ID: 954392775

View in Genome Browser
Species Human (GRCh38)
Location 3:50276109-50276131
Sequence AGGGAGAATCCGAAAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954392775_954392784 26 Left 954392775 3:50276109-50276131 CCCGCCTCTTTCGGATTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 199
Right 954392784 3:50276158-50276180 AGCCTTAAAATGTGCGCCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 64
954392775_954392785 27 Left 954392775 3:50276109-50276131 CCCGCCTCTTTCGGATTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 199
Right 954392785 3:50276159-50276181 GCCTTAAAATGTGCGCCTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954392775 Original CRISPR AGGGAGAATCCGAAAGAGGC GGG (reversed) Intronic
903442010 1:23395280-23395302 AGACAGAGTCAGAAAGAGGCTGG - Intronic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
910061734 1:83101811-83101833 AGGAAAAATCCTACAGAGGCTGG + Intergenic
915326047 1:155081751-155081773 ACGCAGAAACCGAGAGAGGCAGG - Intronic
918616842 1:186553753-186553775 AGGGAGACTGTGACAGAGGCAGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
921131990 1:212227829-212227851 AAGGAGAGTGGGAAAGAGGCAGG + Intergenic
922239293 1:223745071-223745093 GGGCAGAATGCTAAAGAGGCGGG + Intronic
922577433 1:226671649-226671671 AGGGAGAACCCCAGGGAGGCGGG + Intronic
923092782 1:230752607-230752629 AGGGAGGATGGGAAGGAGGCGGG + Intronic
1063889876 10:10618302-10618324 AGGGAGAGTAGGGAAGAGGCTGG - Intergenic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1066497979 10:35960746-35960768 AGGGATATTCCGAATGAGGAAGG + Intergenic
1067356508 10:45533481-45533503 TGGGAGCACCTGAAAGAGGCAGG + Intronic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1074688270 10:115979760-115979782 AGGGGAATTCCGACAGAGGCTGG + Intergenic
1075456204 10:122586633-122586655 AGGGAGAAGACGAAAGCGCCGGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1080068949 11:28055587-28055609 AGGGCAAATCAGAAATAGGCAGG + Intronic
1080585003 11:33674103-33674125 AGGTAGAATGAGAAACAGGCAGG - Intergenic
1081868086 11:46370638-46370660 AGGGAAAATCCGAGTGAGGCAGG + Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1083737374 11:64689207-64689229 AGGGAGACACAGAGAGAGGCAGG - Intronic
1088398302 11:109393293-109393315 AGGGAGAAATGGAAAGTGGCTGG + Intergenic
1089126727 11:116181462-116181484 TGGGAGAATCCCAAAGGTGCTGG - Intergenic
1089347138 11:117797562-117797584 AAGCTGAGTCCGAAAGAGGCAGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1094842295 12:34347226-34347248 AGGGGGCAGCCCAAAGAGGCAGG - Intergenic
1094870624 12:34597390-34597412 AGGGGGAAACCCAAAGCGGCAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1098454547 12:70657263-70657285 AGGGTGAATTTGAAGGAGGCAGG + Intronic
1108546212 13:51497315-51497337 AGGGAAAATTGGAAAAAGGCAGG - Intergenic
1109122211 13:58471700-58471722 AGGGAGTAAGTGAAAGAGGCAGG + Intergenic
1111127747 13:83934327-83934349 AATGAAAATCCAAAAGAGGCTGG + Intergenic
1112451856 13:99519325-99519347 AGTGAGATTCCTAAAGAGGAAGG - Intronic
1115558571 14:34562266-34562288 AGGTGGAATCGGACAGAGGCAGG - Intronic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116749721 14:48868264-48868286 AGGGATCATCCTAAAGAGGGAGG + Intergenic
1119321397 14:73733218-73733240 AAGGTGAATCAGAAATAGGCTGG + Intronic
1120938948 14:89927364-89927386 AGGGAGAATTCTAATTAGGCCGG - Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1122861758 14:104585747-104585769 AGACAGAATCAGAGAGAGGCAGG + Intronic
1124204730 15:27707489-27707511 AGGATGAATCTGAAAGAGGAAGG - Intergenic
1124341584 15:28893372-28893394 AGCCAGAATCAGTAAGAGGCTGG - Intronic
1125911618 15:43444877-43444899 AGGAAGGATCCAAAAGAGGGAGG - Intronic
1128625054 15:69192957-69192979 AGGGTGAACCCCCAAGAGGCTGG - Intronic
1129298148 15:74611052-74611074 AGGGAGAATCTGAGGGAGGGAGG - Intronic
1129683499 15:77671593-77671615 AGGGAGAATAGGAAGGAGACCGG - Intronic
1130761544 15:86825702-86825724 AGGGAGAAAGCGAGAGAGGGAGG + Intronic
1131838465 15:96413105-96413127 AGTGAGAATCAGAGAGATGCAGG - Intergenic
1132397643 15:101486453-101486475 ATGGATAATCCAAAAGAGCCTGG - Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136555650 16:31006355-31006377 AGGGAGGATGAGAAAGGGGCAGG - Intronic
1136625332 16:31458776-31458798 AGGGAGAATCCGGACGGGGCGGG - Intronic
1137253971 16:46760180-46760202 AGGGAGAGTCCGCACGAAGCTGG + Intronic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139768637 16:69254322-69254344 TTGGAGAATCCCTAAGAGGCCGG - Intronic
1142638501 17:1271760-1271782 AGGCAGGATCCGGGAGAGGCAGG + Intergenic
1144158358 17:12531078-12531100 AAATAGAATCTGAAAGAGGCAGG - Intergenic
1144710215 17:17396573-17396595 GGCGAGAATCCAAAAGATGCAGG - Intergenic
1144742280 17:17590788-17590810 AGGGAGAATGCAAGAGAGGTTGG + Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147176425 17:38658846-38658868 AGGGAGGGTCCGGAGGAGGCTGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147766199 17:42838016-42838038 AGGGAAAATGAGAGAGAGGCAGG + Intronic
1147964510 17:44186981-44187003 CGGGAGAAGCCGGAAGAGACCGG + Intronic
1149354756 17:55828365-55828387 AGGCAGAAACTGGAAGAGGCAGG - Intronic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149564460 17:57631159-57631181 AGGGGGACTCAGAAAGGGGCTGG - Intronic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1153604450 18:6817738-6817760 AGGGAGAATGGGAAAGAGAAAGG + Intronic
1154494012 18:14942458-14942480 ATGGAGAGTCCCAAATAGGCTGG - Intergenic
1159075987 18:63682776-63682798 AGGGAGAATCTGGAACAGGGAGG - Intronic
1159959538 18:74544948-74544970 AGAGAGACACAGAAAGAGGCTGG + Intronic
1159966485 18:74600267-74600289 AGGCAGCAACCAAAAGAGGCTGG + Intronic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1161468384 19:4444560-4444582 AGGGTGAATCAGAGAGAGACTGG - Intronic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1163666868 19:18607370-18607392 GCGGAGAATCGAAAAGAGGCAGG - Intronic
1166361445 19:42254425-42254447 AGCGAGGAGCCGACAGAGGCGGG + Intronic
1166982367 19:46638921-46638943 AGGGAGAGTCAGAGAGACGCAGG + Intergenic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167463927 19:49640302-49640324 AGGGGAATTCCGAATGAGGCGGG + Intergenic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167650407 19:50725527-50725549 AGGGAGATTCCGGAGGAGGGTGG - Exonic
925373123 2:3361983-3362005 AGGGAGCATGCCAAAGAGGAAGG - Intronic
925972152 2:9113368-9113390 AGGGAGGATGGGAAAGATGCAGG - Intergenic
926729245 2:16022860-16022882 AGAGAGAATTCGACAGAGCCAGG + Intergenic
927330632 2:21859342-21859364 AAGGAGGATCTGTAAGAGGCTGG + Intergenic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
930774925 2:55162027-55162049 AGGCAGAATGCCAATGAGGCTGG + Intergenic
931494218 2:62784495-62784517 AGTGAGGATGCTAAAGAGGCAGG + Intronic
931766254 2:65459145-65459167 AGGGTGAGTCAGAAAAAGGCTGG - Intergenic
931859004 2:66334137-66334159 AGTGAGGATCAGAAAGAAGCGGG - Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
936344029 2:111661639-111661661 AGGAAGAAGCTGAAAGAGACAGG - Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
939442738 2:142270930-142270952 TGGGAGAATTTGAAAGAGGGAGG - Intergenic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
944526833 2:200627903-200627925 AGGGAGAATCAGAGAGAGAAAGG - Intronic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
947810894 2:233003348-233003370 AGGAAGGATCAGAAATAGGCTGG - Intronic
1169044975 20:2527977-2527999 AGAGAGAATACAGAAGAGGCTGG + Intergenic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1175197467 20:57254317-57254339 AAGAAGAAACCAAAAGAGGCTGG - Intronic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1176233974 20:64045626-64045648 AGCCAGAATCCGCAAGTGGCTGG - Intronic
1178059195 21:28833755-28833777 AGTGAGAAAACGATAGAGGCAGG - Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1180059678 21:45378398-45378420 AGGAAGAATCACAAAGAGCCTGG - Intergenic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
953200694 3:40776405-40776427 AGGGTGAATAGGATAGAGGCAGG + Intergenic
953236859 3:41114452-41114474 AGGGAGAGTCAGAGAGAGGGAGG + Intergenic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
956188396 3:66584205-66584227 AGGGAGAATTTGAAAGAGTGAGG + Intergenic
956751388 3:72346568-72346590 AGCCAGAATCTGGAAGAGGCTGG + Intergenic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962133759 3:132710657-132710679 AGGGTGAGTCCGGGAGAGGCTGG - Intronic
962237109 3:133716040-133716062 AGGGAGAATCCAAGAGAGTGTGG - Intergenic
965784333 3:172320081-172320103 TGGAAGAATCTGAAAGAGGCCGG + Intronic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
970359098 4:15289852-15289874 AGGGAGACTATGCAAGAGGCAGG + Intergenic
971605929 4:28657291-28657313 AGGGACAATCTGAAAGAGTAAGG + Intergenic
973270117 4:48254233-48254255 AGGGAGAATGACAAAGAGGTTGG + Intronic
974593263 4:63983456-63983478 GGTGAGAATCTGAAAGTGGCTGG - Intergenic
974845802 4:67350275-67350297 AGGGAGAATTCAAAAAAGGAAGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975475876 4:74822773-74822795 AGGGAGAATATGAGAGAGGAAGG - Intergenic
975870710 4:78776178-78776200 AGGAAGAGAGCGAAAGAGGCTGG - Intergenic
978168752 4:105643246-105643268 AGAGAGACTCGGAAAGAGGGAGG - Intronic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
991707211 5:69369543-69369565 AGGGAGGAGCCGGAAGGGGCGGG + Exonic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996746245 5:126848498-126848520 TGGGAGAAACCGACAGGGGCAGG + Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
997755609 5:136396274-136396296 AGGAAGAATGGAAAAGAGGCAGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
1002641434 5:180632397-180632419 AGGGAGAGCCCGGAGGAGGCTGG - Intronic
1003410921 6:5862351-5862373 AGGGAGAATGCGAGAGTGGGAGG + Intergenic
1005620558 6:27616297-27616319 AGGGAGAATGCTGAAGGGGCGGG - Intergenic
1007299421 6:40855652-40855674 AGGGAGAACCCAAAAGAGACAGG + Intergenic
1007625216 6:43242750-43242772 AGGAAGAAACTGAAAGAGACAGG + Intergenic
1011713222 6:90076499-90076521 AAGGAGAATACAAAATAGGCAGG + Intronic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017832315 6:158141668-158141690 AGGAAGAATCAAAAAGAGCCAGG + Intronic
1018232651 6:161690421-161690443 AGGAAGAATCTGGAAGATGCTGG + Intronic
1018573542 6:165234754-165234776 AGGAAGAATTTCAAAGAGGCAGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021874186 7:25033079-25033101 AGGGGGCATGAGAAAGAGGCAGG + Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1025073700 7:55924393-55924415 AGGGAGATACAGAGAGAGGCTGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026927547 7:74204489-74204511 AGGGAGAAAGGGAAAGAGGGAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031452575 7:121940033-121940055 AGGAAGAATGCGGTAGAGGCTGG - Intronic
1032059666 7:128714143-128714165 AGGGAGAAGCCTAAAGGGCCTGG - Intronic
1033135617 7:138781624-138781646 ATAGAAAATCTGAAAGAGGCTGG - Intronic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1035081947 7:156223564-156223586 AGTGAGAATACGAAAGAAGATGG - Intergenic
1035265448 7:157688459-157688481 GCGGAGAGTCTGAAAGAGGCTGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1036546139 8:9771554-9771576 AGGGAGAAAGCGAGAGAGGAAGG + Intronic
1036546168 8:9771702-9771724 AGGGAGAAAGCGAGAGAGGAAGG + Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1043977063 8:86595255-86595277 AGGGAGGAACCCAAACAGGCTGG + Intronic
1045192916 8:99900909-99900931 AGGGAGAATGGGGAAGAGGGAGG - Intergenic
1045432010 8:102123700-102123722 AGGGAGAGGCCGAAAGGCGCTGG - Intronic
1049249659 8:141581559-141581581 AGAGAGAGACAGAAAGAGGCGGG + Intergenic
1052106361 9:24522047-24522069 AGGGAGAAAGGGAAAGAGGGAGG - Intergenic
1055728589 9:79257869-79257891 GGGGAGAATACGAAAGAGAGAGG - Intergenic
1059258992 9:112957857-112957879 AGGGAAGATCCTAAAGATGCAGG + Intergenic
1060624363 9:125096728-125096750 TGGGAGAATGGGATAGAGGCAGG - Intronic
1061831563 9:133299643-133299665 AGGGAGAACCCAAAAGAGCCTGG + Intergenic
1062275148 9:135726998-135727020 AGGGAGAATGGGAAAGAGAGAGG - Intronic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1187027876 X:15454971-15454993 AGGCAGAGTCCTAAAGAGGGTGG - Intronic
1187641861 X:21300146-21300168 AGGGAGGATCCCAACGTGGCAGG - Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1191021226 X:55862498-55862520 ATGGAGAATCCAGGAGAGGCAGG + Intergenic
1192908895 X:75582448-75582470 AGGGAGAATACTAAGGATGCTGG - Intergenic
1195009070 X:100717525-100717547 AGGGAGAATGCGGAAGAGGCAGG + Intronic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1199424926 X:147690425-147690447 AGGGAGGATTCGCAAGAGGTAGG + Intergenic
1199827046 X:151510534-151510556 AGGGAGAAACGGAGAGAGGTAGG + Intergenic
1200009779 X:153112282-153112304 AGGGAGGAACCAAGAGAGGCGGG - Intergenic
1200029821 X:153287640-153287662 AGGGAGGAACCAAGAGAGGCGGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic