGCTGGAACTGGGGCTGG - Intronic
1001658493 5:173372690-173372712 CTACCTGGTGGGTGAGGAGGAGG + Intergenic
1002450357 5:179315077-179315099 CTCCATGCAGGGGCAGGGGGAGG - Intronic
1004385645 6:15170431-15170453 CTCCATCCTGGGACTGGGGGAGG + Intergenic
1005006789 6:21295285-21295307 CTACTTGCTGGTACTGGGGCAGG + Intergenic
1005848385 6:29800599-29800621 CTACCTGCCGGGAAGGTGGGCGG + Intergenic
1005868589 6:29956783-29956805 CTACCTGCAGGGAAGGTGGGCGG + Intergenic
1006358479 6:33574283-33574305 CTTCCAGCTGGGAGAGGGGTGGG - Intronic
1006502972 6:34469747-34469769 CTACCTGTTGCCCCAGGGGGTGG - Intronic
1006522669 6:34581116-34581138 CTTCCTTCTGGGTGAGGGGGAGG - Intergenic
1006812775 6:36830843-36830865 CTTGCTGATGGGACAGGAGGGGG - Intronic
1007832961 6:44652910-44652932 CTACCTGGTGGGACATGTCGAGG + Intergenic
1012602737 6:101117678-101117700 CTACCTGTCGGGGCAGGGAGAGG + Intergenic
1015341104 6:132101839-132101861 CAACCTGCAGGGAGAGGAGGAGG - Intergenic
1015960891 6:138648502-138648524 CTACATGCTGGGAGAGACGGAGG - Intronic
1018169771 6:161135587-161135609 CTACATGCTGGGAAGGGGCGAGG + Exonic
1018923202 6:168189851-168189873 CTACTTGCTGGGAAGGTGGGAGG + Intergenic
1019504446 7:1383825-1383847 GTTCCTGCTGGGGCAGGGGGCGG - Intergenic
1019548933 7:1592671-1592693 GTCCCTGCAGGGAAAGGGGGCGG - Intergenic
1023185109 7:37524941-37524963 CTGCCTGCTGGGATGTGGGGAGG + Intergenic
1023838834 7:44084183-44084205 ATCCCTGCTGGCACAAGGGGAGG - Intergenic
1026570039 7:71521365-71521387 CTTCCTGCTGGGAAAGGAGGTGG - Intronic
1026883329 7:73921057-73921079 CTTCCTGCTGGCACAGGGGCCGG - Intergenic
1030396072 7:108988488-108988510 ATACCTGGTGGGGCAGGGAGGGG + Intergenic
1032191590 7:129768994-129769016 GCACCTGCTGGGACACAGGGAGG - Intergenic
1033607261 7:142936463-142936485 CTACCAGCTGGGACTGCCGGGGG - Intergenic
1034458052 7:151182204-151182226 CTGCATGCTGGGACTGGAGGAGG + Intronic
1036141473 8:6212963-6212985 ATTCCTGCTGGGGCAGGGGTGGG + Intergenic
1036553033 8:9831927-9831949 CTTGCTGCTGGGGCAGGAGGTGG + Intergenic
1036662302 8:10716174-10716196 GTGGCTGCTGGGACAGGGCGGGG + Intergenic
1037473516 8:19235127-19235149 CAACAGGATGGGACAGGGGGAGG - Intergenic
1038486008 8:27935743-27935765 CTATCTGCTGGGAATGGGTGGGG - Intronic
1039419053 8:37420372-37420394 CTGACTGCGGGGACAGGAGGCGG - Intergenic
1039707628 8:40023470-40023492 CTTCCAGCTGGGGCACGGGGAGG + Intergenic
1040610424 8:48977469-48977491 GTTCCTCCTGGGACAGGGTGAGG + Intergenic
1041974201 8:63778373-63778395 CTGACCGCTGGGACAGGAGGAGG - Intergenic
1045475392 8:102548212-102548234 CTACCTGCTGGAAGAGGCAGAGG + Intergenic
1049217449 8:141414757-141414779 CTACCTCCTGGGGCAGAGAGCGG - Intronic
1049220657 8:141427375-141427397 CTCCCTGCTGGGAGAACGGGAGG + Intronic
1049320172 8:141992079-141992101 CTGGCTGCTGGGAGAGTGGGTGG - Intergenic
1049983179 9:923429-923451 TTACCTGCTGAGAGAGGGTGAGG + Intronic
1053606277 9:39663218-39663240 CCACCTACTGGGAGAGGTGGGGG + Intergenic
1053864199 9:42419833-42419855 CCACCTACTGGGAGAGGTGGGGG + Intergenic
1054247263 9:62679198-62679220 CCACCTACTGGGAGAGGTGGGGG - Intergenic
1054561382 9:66713733-66713755 CCACCTACTGGGAGAGGTGGGGG - Intergenic
1057268133 9:93632133-93632155 CTCCCTGCAGGGACAGGGGCAGG - Intronic
1057494784 9:95552560-95552582 CTTCCTGCTTGAACGGGGGGTGG + Intergenic
1060807715 9:126588060-126588082 CACCCTGCTGAGACAGGTGGAGG + Intergenic
1061286951 9:129629211-129629233 GTACCTGCTGGCAGAGGGGCAGG + Intronic
1062384134 9:136302388-136302410 CCTCCTGCAGGGACAGGGGGTGG - Intronic
1062560936 9:137141616-137141638 CTTCCTGATGGGCCAGGGGTGGG - Intronic
1062623864 9:137434327-137434349 CTCCCTGCTGGGATCGGGGCAGG - Exonic
1186284965 X:8033280-8033302 CTACCTGAGGGCACAGGGGATGG + Intergenic
1187361953 X:18636867-18636889 CCATCTGCTGGGAAAGGGGATGG - Intronic
1188402832 X:29768984-29769006 CTATCTGCTGGGACAGGAAAAGG + Intronic
1189363420 X:40370429-40370451 CTGCCTTCTGGGGCAGGGGACGG - Intergenic
1189503597 X:41587996-41588018 CTTCCTACTGGGGCAGGAGGGGG + Intronic
1192363798 X:70455051-70455073 CCTCCTCCTGGGTCAGGGGGCGG - Intronic
1193274682 X:79571215-79571237 CCACTTCCTGGGTCAGGGGGAGG + Intergenic
1193331464 X:80239399-80239421 CTACCTACTGTAACAGGGTGGGG + Intergenic
1195255895 X:103090667-103090689 CTCCCTTTTGGGGCAGGGGGAGG + Intronic
1195948643 X:110242709-110242731 CCAACTGCTGGGGCAGAGGGAGG + Intronic
1196755706 X:119155519-119155541 CTGCCTGATGGGAGAGGAGGAGG - Intergenic
1200487349 Y:3785639-3785661 CTATCTGCTGAGAAGGGGGGGGG - Intergenic