ID: 954392195

View in Genome Browser
Species Human (GRCh38)
Location 3:50273697-50273719
Sequence TCCGGGAGCCCCCGCCGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954392180_954392195 29 Left 954392180 3:50273645-50273667 CCGTGAGTGCGGGAGTGGGTATG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 954392195 3:50273697-50273719 TCCGGGAGCCCCCGCCGCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954392195 Original CRISPR TCCGGGAGCCCCCGCCGCAG CGG Intronic
900578038 1:3393999-3394021 CCCTGGAGCCGCCGCCGCCGCGG - Intronic
901200258 1:7462956-7462978 TCCAGGAGCCCCCGACCCAGTGG - Intronic
906640678 1:47438875-47438897 GCCGGGATCCCCCGCCGCCGCGG - Exonic
907310124 1:53534343-53534365 TCAGGAAGGCCCCGCCCCAGTGG - Intronic
911723783 1:101220132-101220154 GCCTGGAGCTCCCGCCGCACTGG + Intergenic
916890282 1:169106692-169106714 TCCGAGAGCCGCAGCGGCAGCGG + Exonic
919789653 1:201283070-201283092 CCCGGGAGCCTCCACCGCCGGGG + Intergenic
921325815 1:213985554-213985576 GCCGGGAGCCTCTGCCGCCGAGG + Intronic
923299871 1:232630606-232630628 TCCGTGAGCCTCGGCCGCTGGGG + Intergenic
924706891 1:246509384-246509406 TCCTGCAGCCCTCGCCTCAGCGG - Intergenic
1063663597 10:8049532-8049554 TCCGGGGCGCCCTGCCGCAGCGG + Intergenic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1065841284 10:29703549-29703571 TGTCGGAGCCCCCGCCACAGGGG - Intronic
1067141341 10:43659641-43659663 TGAGGGAGCCCCCGCCCCATTGG - Intergenic
1067830974 10:49610814-49610836 TGCAGGAGCCCCGGCGGCAGAGG + Exonic
1073127142 10:101158402-101158424 TATGGGAGCCCCAGCAGCAGGGG + Intergenic
1075802552 10:125161598-125161620 TCCGGGAGACCGTGCCGGAGAGG + Intergenic
1076721777 10:132396324-132396346 TCGGGGAGCCCCTGCCGCGGGGG + Intergenic
1076886721 10:133266505-133266527 TCCGGGGACCCCCTCCACAGAGG - Intronic
1076929444 10:133520348-133520370 TCAGGGAGCCGCAGCCCCAGCGG + Intergenic
1077021109 11:417521-417543 CCCGGGAGCCGCTGCCGCACGGG + Intergenic
1077043245 11:533724-533746 CCCGGGAGCCCACGCCGCACAGG - Intronic
1081528502 11:43942825-43942847 CCCGGGGGGCCCCGGCGCAGCGG + Exonic
1083639813 11:64139441-64139463 TCGGGCTGCCCCCACCGCAGAGG + Intronic
1084686435 11:70698513-70698535 TCCTGGAGCCCCTGCCTGAGAGG - Intronic
1084791996 11:71480929-71480951 TCCAGGAGTCCCCACCCCAGGGG - Intronic
1085044014 11:73343108-73343130 CCCCGGCGCCCCCGCCCCAGCGG + Intronic
1085399049 11:76224640-76224662 TCCCGGCCACCCCGCCGCAGGGG - Intergenic
1085514561 11:77104833-77104855 CCCGGCAGCCCCAGCCACAGGGG - Intronic
1090231946 11:125113683-125113705 TCCGGGAGCCCAAGCCCCTGAGG - Intergenic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1103534759 12:121626824-121626846 CGCCGGAGCCGCCGCCGCAGCGG + Exonic
1104093286 12:125533673-125533695 TCCAGGAGCCTCCGCCGGGGAGG - Intronic
1104602453 12:130162677-130162699 CCCCGGAGCTCCCGGCGCAGCGG - Exonic
1106190740 13:27450416-27450438 TCCGGGTGCCTCCTCCACAGGGG + Intronic
1109145437 13:58773570-58773592 TCTGGGAGGCTCCGCCGCACAGG - Intergenic
1110619692 13:77581539-77581561 TCCAGGAGCCCCCCTGGCAGGGG - Intronic
1113494020 13:110713921-110713943 CCCGGGAGCCACCGCCACCGCGG + Intronic
1113705096 13:112425148-112425170 TCCGGGCGCCCACGCCACTGTGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114900978 14:27057502-27057524 TCTGTGAGCCCCTGCCTCAGAGG + Intergenic
1117377379 14:55129095-55129117 ACCCCGAGCCGCCGCCGCAGGGG - Exonic
1122418452 14:101561232-101561254 TCCGGCAGCCGCTGCCGCTGGGG - Intergenic
1122878101 14:104678063-104678085 TCCCGGAGCCCCCAGCCCAGCGG + Intergenic
1123709951 15:22980128-22980150 TCCCGGAGGCCGCGCCGCCGGGG + Intronic
1124394172 15:29286589-29286611 TCCTGGAGCCCCGGCCTCGGAGG + Intronic
1128582346 15:68818774-68818796 TCCGGAAGCCCCCTGCGCGGAGG - Intronic
1132688899 16:1173667-1173689 TCCGGGAACGCCCGTCGGAGGGG + Intronic
1134055335 16:11166459-11166481 AGCGGGAGCCCCAGCGGCAGCGG + Exonic
1138506138 16:57479235-57479257 TGCTGCAGCCCCCGCCCCAGAGG - Intronic
1139341298 16:66269862-66269884 TCCGGGTCTCCCCTCCGCAGAGG - Intergenic
1140469393 16:75205956-75205978 TGAGGGAGCCCCCGCAGAAGTGG + Exonic
1140472391 16:75222983-75223005 TGAGGGAGCCCCCGCAGAAGTGG - Exonic
1142192790 16:88725565-88725587 CCGGGGAGTCCCCGCCCCAGAGG + Intronic
1142223026 16:88864621-88864643 GGCGGGAGCCCCCTCTGCAGGGG - Intronic
1143768937 17:9155626-9155648 TCCAGGAGCGCCAGGCGCAGTGG - Intronic
1145023043 17:19446817-19446839 TCCGGGCCCCCCCGCTGCACCGG + Intergenic
1148090918 17:45022092-45022114 TCGGCGAGCGCCCGCCGCGGAGG + Intergenic
1148542637 17:48492651-48492673 TGCGGGAGCCGCGGGCGCAGAGG + Intergenic
1152361444 17:79834976-79834998 GCCTGGAGCACCCGCCGCACCGG + Exonic
1154303889 18:13217449-13217471 TCCGGGCCCGCCCCCCGCAGGGG + Intergenic
1157098751 18:44711072-44711094 TCAGTGAGCCCCCGCTGCTGGGG + Intronic
1159102351 18:63970627-63970649 TCCCGGAGCCTCCTCCGCAGCGG - Intronic
1160504728 18:79420598-79420620 TCCGGGAGACGTCGCTGCAGAGG + Intronic
1160562398 18:79766812-79766834 TCCAGGAGCCCAGGCTGCAGTGG - Intergenic
1161039133 19:2100742-2100764 CCCAGGAGCCCCCGGGGCAGGGG - Intergenic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1163708484 19:18831798-18831820 TCCTCGAGCTGCCGCCGCAGCGG + Intergenic
1164885037 19:31771269-31771291 TCAGGAAGCCCCCTCCACAGAGG + Intergenic
1166266173 19:41685920-41685942 TCCGTGAGACCCTGCCTCAGTGG + Intronic
1166983933 19:46648869-46648891 GCCGGGAACACGCGCCGCAGGGG + Exonic
1167613320 19:50517660-50517682 CCCCGCAGCCCCCGCCGCTGGGG + Exonic
932212706 2:69945637-69945659 TCCGGGAGCCTCCCCGGCTGTGG + Intergenic
934657608 2:96124166-96124188 TCCAGGAGCCCCGACCCCAGTGG - Exonic
935058532 2:99588666-99588688 TCTGGGAGCCCCTGTGGCAGAGG - Intronic
937366075 2:121262581-121262603 TCCCGGATCCCACGCTGCAGGGG - Intronic
948712412 2:239833361-239833383 TCCGGGAGCCTCCTCTCCAGGGG - Intergenic
948764506 2:240212513-240212535 GATGGGAGCCCCCGCCTCAGGGG - Intergenic
948836196 2:240627091-240627113 TCAGGGAGCTCCCGCTGCCGGGG - Intronic
948991958 2:241559839-241559861 TCCGGGAGCACCCGCCTGGGTGG - Intronic
949008754 2:241666785-241666807 TCCGTGAGCCCCAGGCGCAGGGG - Exonic
1168753122 20:297747-297769 TCCGCGAGCCGCGGCCGCCGCGG + Exonic
1171187445 20:23132989-23133011 TCCTGGAGCCCCCACCTCTGGGG - Intergenic
1173810490 20:45952374-45952396 TCTGGGAGTCCCCTACGCAGTGG + Exonic
1175696739 20:61108383-61108405 TCCTGGAGCCTCGGCCTCAGGGG - Intergenic
1175962102 20:62642442-62642464 TGGGGCCGCCCCCGCCGCAGAGG - Exonic
1176547493 21:8208127-8208149 TCCCGGAGCCGCCGCCTCTGCGG + Intergenic
1176566444 21:8391174-8391196 TCCCGGAGCCGCCGCCTCTGCGG + Intergenic
1177388050 21:20433035-20433057 CCCGTGAGCCCACGCCGCCGGGG + Intergenic
1179540505 21:42080352-42080374 ACCTGGAGGCCCCGCCACAGAGG - Intronic
1179719110 21:43305477-43305499 ACCTGGAGCTCCCACCGCAGTGG + Intergenic
1180064422 21:45405395-45405417 TCCAGGAGGCGCCGCCGCCGCGG - Intronic
1184101499 22:42343727-42343749 GCCGGGAGCCCGCGCCGCCCGGG - Intergenic
1185272750 22:49936271-49936293 TCGGGGAGCCCCCGCCCCCGGGG - Intergenic
950559246 3:13712441-13712463 TCCAGGTGCCCCCACCTCAGTGG - Intergenic
951558900 3:23946180-23946202 TCGGGGACGCCCCGCCGCGGGGG - Intronic
951710067 3:25577911-25577933 TCCTGTAGCCCCTGCCGAAGAGG + Intronic
954392195 3:50273697-50273719 TCCGGGAGCCCCCGCCGCAGCGG + Intronic
954403398 3:50331395-50331417 GCCAGGAGCCGCAGCCGCAGGGG + Exonic
961634425 3:128323928-128323950 TGAGGGAGCCCCTGCCACAGGGG - Intronic
961698863 3:128726332-128726354 GCCCGGAGCCCCCAGCGCAGCGG + Exonic
962350448 3:134651991-134652013 TCTGGGAGCCCTCCCCGCATTGG + Intronic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
965787025 3:172346358-172346380 TCCAGGAGGCCCTGCAGCAGTGG - Exonic
966849494 3:184155820-184155842 TCCGGGAGCCCCGGCCGCTCTGG + Intronic
968574936 4:1361233-1361255 TCCTGGAGTCCCAGCTGCAGGGG - Intronic
968731313 4:2270603-2270625 TCTGGGTGCCCCTGCAGCAGCGG + Exonic
975710628 4:77157397-77157419 TCGGGGACCCACCGCCTCAGCGG - Exonic
986152482 5:5140273-5140295 TCCCGCCGCCCCCGCCGCCGCGG + Intergenic
986667092 5:10113639-10113661 AGCGGGAGCCCCAGCAGCAGAGG + Intergenic
992399934 5:76403101-76403123 TGCGGGGGCCCCAGCTGCAGGGG + Intergenic
992673312 5:79081185-79081207 TCCGGGAGCACCCTCTCCAGAGG + Intronic
992940038 5:81751838-81751860 CCCGGGCGCCGCCACCGCAGCGG - Intergenic
1001395746 5:171418985-171419007 CCCGGGAGCCCCCTTCGCAGCGG + Intergenic
1001533232 5:172479550-172479572 GCCGGGAGCCCCCGCAGATGCGG + Intergenic
1003995536 6:11537296-11537318 TTCGGGGGCCCGCGCTGCAGGGG - Intergenic
1005940473 6:30556267-30556289 CGGGGCAGCCCCCGCCGCAGGGG + Exonic
1007276775 6:40679817-40679839 TCAGGGAGCCCCAGCCTGAGGGG + Intergenic
1007284594 6:40738394-40738416 CCAGGGAGCCCCAGCCGGAGGGG - Intergenic
1007729593 6:43937894-43937916 TCAGGGAGCCCCAGCCTGAGTGG - Intergenic
1007740004 6:44004463-44004485 TCAGGGAGCCCCAGTCGGAGGGG - Exonic
1007740017 6:44004502-44004524 TCAGGGAGCCCCAGTCGGAGGGG - Exonic
1013117730 6:107115333-107115355 CACAGGAGCCCCCGCTGCAGTGG + Intergenic
1013422532 6:109979225-109979247 TCCTAGAGCCGCCGCAGCAGGGG - Exonic
1015149235 6:130019886-130019908 GCCGGGAGCCCGCGCCGTCGCGG + Intronic
1018635545 6:165856107-165856129 TCAGGGAGCCCCTGCATCAGAGG - Intronic
1021230938 7:18086329-18086351 TCGGGGAGCCCCGGCCGCTCAGG - Intergenic
1021992593 7:26152434-26152456 TCCCGGCGCCCCAGCCGCCGGGG - Exonic
1026824074 7:73570483-73570505 TCTGGGAGGGCCCGGCGCAGAGG - Exonic
1028135358 7:87219145-87219167 TGCGGGAACCCCCTCCGGAGGGG - Intronic
1032401987 7:131630083-131630105 TCCGGGTTCCCCAGCCACAGAGG + Intergenic
1035022098 7:155806025-155806047 TTCTGGAGCCCCCACTGCAGGGG - Intronic
1035700373 8:1634306-1634328 TCCCGAAGCCCCCGGCTCAGTGG - Intronic
1035754803 8:2023140-2023162 ACCGGCAACCCCCGCAGCAGAGG - Intergenic
1035783265 8:2245000-2245022 ACAGGGAGCCCCCGCTGCACAGG + Intergenic
1035808859 8:2474586-2474608 ACAGGGAGCCCCCGCTGCACAGG - Intergenic
1035854820 8:2963425-2963447 TTCCGGAGCTCCCGCTGCAGCGG + Intronic
1036952483 8:13154289-13154311 TTCCTGAGCCCCCACCGCAGCGG - Intronic
1038350509 8:26771955-26771977 TTCGGGAGCCTCCTCTGCAGTGG + Intronic
1038441004 8:27570935-27570957 TCCAGAAGCCCCCTCCTCAGAGG + Intergenic
1048442748 8:134471918-134471940 TGGGGGAGCCCCCGCGGCTGAGG + Intergenic
1049664162 8:143835640-143835662 ACCCGGAGCCCCAGCCCCAGGGG - Exonic
1049835081 8:144730304-144730326 CCCGGGACGCCCCGTCGCAGCGG - Intronic
1051079467 9:13278878-13278900 TCCGGGAGCGGCCCCTGCAGGGG + Intronic
1061052747 9:128205778-128205800 TCCTGGAGCCCATGACGCAGGGG + Intronic
1062174991 9:135156689-135156711 TCCGAGAGCCCGCGCCTCAGTGG + Intergenic
1062442739 9:136578453-136578475 GCCGGGCGCCCCCACCGCTGTGG + Intergenic
1062543001 9:137049760-137049782 TCTCGGAGCACCCGCTGCAGTGG - Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1190053669 X:47170038-47170060 TCAGGGAGCCCCCACCCGAGGGG + Intronic
1195924920 X:110015731-110015753 TCCTGGAGCCCCAGCCCCACAGG + Intronic
1198286174 X:135194362-135194384 TCTGGGAGCCCCTGCTGCTGTGG + Intergenic
1198960175 X:142174896-142174918 TCGGGGAACCCCCACCTCAGAGG - Intergenic