ID: 954390730

View in Genome Browser
Species Human (GRCh38)
Location 3:50266873-50266895
Sequence CTTTCTAGGTTGGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 465}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954390730_954390737 -7 Left 954390730 3:50266873-50266895 CCTCCCACCTCCAACCTAGAAAG 0: 1
1: 1
2: 3
3: 35
4: 465
Right 954390737 3:50266889-50266911 TAGAAAGAGAAGCCAGAGGAAGG 0: 1
1: 2
2: 5
3: 116
4: 1087
954390730_954390739 -3 Left 954390730 3:50266873-50266895 CCTCCCACCTCCAACCTAGAAAG 0: 1
1: 1
2: 3
3: 35
4: 465
Right 954390739 3:50266893-50266915 AAGAGAAGCCAGAGGAAGGGAGG 0: 1
1: 1
2: 7
3: 137
4: 1312
954390730_954390738 -6 Left 954390730 3:50266873-50266895 CCTCCCACCTCCAACCTAGAAAG 0: 1
1: 1
2: 3
3: 35
4: 465
Right 954390738 3:50266890-50266912 AGAAAGAGAAGCCAGAGGAAGGG 0: 1
1: 2
2: 17
3: 221
4: 1844
954390730_954390741 5 Left 954390730 3:50266873-50266895 CCTCCCACCTCCAACCTAGAAAG 0: 1
1: 1
2: 3
3: 35
4: 465
Right 954390741 3:50266901-50266923 CCAGAGGAAGGGAGGTCACATGG 0: 1
1: 0
2: 3
3: 44
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954390730 Original CRISPR CTTTCTAGGTTGGAGGTGGG AGG (reversed) Intergenic
900381275 1:2385258-2385280 CCATCTAGGGTGGGGGTGGGCGG - Intronic
900925903 1:5705852-5705874 CTTTCCAGGTTGGAGGGGGAGGG - Intergenic
902344899 1:15809183-15809205 CTTTATTGGATGGAGGAGGGTGG + Intergenic
902725105 1:18330308-18330330 CTGCCTTGGTTGGAAGTGGGGGG + Intronic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903714953 1:25358449-25358471 GTTTCTTTTTTGGAGGTGGGTGG - Intronic
904503892 1:30935124-30935146 CTTTGTAGTTTAGAGGAGGGAGG - Intronic
904612821 1:31734885-31734907 CTCTGTAGGTTGGGGGTGTGGGG + Intronic
904749525 1:32732833-32732855 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
905079281 1:35302895-35302917 CTCTGGAGGCTGGAGGTGGGAGG + Intronic
905262730 1:36730862-36730884 TTTTCTGGGAAGGAGGTGGGAGG + Intergenic
905525651 1:38637045-38637067 CTGTCTAGGTCAGAGATGGGAGG + Intergenic
905883239 1:41477975-41477997 CTAGCTGGGGTGGAGGTGGGTGG - Intergenic
906151173 1:43588544-43588566 ACTTCTAGGCTGGAAGTGGGTGG + Intronic
906236075 1:44211653-44211675 CTATCTAGGTTAGAGGTGTTGGG - Intergenic
906427291 1:45724999-45725021 CCGTCCAGGTGGGAGGTGGGGGG + Intronic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
906554651 1:46699285-46699307 CTTTCTAGGTTAGAAGGGTGAGG + Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
908905867 1:69007985-69008007 CTTTGCAGGGTCGAGGTGGGTGG + Intergenic
909478888 1:76112249-76112271 CTGTCCAGGAAGGAGGTGGGGGG - Intronic
909614588 1:77592191-77592213 GATTCAGGGTTGGAGGTGGGAGG - Intronic
911306246 1:96235921-96235943 CTGCCTAGGTAGCAGGTGGGAGG + Intergenic
913255043 1:116945245-116945267 GTTGAGAGGTTGGAGGTGGGCGG + Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914507686 1:148303541-148303563 CTTCCAAGCCTGGAGGTGGGTGG + Intergenic
915342115 1:155182232-155182254 CTTGCTAGGGTGGGGCTGGGAGG + Intronic
915516114 1:156413617-156413639 CTTTGTACTTTGGGGGTGGGGGG + Intronic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
918220581 1:182432737-182432759 CATTCTGGTTGGGAGGTGGGAGG - Intergenic
919800030 1:201348364-201348386 CTGTCCTGGTGGGAGGTGGGCGG + Intergenic
920615020 1:207483374-207483396 TGTTCTAGGCTGGAGGCGGGAGG + Intronic
921238009 1:213151605-213151627 CCGTCTGGGATGGAGGTGGGGGG - Intronic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
921682532 1:218051364-218051386 CTTTGTGGGGTGGAGGTGGGAGG - Intergenic
923792931 1:237127419-237127441 CCTTCTGGGAGGGAGGTGGGGGG - Intronic
924695243 1:246392689-246392711 CTTTTGAAGGTGGAGGTGGGAGG - Intronic
924766039 1:247032463-247032485 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
924898192 1:248365482-248365504 CCCTCAAAGTTGGAGGTGGGAGG - Intergenic
1063050744 10:2444430-2444452 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063343035 10:5286239-5286261 CTTTTGAGGTTGGAGGATGGTGG - Intergenic
1063672944 10:8114469-8114491 CTTTCTGGGTTGAGGTTGGGAGG + Intergenic
1064232082 10:13537920-13537942 AATTCTAGGTGGGAAGTGGGGGG + Intergenic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1065805532 10:29390501-29390523 ATGTCAAGGTTGGAGGTGGTGGG + Intergenic
1065973107 10:30820625-30820647 CTTTCGAGGCTGGAGGTTGAAGG - Intronic
1066010843 10:31192120-31192142 TTTTATAGTCTGGAGGTGGGTGG + Intergenic
1067203934 10:44197882-44197904 CTTTCTAGGCAGGAAGTGGTAGG + Intergenic
1067561539 10:47308059-47308081 TTTTCTAGCTTGGGGATGGGGGG + Intronic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1068922925 10:62503987-62504009 ATTTCTAGCTTGGGGGTTGGGGG - Intronic
1069568296 10:69478349-69478371 CTTTCTAGCTTGAAAGGGGGTGG - Intronic
1070089254 10:73268800-73268822 CTTTCGAGGGTTGGGGTGGGAGG - Intronic
1070138344 10:73715605-73715627 CCTTCCAGGAGGGAGGTGGGGGG - Intergenic
1070248655 10:74754273-74754295 CGTGCTAGCTTGGAGGTTGGGGG + Intergenic
1072190091 10:93071607-93071629 CTTTCGTGGGTGGTGGTGGGCGG - Intergenic
1074098769 10:110336562-110336584 CTTTCTAGGTTGGAGAAGCAGGG + Intergenic
1074186542 10:111103344-111103366 CTTTTTGGGGTGGAGCTGGGAGG + Intergenic
1074189447 10:111123248-111123270 CTTTCTCTATTGGAGGTGGGGGG + Intergenic
1074543269 10:114383935-114383957 GTGACGAGGTTGGAGGTGGGAGG - Intronic
1075859898 10:125666666-125666688 TATTCAAGGTTGGAGGAGGGGGG - Intronic
1076083722 10:127606529-127606551 ATATCTAGGTTGGGGGTGAGGGG + Intergenic
1076294943 10:129376855-129376877 CTCTCTGGGGTGGGGGTGGGGGG - Intergenic
1076936009 10:133567867-133567889 TCCTCTAGGTGGGAGGTGGGAGG + Intronic
1077281643 11:1748762-1748784 GTCCCCAGGTTGGAGGTGGGGGG - Intronic
1077714369 11:4566927-4566949 CTTTCTAGGTGTGAGGTTTGTGG + Intergenic
1077850206 11:6068838-6068860 CTTCCTAGCTTGGAGGTCAGTGG - Intergenic
1078187085 11:9061249-9061271 CTTTAAAGGCTGGGGGTGGGGGG + Intronic
1078190983 11:9092046-9092068 CTTTCCACGTGGGAGGTGGGAGG + Intronic
1078370456 11:10740525-10740547 CTTTCTCAGTTGGAGGCTGGAGG + Intergenic
1078481397 11:11679182-11679204 AATTCGATGTTGGAGGTGGGGGG - Intergenic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1079600094 11:22300671-22300693 CTTTGGGAGTTGGAGGTGGGCGG - Intergenic
1080370380 11:31632750-31632772 CTGTCAAGATTGGAGGTGTGAGG - Intronic
1080697851 11:34618767-34618789 TTTTTTAGGTTGGGGGTGAGGGG + Intergenic
1081639793 11:44744972-44744994 CTGTCATGGTTGGAGGAGGGTGG + Intronic
1082011421 11:47452374-47452396 CTTGCGAGGGTTGAGGTGGGAGG - Intergenic
1082044239 11:47711962-47711984 CCTTCTAGTTGGGAGGTAGGAGG + Intronic
1082811074 11:57479372-57479394 CTGTCTGGGCTGGTGGTGGGAGG - Intergenic
1083093088 11:60220773-60220795 CTTTCTTGGTTGTAGGGGGTGGG - Intronic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083641510 11:64148221-64148243 CTTTTCAGGATGGAGGAGGGTGG + Intronic
1084311277 11:68317549-68317571 CTTCCTGGGTTGGGGGTGGGGGG + Intronic
1084512363 11:69614213-69614235 CTTGCTGGGGTGGAGGTGGGAGG - Intergenic
1084734502 11:71095645-71095667 CTTTCTGGGATGGAGGGGGATGG - Intronic
1084875495 11:72129365-72129387 CATTCTAGTTTGGGGGTGGGAGG - Intronic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1086828595 11:91531235-91531257 CTTTCAAGGTTGGCAGTGAGAGG + Intergenic
1088060621 11:105644938-105644960 CCTTCTATTTTGGAAGTGGGAGG + Intronic
1088098389 11:106126473-106126495 CTCTCTGTGTTGGATGTGGGTGG + Intergenic
1089477670 11:118778567-118778589 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1089477950 11:118780987-118781009 CTTACTGGGTTGGAGGAGGAGGG + Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1090688278 11:129149391-129149413 CTTGCTTGGATGGAGGTGGCAGG - Intronic
1091468934 12:709827-709849 CCCTGGAGGTTGGAGGTGGGAGG + Intergenic
1092561801 12:9622536-9622558 CTTTGTGAGGTGGAGGTGGGTGG - Intergenic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1093638576 12:21500235-21500257 TTTTCTAAGTTAGAGGTGGGGGG + Intronic
1093727434 12:22531013-22531035 ATTTCTAGGTTATAGTTGGGGGG + Intronic
1095428349 12:42104003-42104025 CTTTGGGGGTTTGAGGTGGGAGG + Intronic
1095594209 12:43940255-43940277 GTTTCTAGGTAGGAGATGTGGGG - Intronic
1095667537 12:44819914-44819936 CTTTCTCCGTTATAGGTGGGAGG - Intronic
1095685196 12:45025275-45025297 CTTTCTTGCTTTGAGGTTGGAGG + Intronic
1096600301 12:52724251-52724273 TTTTCTAGTTTGCAGGTGTGGGG - Intergenic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1098264709 12:68706686-68706708 CTGTCCAAGCTGGAGGTGGGCGG + Intronic
1100620199 12:96263866-96263888 CTTTTTAAGCTGGAGGTAGGAGG + Intronic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1104495171 12:129230294-129230316 CCTTCTGTGTTGGAGGGGGGGGG + Intronic
1105279135 13:18953056-18953078 CAGTCAAGGTTGGAGGAGGGCGG + Intergenic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105851389 13:24339431-24339453 CTTTCTTGGGGGGGGGTGGGGGG + Intergenic
1106850257 13:33782504-33782526 CTTCCCAGGTTGGAGGTGGGGGG - Intergenic
1108592938 13:51926596-51926618 CCTTCATGGTTGGGGGTGGGGGG + Intergenic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1109289528 13:60456937-60456959 CTTTGGAGGATGGAGGTGGGTGG - Intronic
1110969169 13:81739625-81739647 TTTCCTAGGTGGGGGGTGGGAGG + Intergenic
1111155266 13:84313399-84313421 CTGTCTAGGTTGAAAGTTGGAGG - Intergenic
1111251959 13:85613187-85613209 GTTTCCAGGATTGAGGTGGGTGG + Intergenic
1111956828 13:94768410-94768432 CTCTTTAGTTTGGAGTTGGGTGG - Intergenic
1112734724 13:102402773-102402795 GTTGGGAGGTTGGAGGTGGGGGG + Intergenic
1113335635 13:109373405-109373427 TCTTCTTGGTTGGGGGTGGGGGG + Intergenic
1113751565 13:112780250-112780272 CCTTCTGGGTTGGAGGGTGGTGG - Intronic
1113751581 13:112780307-112780329 CCTTCTGGGTTGGAGGGCGGTGG - Intronic
1114658591 14:24330817-24330839 CTCTGTAGGTTTGAGGTGTGTGG + Intronic
1114704919 14:24715106-24715128 CTGTCTGGGATGGAGGTGGGGGG + Intergenic
1114888686 14:26888090-26888112 CTTTCTGGGTTTGTGATGGGTGG + Intergenic
1116846815 14:49872363-49872385 CCTTGGAGGCTGGAGGTGGGAGG - Intergenic
1117164401 14:53019209-53019231 ATTTCCTGGGTGGAGGTGGGTGG - Intergenic
1118110312 14:62711226-62711248 TGTTCTTGGTTGGGGGTGGGTGG - Intronic
1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG + Intergenic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118771139 14:68943528-68943550 CTTTCAAGGTTGGGGGGAGGGGG - Intronic
1119099485 14:71866923-71866945 CTTTAGGGGTCGGAGGTGGGAGG + Intergenic
1119274141 14:73338111-73338133 CTGTAGAGGTTGGGGGTGGGGGG - Intronic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1119727067 14:76927876-76927898 CTTTAGGGGTTGGAGGCGGGTGG - Intergenic
1120410273 14:84145279-84145301 GTGTATAGGTTGGTGGTGGGAGG + Intergenic
1120666075 14:87308246-87308268 ATTTCTATGGTGGGGGTGGGGGG + Intergenic
1120875727 14:89373460-89373482 CTTTTTGGGGTGGGGGTGGGGGG + Intronic
1121634454 14:95444477-95444499 CTCTCAAGGTTGCAGGTGAGGGG - Exonic
1122289126 14:100670329-100670351 CATTCTGGGTTCCAGGTGGGTGG - Intergenic
1124098986 15:26675683-26675705 GTGTTTATGTTGGAGGTGGGGGG + Intronic
1124831109 15:33150370-33150392 ATCTCCAGGTTGGTGGTGGGAGG + Intronic
1125173281 15:36791774-36791796 CTTTCTATAATGGAGTTGGGTGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1126188444 15:45853790-45853812 TTTCTTAGGTTGGAGGTGGTAGG + Intergenic
1127295446 15:57604812-57604834 CTTTCTTGGCTGGGGGTAGGAGG + Intronic
1127782865 15:62332258-62332280 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1127913984 15:63440470-63440492 CTTTCTGGGCTGGTGGTGGGTGG - Intergenic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128875147 15:71195518-71195540 GTTTGTAGATTGGAGGTAGGGGG + Intronic
1129054069 15:72807087-72807109 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1129206692 15:74041346-74041368 CTTCCTAGCTTGTAGCTGGGTGG - Intronic
1129210562 15:74065639-74065661 CATTCTTGGTGGGGGGTGGGAGG - Intergenic
1129403449 15:75299690-75299712 CATTCTTGGTGGGGGGTGGGAGG + Intergenic
1129996093 15:80007553-80007575 CTTTGGGAGTTGGAGGTGGGAGG - Intergenic
1130548716 15:84875350-84875372 GTTTTTTGGTTGGTGGTGGGTGG - Intergenic
1131234476 15:90683998-90684020 CTTTATAAGTTGGATGTGGGTGG + Intergenic
1132052441 15:98618242-98618264 CTTTGTGGGGTGGAGGCGGGCGG - Intergenic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1133933346 16:10250013-10250035 CTTCCTGGGTTGGAGATGGCCGG - Intergenic
1134333556 16:13272469-13272491 CTTTCTGAGGTCGAGGTGGGAGG - Intergenic
1135875476 16:26196129-26196151 CTTTTAATGCTGGAGGTGGGGGG - Intergenic
1138087404 16:54145372-54145394 CTTTAAAAGTTGGAGGTAGGAGG - Intergenic
1138101707 16:54257133-54257155 CTTTCTAGCATGGAGCTGTGGGG - Intronic
1138664454 16:58553027-58553049 CTTTGCAGGGCGGAGGTGGGCGG + Intronic
1138903539 16:61302867-61302889 CTTTGTGGGGTGGAGATGGGTGG - Intergenic
1138984604 16:62313168-62313190 CTTTCTATGAACGAGGTGGGAGG - Intergenic
1139397278 16:66650202-66650224 CTTGGTTGGCTGGAGGTGGGTGG + Intronic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1141021958 16:80505709-80505731 TTTTGGAGGGTGGAGGTGGGTGG + Intergenic
1141570571 16:84931183-84931205 CTTTCTAAGAGGGAGGTGAGGGG - Intergenic
1142439257 16:90084415-90084437 CTTGGGAGGTTTGAGGTGGGAGG - Intronic
1143485244 17:7250750-7250772 GTGTCAAGGGTGGAGGTGGGTGG - Intronic
1143717085 17:8781469-8781491 CTTTTTAACTTGGAAGTGGGGGG + Intergenic
1144390437 17:14788556-14788578 ATCTCTTGGTAGGAGGTGGGGGG + Intergenic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145920121 17:28604137-28604159 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
1146070339 17:29675255-29675277 ATTGATAGGATGGAGGTGGGTGG - Intronic
1146152415 17:30486271-30486293 CTTTGGAGGTCTGAGGTGGGCGG + Intronic
1146321732 17:31852108-31852130 CTTTCTGCCTTGTAGGTGGGCGG - Exonic
1146466054 17:33087668-33087690 CTTGGGCGGTTGGAGGTGGGAGG - Intronic
1146808805 17:35887304-35887326 CTTTGGGAGTTGGAGGTGGGTGG + Intergenic
1147132568 17:38418056-38418078 CTTTATAGGCTGGGTGTGGGGGG - Intergenic
1147256211 17:39183978-39184000 CTTTCTGGGCCGGATGTGGGAGG - Intronic
1147953511 17:44120017-44120039 CTGTCTTGGCTGGATGTGGGAGG - Intronic
1148538058 17:48457186-48457208 CTTTCTGGGTTGCAGGTGCAGGG + Intergenic
1149428958 17:56581665-56581687 CCTTCTGGGTGGGAGGTGGAAGG - Intergenic
1150488252 17:65558942-65558964 TTTTCGGGGTTGGGGGTGGGAGG + Intronic
1150493488 17:65590294-65590316 CTTGGGAGGTTTGAGGTGGGAGG - Intronic
1150685414 17:67316748-67316770 CTTTGGGGGATGGAGGTGGGCGG - Intergenic
1151351005 17:73532204-73532226 CGTTCTTGGTTGGGGGTGGGTGG - Intronic
1151880901 17:76893811-76893833 CTTTCTAGACTGGGGGCGGGGGG + Intronic
1152002464 17:77655262-77655284 ATTTCTCGGGTAGAGGTGGGTGG + Intergenic
1152207759 17:78984175-78984197 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
1153068442 18:1076494-1076516 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
1153843583 18:9029302-9029324 ATTGCTAGTTGGGAGGTGGGAGG - Intergenic
1156475376 18:37402525-37402547 CCTTCTAGCTTGGAGGTGGCAGG + Intronic
1158853228 18:61516771-61516793 CTTCTTAGGATGGAGGTGGGAGG + Intronic
1159424901 18:68272411-68272433 TTTTCTATGTGGGAGGTGGGGGG + Intergenic
1159665992 18:71161036-71161058 CATTCTAGGTTAAAGGTGAGAGG + Intergenic
1160996411 19:1884161-1884183 GTTTCTGGTTTGGAGGTGGGGGG - Intronic
1161333516 19:3699321-3699343 CTTTCAAGGCGGGGGGTGGGGGG + Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162290922 19:9779814-9779836 CTTTGGGAGTTGGAGGTGGGTGG - Intronic
1163462528 19:17447801-17447823 CTGTCTGGCTTGGAAGTGGGTGG - Intronic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164105827 19:22107278-22107300 CTGTCCGGGTGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1164511950 19:28904675-28904697 TTTTCTAGGCCGGGGGTGGGGGG + Intergenic
1165360501 19:35333664-35333686 CTAGCTACTTTGGAGGTGGGAGG - Intronic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1167302582 19:48687343-48687365 CTTTGGGGGCTGGAGGTGGGAGG - Intergenic
926047126 2:9717909-9717931 CTGTCTGGAATGGAGGTGGGTGG + Intergenic
926102193 2:10125353-10125375 TTTTGGAGATTGGAGGTGGGGGG + Intronic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
926580734 2:14631569-14631591 CTTTGTAGGGAAGAGGTGGGGGG + Intergenic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
928333955 2:30379846-30379868 CTTTGTAGGGTGGTGGCGGGTGG - Intergenic
928454527 2:31407150-31407172 CTCACTAAGTTTGAGGTGGGAGG - Intronic
928845426 2:35666184-35666206 ATGTGTTGGTTGGAGGTGGGGGG + Intergenic
929690091 2:44067029-44067051 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
929739853 2:44588990-44589012 CATTCTGGGAGGGAGGTGGGGGG + Intronic
929974344 2:46617130-46617152 CTTTCCAGGTTTGGGGTAGGCGG + Exonic
930001173 2:46862466-46862488 CTGTCTGGCTTGGAGGTGGGGGG + Intergenic
931129985 2:59324790-59324812 TTTTGGAGGGTGGAGGTGGGAGG - Intergenic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
933852005 2:86375634-86375656 CTTGGGAGGTTTGAGGTGGGAGG - Intergenic
934100455 2:88648395-88648417 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
934708685 2:96501812-96501834 CTTTCTGGGCTGGGGGAGGGAGG + Intronic
934998486 2:98988856-98988878 CCTTCTGGGAGGGAGGTGGGGGG - Intergenic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935056495 2:99572294-99572316 GTTTCTAGGTGGGGGGGGGGGGG - Intronic
935949777 2:108318098-108318120 CTTGGGAGGCTGGAGGTGGGAGG - Intergenic
936744663 2:115560568-115560590 CTACCTAGGTGGGAGGTCGGGGG - Intronic
937444900 2:121949667-121949689 GTTCCCAGGATGGAGGTGGGTGG - Intergenic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
940945769 2:159615947-159615969 CGTCCTGGGTGGGAGGTGGGGGG - Intronic
941773225 2:169364497-169364519 CTTTGTAAGTCGGAGGTGCGGGG - Intergenic
941777950 2:169413248-169413270 CTTCCTAGGTTGGAGGAAGAAGG + Intergenic
941786863 2:169506344-169506366 CTTTGTGGAGTGGAGGTGGGGGG + Exonic
942791733 2:179768656-179768678 CTCCCAAGGTTTGAGGTGGGAGG - Intronic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
946579150 2:221107537-221107559 AATTCAAGGTTGGAGTTGGGTGG + Intergenic
946643620 2:221810414-221810436 CTTTCTCGGATGGCCGTGGGCGG - Intergenic
946904686 2:224405219-224405241 TTTCCTGGGTTGGGGGTGGGTGG - Intergenic
947253663 2:228137086-228137108 CTTCCTGGGTTGGAGTGGGGTGG - Intronic
947767424 2:232646688-232646710 CTTTCTGGGACCGAGGTGGGTGG - Intronic
948386525 2:237584186-237584208 CTTTCTTGGGTGGGGGTGGGGGG - Intronic
1168945055 20:1747249-1747271 TCATGTAGGTTGGAGGTGGGTGG + Intergenic
1169136307 20:3199909-3199931 CCTTCTAGGTTGGAGGTGCCAGG + Intronic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1170780123 20:19417903-19417925 CTCTCTAGGTAGGAAGTTGGAGG + Intronic
1170946219 20:20893305-20893327 GTTTCTAGCTGGCAGGTGGGAGG - Intergenic
1171148862 20:22809521-22809543 CTCTCCAGGCTGCAGGTGGGTGG - Intergenic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1172541896 20:35724708-35724730 CTTTCTAGGTTCGAGATGTGAGG - Exonic
1172567261 20:35940420-35940442 CTTTCTCGGTGGGAGGATGGGGG - Intronic
1172933925 20:38605651-38605673 TCTTGTGGGTTGGAGGTGGGAGG - Intronic
1174026850 20:47584049-47584071 CTTTGGGGATTGGAGGTGGGAGG + Intronic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174797932 20:53538082-53538104 TTTGGGAGGTTGGAGGTGGGCGG + Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175431785 20:58910161-58910183 CTTTATGGTTTGGTGGTGGGAGG - Intronic
1176006706 20:62868418-62868440 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1178109171 21:29353581-29353603 CTCTGTAGGCTGGAGGTGGGTGG - Intronic
1178160778 21:29911722-29911744 CTTCCTATGATGGAGGAGGGAGG - Intronic
1178306162 21:31491812-31491834 TTTTCAAGGATGGAGGTTGGTGG + Intronic
1178798638 21:35770299-35770321 CTTTGGAGGGTGGAGTTGGGAGG + Intronic
1179416428 21:41202352-41202374 CCCTCTGGGGTGGAGGTGGGTGG - Intronic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182866694 22:33610626-33610648 CTTTATAGGGTGGTGGTGGGTGG + Intronic
1183414842 22:37676181-37676203 CCTTCTAGGTCGGGGGTGGAGGG + Intronic
1183496969 22:38152069-38152091 ATTCCAATGTTGGAGGTGGGGGG + Intronic
1184301239 22:43562496-43562518 AGTTCTGGGTTGGGGGTGGGAGG + Intronic
1184374299 22:44102070-44102092 CTTTCTAGCTTGCAGATGGCAGG - Intronic
1184667372 22:45996191-45996213 CCTTCCAGCTTGGAGGAGGGTGG - Intergenic
1185301373 22:50082906-50082928 CTTTGAGGGGTGGAGGTGGGTGG - Intronic
1185342582 22:50298282-50298304 CTGTCTAGGTTGTAGAGGGGAGG - Intronic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
949443937 3:4113528-4113550 CTTTCTTTTTTGGGGGTGGGGGG - Intronic
949944230 3:9177520-9177542 CTTTCTAGGAAGGAGGTCCGTGG + Intronic
951115509 3:18856730-18856752 CTTTCTTGGGTGGAGGATGGGGG - Intergenic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
952323347 3:32298068-32298090 TTTTTTTGGTTGGGGGTGGGGGG + Intronic
952878532 3:37968535-37968557 CTTTAGAGGTTGAAGCTGGGGGG + Intronic
952949758 3:38513043-38513065 CTTTGAGGGGTGGAGGTGGGAGG - Intronic
953129867 3:40127641-40127663 CATTCCCGGTTGGGGGTGGGGGG + Intronic
953382910 3:42487489-42487511 CATTCTTGGTTGAATGTGGGAGG - Intergenic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954390730 3:50266873-50266895 CTTTCTAGGTTGGAGGTGGGAGG - Intergenic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954481275 3:50803795-50803817 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
954481295 3:50803841-50803863 CCGTCCAGGATGGAGGTGGGGGG - Intronic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
954776557 3:53024220-53024242 CTTCCAAGTCTGGAGGTGGGTGG + Intronic
955265219 3:57436553-57436575 CTTTCTAGGTTGTAGGTCTCTGG + Intronic
955319731 3:57965614-57965636 CTTTGGAGGTTCGAGGCGGGTGG + Intergenic
955901536 3:63760760-63760782 CTTACTAGGTTGAAAGTGGCGGG - Intergenic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
957038657 3:75318750-75318772 CTTACCAGGTTGGAGGTAGTAGG + Intergenic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
958560753 3:95744798-95744820 CTATCTGGGAAGGAGGTGGGGGG - Intergenic
958940877 3:100312908-100312930 CTTTGGGAGTTGGAGGTGGGCGG + Intronic
959574436 3:107919257-107919279 CTTTCTGGGGTGGTGGTGGGAGG - Intergenic
961086692 3:124074048-124074070 CTTACCAGGTTGGAGGTAGTAGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
962517330 3:136164633-136164655 TTTCTTAAGTTGGAGGTGGGGGG - Intronic
962806238 3:138929586-138929608 CTTCGTAGGTGGGGGGTGGGAGG - Intergenic
963300510 3:143592281-143592303 CTTTGCAGGGTGGAAGTGGGAGG + Intronic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
963831793 3:150016475-150016497 CCTACTGGGTTGGATGTGGGGGG + Intronic
964193201 3:154030559-154030581 CTTTCTAGGTTTTATTTGGGCGG - Intergenic
965184996 3:165451809-165451831 CTTGCTCTGGTGGAGGTGGGAGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
965593444 3:170384105-170384127 CTTTGGGAGTTGGAGGTGGGAGG + Intronic
966963010 3:184959527-184959549 TTTTCTGGGGTGGTGGTGGGGGG - Intronic
967876165 3:194269825-194269847 CTTGCTAGGATGGGGGAGGGCGG + Intergenic
967912903 3:194556698-194556720 ATTTCAAGGTCGGATGTGGGTGG - Intergenic
967926044 3:194648702-194648724 CTTCCGATGTTGGAGGTCGGTGG + Exonic
968620478 4:1601521-1601543 CTTTCCAGGTGGGGGCTGGGGGG - Intergenic
969640981 4:8398587-8398609 GTTACTTGGTGGGAGGTGGGAGG - Intronic
970210674 4:13706684-13706706 CTTTGTAGGTAGGAAGAGGGTGG + Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
974594524 4:63998650-63998672 CTTTTTAGTTTGGAGGGGGGTGG + Intergenic
974729806 4:65847548-65847570 ATTTCTAGGATGGAGGTGGGAGG - Intergenic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
976097923 4:81528551-81528573 CCTTCCAGGTTGGAGGGGGTGGG - Intronic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
978947570 4:114516763-114516785 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
980110257 4:128629288-128629310 CTTTGTGGGGTTGAGGTGGGTGG + Intergenic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
980987520 4:139710095-139710117 TTTTAGGGGTTGGAGGTGGGTGG + Intronic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
982435223 4:155377051-155377073 CTATCTGGGTGGGAGTTGGGCGG - Intergenic
983786938 4:171744316-171744338 CTTTTTAGGTTGGAGAGGGGAGG - Intergenic
984144367 4:176043642-176043664 ATCTCTAGGGTTGAGGTGGGGGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
986167093 5:5283466-5283488 CTTTCTGGGGGGGAGGTGGGGGG - Intronic
986644341 5:9901926-9901948 CCTGCTAGGCTGGACGTGGGAGG - Intergenic
987059165 5:14225798-14225820 CTTTTGGGCTTGGAGGTGGGGGG - Intronic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
989265678 5:39470892-39470914 TTTTTTGGGGTGGAGGTGGGTGG - Intergenic
989635536 5:43528775-43528797 CTTCCTAAGTAGGAGATGGGAGG - Intronic
989828901 5:45890794-45890816 CTGTCCAGGAAGGAGGTGGGGGG + Intergenic
990020750 5:51124427-51124449 ATTTCTAGCTTGAAGGTGGATGG + Intergenic
990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG + Intergenic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
991135757 5:63180113-63180135 CTTTGGGAGTTGGAGGTGGGTGG + Intergenic
992777022 5:80097638-80097660 CTGCCTATGTTGGAGGTGCGGGG + Intergenic
992852492 5:80824444-80824466 ATTTCTGGGAGGGAGGTGGGGGG - Intronic
993008096 5:82449732-82449754 AGGTCTAGGTTGGGGGTGGGTGG + Intergenic
993231957 5:85247889-85247911 CTTTCTTGGTTGTAGGGGGATGG + Intergenic
996007422 5:118439542-118439564 CTTTATATGTTGAGGGTGGGTGG - Intergenic
996381036 5:122862739-122862761 CTTTTGAGGATGGAGGTGAGAGG + Intronic
997470801 5:134115675-134115697 GTTTCTTGGTTGGAGGGCGGGGG + Intronic
997874813 5:137537936-137537958 CCGTCCAGGTGGGAGGTGGGGGG - Intronic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
999544604 5:152613334-152613356 CTTTCCAGGTTTGAGGAGAGAGG + Intergenic
999870276 5:155742648-155742670 CTTGCTTGGTATGAGGTGGGTGG - Intergenic
1000032067 5:157410816-157410838 CTTCCTAGCTCGGAAGTGGGAGG - Intronic
1000052145 5:157572804-157572826 CTTTGGAGGTCCGAGGTGGGCGG + Intronic
1000103368 5:158037089-158037111 CCTTCTGGGAGGGAGGTGGGGGG - Intergenic
1001394189 5:171404188-171404210 CTATCTGGGAGGGAGGTGGGGGG - Intronic
1001561040 5:172669210-172669232 CTTCCTAGGTGGGAGGTATGGGG - Intronic
1001763031 5:174223281-174223303 CACTCCAGGTTGGAGGTGGGAGG + Intronic
1001788739 5:174436719-174436741 CTTCCTTGGCTGGGGGTGGGGGG - Intergenic
1002159777 5:177308169-177308191 CTGCCTAGATTGGGGGTGGGGGG + Intronic
1003150526 6:3544415-3544437 ATTTCTAGGTTAGATGTGGAGGG + Intergenic
1004138305 6:12990272-12990294 CTCTCAAGGCTGGGGGTGGGTGG - Intronic
1004643917 6:17541334-17541356 CTTTGGGGGTTTGAGGTGGGAGG + Intronic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1005824230 6:29622928-29622950 CTTTCAAGGGGGGTGGTGGGTGG - Intronic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1007026666 6:38582993-38583015 CTCTCTAGATTGGAGGTGTCAGG - Intronic
1007858139 6:44879222-44879244 CATTCGAGCTTGGTGGTGGGAGG + Intronic
1007868313 6:45001180-45001202 TATTTTAGGATGGAGGTGGGTGG + Intronic
1009840436 6:69066139-69066161 GTGTGAAGGTTGGAGGTGGGGGG - Intronic
1011792165 6:90910321-90910343 GTTTCTAGTTTGTAGTTGGGGGG + Intergenic
1013015019 6:106153078-106153100 CTTTCTTGGGTGGAGATGGTTGG + Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013392588 6:109701677-109701699 CTTTCTGTGATGGGGGTGGGAGG - Intronic
1014451195 6:121583650-121583672 ATTTGTAGATTGGGGGTGGGGGG + Intergenic
1016614308 6:146028901-146028923 CTTTCTAACTTGGAGGGCGGTGG - Intronic
1017660673 6:156670378-156670400 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1018404910 6:163469704-163469726 CTGTCCAGGTTGGAGGAGTGGGG + Intronic
1018680823 6:166263389-166263411 CTTCCTGGAATGGAGGTGGGAGG + Intergenic
1018731005 6:166650429-166650451 CACTTTAGGCTGGAGGTGGGAGG + Intronic
1019847974 7:3525514-3525536 CTTTCCAGGTTGGTGGTGCTGGG - Intronic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021858758 7:24884548-24884570 CTTTTCAGCTGGGAGGTGGGTGG - Intronic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1022128360 7:27379371-27379393 CTAGATAGGTTGGAGGAGGGGGG + Intergenic
1022887494 7:34661576-34661598 AATTCAAGGGTGGAGGTGGGAGG - Intronic
1023164685 7:37331882-37331904 CTGTATGGGTTTGAGGTGGGAGG + Intronic
1023724914 7:43132816-43132838 CTTCTTCAGTTGGAGGTGGGAGG + Intronic
1025009579 7:55385243-55385265 CTTTCTGGGCTGGTGGTGTGGGG + Intronic
1025947130 7:66113295-66113317 CTTTGGGAGTTGGAGGTGGGAGG + Intronic
1026079523 7:67205370-67205392 CATTATAGGATGGAGGCGGGGGG + Intronic
1026569949 7:71520737-71520759 ATTACTAGGCTTGAGGTGGGAGG + Intronic
1026697324 7:72606612-72606634 CATTATAGGATGGAGGCGGGGGG - Intronic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1027336727 7:77158759-77158781 CTTTGTGGTGTGGAGGTGGGCGG - Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1029779063 7:102712352-102712374 CTTTGTGGTGTGGAGGTGGGCGG + Intergenic
1029801439 7:102951694-102951716 CTACTTAGGTGGGAGGTGGGAGG + Intronic
1029812065 7:103059160-103059182 CTTGCTAGGTGGGAGGTGGGAGG + Intronic
1030048185 7:105516050-105516072 CTTTACAAGTTTGAGGTGGGCGG - Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1033010684 7:137619389-137619411 CCTTCCAGGTTGGAAGTGGCAGG + Intronic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1033443067 7:141397449-141397471 CATTCTAAGTTGGAGGCTGGTGG - Intronic
1033860688 7:145623092-145623114 CTTTGGGAGTTGGAGGTGGGTGG - Intergenic
1035575559 8:702513-702535 CCGTCTTGGCTGGAGGTGGGAGG - Intronic
1035595444 8:853982-854004 CTTGCTAGGTAGGAGGTGCAGGG - Intergenic
1036568186 8:9956168-9956190 CTTTATAGGTTGGAGGTGGGTGG - Intergenic
1037442323 8:18928923-18928945 CTTGGGAGGCTGGAGGTGGGAGG - Intronic
1038619179 8:29123813-29123835 CTTTCTTTGTAGGGGGTGGGAGG + Intronic
1039872100 8:41554912-41554934 CCATTTAGATTGGAGGTGGGTGG + Intergenic
1040854300 8:51932802-51932824 CTTTCTAGGGAGGAGGTAAGAGG - Intergenic
1041057957 8:54007083-54007105 CTTTGGAAGCTGGAGGTGGGTGG - Intronic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1042255437 8:66798249-66798271 CTTTCTGGGGCTGAGGTGGGAGG - Intronic
1043476704 8:80612036-80612058 CCTTCTAGGGTGGAGGTAGGGGG + Intergenic
1043871022 8:85433048-85433070 ATTTGGAGGGTGGAGGTGGGAGG - Intronic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047976012 8:130131518-130131540 CTTTCTGGGGTCGAGGTGGGAGG + Intronic
1048985264 8:139731572-139731594 CTTGAGAGGTAGGAGGTGGGAGG + Intronic
1049756182 8:144312195-144312217 TTTTCAGGGGTGGAGGTGGGCGG - Exonic
1050003883 9:1107550-1107572 CTTCCTAGTTTGGACTTGGGAGG + Intergenic
1052024122 9:23556188-23556210 CTTTCTGGGATGGTGGAGGGGGG + Intergenic
1053042768 9:34888904-34888926 CATTCTAGGGTGGGGCTGGGAGG + Intergenic
1054798833 9:69326476-69326498 CGTTCCCGGTTGGAGGAGGGAGG - Intronic
1055242227 9:74197956-74197978 CTTTCCGGGAGGGAGGTGGGGGG + Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1055521417 9:77084699-77084721 ATGTCTGGGTTGGAGGTGTGAGG + Intergenic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056944693 9:90984311-90984333 CTTGGGAGGGTGGAGGTGGGAGG - Intergenic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059305227 9:113348697-113348719 CTTTCTGGGGTGGGAGTGGGTGG + Intergenic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1059960876 9:119563292-119563314 CTTTCAAAGTTGGACTTGGGAGG + Intergenic
1060478251 9:124000679-124000701 CCTTCTAAATTGGAGGAGGGAGG - Intergenic
1060526747 9:124325207-124325229 CTTTCTAGGTGGGAGGCCTGGGG + Intronic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1062432814 9:136533517-136533539 CTATCTGGGAAGGAGGTGGGCGG - Intronic
1062703326 9:137919596-137919618 CTCACTGGGTTGGAGGTGAGGGG - Intronic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1185569705 X:1124117-1124139 TGTTCTAGGTTGGAGGTTGGGGG + Intergenic
1186516279 X:10168037-10168059 CTTCCTAGGTTGGAGAGGAGAGG + Intronic
1186979579 X:14944819-14944841 CTTTATAGGTTGGGGGAGGGGGG + Intergenic
1187051948 X:15703822-15703844 CTTTCTTGGTGGGGGGGGGGAGG + Intronic
1187975481 X:24701100-24701122 CTTTCTTTTTTGGGGGTGGGAGG - Intronic
1188581094 X:31715200-31715222 CTTTCAAGATTGGGGGTTGGTGG + Intronic
1189790440 X:44598642-44598664 CTTTGCGGGGTGGAGGTGGGTGG + Intergenic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1190773048 X:53531128-53531150 GTTCCTGGGTTGGAGGTTGGGGG - Intergenic
1190878501 X:54476268-54476290 GTTTCTAGGAAGGAGGAGGGGGG - Intronic
1192252223 X:69422342-69422364 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1192326294 X:70134874-70134896 CTTTCTTGGCGGGTGGTGGGGGG + Intronic
1192761349 X:74098624-74098646 CTGTCCGGGATGGAGGTGGGGGG + Intergenic
1192768084 X:74162659-74162681 CTAGCTAGGTCGGAGGTGGCAGG - Intergenic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1193362337 X:80591506-80591528 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1193363579 X:80603931-80603953 CTTTTCAGGTTGGTGGTGGCGGG + Intergenic
1194418425 X:93641931-93641953 CTTTGAAGGTTAGTGGTGGGGGG + Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1196193167 X:112814743-112814765 CTTTCTCTGTTGTATGTGGGGGG - Intronic
1196303505 X:114072921-114072943 CTTTGTAAGTTGGAGGGGGAGGG + Intergenic
1197969059 X:132096018-132096040 CTTTTTTTTTTGGAGGTGGGGGG + Intronic
1199682707 X:150238748-150238770 GTTTCCAGGGTTGAGGTGGGTGG - Intergenic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic