ID: 954394969

View in Genome Browser
Species Human (GRCh38)
Location 3:50288604-50288626
Sequence CGAACCCAGCACTTCCTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954394965_954394969 4 Left 954394965 3:50288577-50288599 CCGCACCTGGAGGTGGTGGTGCA 0: 1
1: 0
2: 3
3: 36
4: 251
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394957_954394969 16 Left 954394957 3:50288565-50288587 CCCTGTCCGTCCCCGCACCTGGA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394963_954394969 6 Left 954394963 3:50288575-50288597 CCCCGCACCTGGAGGTGGTGGTG 0: 1
1: 0
2: 4
3: 20
4: 341
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394953_954394969 21 Left 954394953 3:50288560-50288582 CCCCTCCCTGTCCGTCCCCGCAC 0: 1
1: 0
2: 1
3: 46
4: 832
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394964_954394969 5 Left 954394964 3:50288576-50288598 CCCGCACCTGGAGGTGGTGGTGC 0: 1
1: 1
2: 3
3: 37
4: 392
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394961_954394969 10 Left 954394961 3:50288571-50288593 CCGTCCCCGCACCTGGAGGTGGT 0: 1
1: 0
2: 0
3: 23
4: 211
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394966_954394969 -1 Left 954394966 3:50288582-50288604 CCTGGAGGTGGTGGTGCATGCCC 0: 1
1: 0
2: 20
3: 234
4: 990
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394954_954394969 20 Left 954394954 3:50288561-50288583 CCCTCCCTGTCCGTCCCCGCACC 0: 1
1: 0
2: 3
3: 38
4: 514
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394955_954394969 19 Left 954394955 3:50288562-50288584 CCTCCCTGTCCGTCCCCGCACCT 0: 1
1: 0
2: 2
3: 34
4: 358
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394958_954394969 15 Left 954394958 3:50288566-50288588 CCTGTCCGTCCCCGCACCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 114
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394952_954394969 29 Left 954394952 3:50288552-50288574 CCAGATGTCCCCTCCCTGTCCGT 0: 1
1: 0
2: 1
3: 11
4: 198
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954394969 Original CRISPR CGAACCCAGCACTTCCTTGA AGG Exonic