ID: 954394969

View in Genome Browser
Species Human (GRCh38)
Location 3:50288604-50288626
Sequence CGAACCCAGCACTTCCTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954394953_954394969 21 Left 954394953 3:50288560-50288582 CCCCTCCCTGTCCGTCCCCGCAC 0: 1
1: 0
2: 1
3: 46
4: 832
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394963_954394969 6 Left 954394963 3:50288575-50288597 CCCCGCACCTGGAGGTGGTGGTG 0: 1
1: 0
2: 4
3: 20
4: 341
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394955_954394969 19 Left 954394955 3:50288562-50288584 CCTCCCTGTCCGTCCCCGCACCT 0: 1
1: 0
2: 2
3: 34
4: 358
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394961_954394969 10 Left 954394961 3:50288571-50288593 CCGTCCCCGCACCTGGAGGTGGT 0: 1
1: 0
2: 0
3: 23
4: 211
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394954_954394969 20 Left 954394954 3:50288561-50288583 CCCTCCCTGTCCGTCCCCGCACC 0: 1
1: 0
2: 3
3: 38
4: 514
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394965_954394969 4 Left 954394965 3:50288577-50288599 CCGCACCTGGAGGTGGTGGTGCA 0: 1
1: 0
2: 3
3: 36
4: 251
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394952_954394969 29 Left 954394952 3:50288552-50288574 CCAGATGTCCCCTCCCTGTCCGT 0: 1
1: 0
2: 1
3: 11
4: 198
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394958_954394969 15 Left 954394958 3:50288566-50288588 CCTGTCCGTCCCCGCACCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 114
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394957_954394969 16 Left 954394957 3:50288565-50288587 CCCTGTCCGTCCCCGCACCTGGA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394964_954394969 5 Left 954394964 3:50288576-50288598 CCCGCACCTGGAGGTGGTGGTGC 0: 1
1: 1
2: 3
3: 37
4: 392
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
954394966_954394969 -1 Left 954394966 3:50288582-50288604 CCTGGAGGTGGTGGTGCATGCCC 0: 1
1: 0
2: 20
3: 234
4: 990
Right 954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954394969 Original CRISPR CGAACCCAGCACTTCCTTGA AGG Exonic
903427031 1:23261463-23261485 AGAACCCAGAACTACCTTCATGG - Intergenic
903660466 1:24974118-24974140 CCAACACATCACTTTCTTGATGG - Intergenic
905502918 1:38453730-38453752 CCATCACAGCACTTCCTTGGTGG - Intergenic
905502933 1:38453809-38453831 CTATCCCAGCACTTCCCTGTTGG - Intergenic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
908445701 1:64197438-64197460 AGAACCCAGGTCTGCCTTGAAGG + Intergenic
913201026 1:116495510-116495532 CAAACCCAGCAATTCCTTCCTGG + Intergenic
913386737 1:118265940-118265962 AGACACCAGCACTTACTTGAGGG + Intergenic
919086015 1:192920576-192920598 CCAACCCAAAACCTCCTTGATGG - Intergenic
919788344 1:201274583-201274605 GGAACCCCCCAATTCCTTGACGG + Intergenic
919840216 1:201603619-201603641 TGAACCCTTCCCTTCCTTGAAGG + Intergenic
922807317 1:228397117-228397139 CGAACCCAGCCTCTCCTGGAGGG - Intronic
1065864753 10:29904686-29904708 CCAACTCAGGACATCCTTGAAGG + Intergenic
1070783323 10:79149713-79149735 CGAATGCAGAACTTCCTGGAGGG - Intronic
1071784438 10:88882594-88882616 AGCACCTAGCACTTCCTGGACGG - Intronic
1072207871 10:93220951-93220973 CGAGCCCAGGACCTCATTGACGG - Intergenic
1073462616 10:103675154-103675176 CGAAGCCAGCTCTGCCTTGGAGG - Intronic
1074775691 10:116766891-116766913 CAAACCCAGCAGTTCCCTGGGGG - Intergenic
1079243452 11:18736850-18736872 CGATCCCAGCCCTACCTGGAGGG - Intronic
1083666388 11:64277158-64277180 CAAACCCAGCCCTTGCCTGATGG - Intronic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090251599 11:125255566-125255588 CTAACACAGAAATTCCTTGAGGG - Intronic
1091682349 12:2536118-2536140 GGGGCCCAGCACTACCTTGAAGG - Intronic
1105062284 12:133163563-133163585 GGAACTCAGAACTTCCATGAAGG - Intronic
1107544050 13:41420510-41420532 CCAACCCAGCTCTTGCATGATGG - Intergenic
1114466119 14:22924007-22924029 GGAGCCCAGCACTTCCTAAAAGG - Exonic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124229984 15:27936214-27936236 CAAACCCAGTGCTTCCTTGTGGG + Intronic
1131102688 15:89705605-89705627 GGAACTCACCACTTCATTGATGG - Exonic
1131505846 15:93018354-93018376 TGAGCTCAGCACTTCCTTAATGG + Intronic
1134419118 16:14070212-14070234 GGAGCCCAGCACTACCTTGTAGG - Intergenic
1135040978 16:19116037-19116059 CGCACCCAGGGCTTCCTTGAAGG + Exonic
1136316238 16:29455932-29455954 CGGATCCAGCTCTTTCTTGAGGG + Intronic
1136430815 16:30195274-30195296 CGGATCCAGCTCTTTCTTGAGGG + Intronic
1138218167 16:55223961-55223983 CTAACCCAGTAATTCCCTGAGGG - Intergenic
1138714847 16:59009353-59009375 GGAACCCAGGTCTTGCTTGATGG + Intergenic
1140192632 16:72830943-72830965 CAGACCCAGTACTTCCTTGCTGG - Intronic
1141914063 16:87081910-87081932 GGAAACCAGCAGTTCCCTGAGGG - Intergenic
1152572429 17:81126709-81126731 AGCACCCAGCAGTTCCTGGAGGG + Intronic
1154239406 18:12638835-12638857 GGAAGCCAGCACGTCCTGGATGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1158947457 18:62459430-62459452 GGAACCCAGCAGCTCCTTGGTGG + Intergenic
1159526836 18:69603128-69603150 CGAACTGAGCACTCCCTTCAGGG + Intronic
1166441493 19:42819258-42819280 CTGCCCCAGGACTTCCTTGAAGG - Intronic
1166460922 19:42987544-42987566 CTGCCCCAGGACTTCCTTGAAGG - Intronic
1167007890 19:46787417-46787439 CGAATCGAGCACCTCCTTGCTGG + Exonic
925317964 2:2939774-2939796 TTAACACAGCACCTCCTTGAGGG + Intergenic
927228650 2:20797441-20797463 GGGACCCAGCATTTCATTGACGG - Intronic
929645089 2:43618228-43618250 CTAAACCATAACTTCCTTGAAGG + Intergenic
932209228 2:69914196-69914218 CGATTCCAGCTCTTTCTTGAGGG + Intronic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
935321740 2:101896126-101896148 CTTCCCCAGCACTTCCTGGAAGG - Intergenic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
938300413 2:130207343-130207365 CTAACCCAGCACCACCTCGAGGG - Intergenic
938456315 2:131467134-131467156 CTAACCCAGCACCACCTCGAGGG + Intronic
940027322 2:149222135-149222157 CGAAGCCCGCAGTGCCTTGAGGG + Intergenic
944311516 2:198238897-198238919 CCAACCCCTCTCTTCCTTGAGGG + Intronic
1170181049 20:13530467-13530489 CTGACCCAGCACTTGCTTCAGGG - Intronic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1175936361 20:62515965-62515987 CGCACCCAGGGCTGCCTTGAGGG - Intergenic
1179065984 21:38025310-38025332 CGATCCCACTACTTCCCTGATGG + Intronic
1179792074 21:43761564-43761586 CGAAGCCAGCATCTCCGTGAAGG + Exonic
1180062772 21:45394032-45394054 CGAACCCAGCTCTTCCCTTGTGG + Intergenic
1183768115 22:39898146-39898168 AGAAGCCAGTACTTCCTGGATGG - Intergenic
1184048646 22:41988347-41988369 TGTTCCCAGCACTTCCTTCATGG - Intronic
950456429 3:13095413-13095435 CGAAGCCAGCACTTCCCTAAAGG - Intergenic
952074866 3:29683605-29683627 CAAACACACCACCTCCTTGAAGG + Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
964314557 3:155429510-155429532 AGAAACCAGCATTTCCTTGTGGG - Intronic
966173733 3:177112711-177112733 CGCACCCAGCAGGTCTTTGAGGG - Intronic
966863198 3:184241904-184241926 CGGGCCCAGCACTTGCCTGACGG + Exonic
968960481 4:3740750-3740772 CAAACCCAGCTCTTCCTCCACGG - Intergenic
969160143 4:5249916-5249938 TGAAACCAGCGCCTCCTTGAGGG - Intronic
970687396 4:18584096-18584118 CAAACCCTGCACTTCCTTCATGG - Intergenic
999805905 5:155081125-155081147 AGAACGCAGCACAGCCTTGAGGG + Intergenic
1001645395 5:173277961-173277983 CTAACACAGAAGTTCCTTGAGGG - Intergenic
1002942800 6:1733059-1733081 CAGACCCAGCACTTCCTTACAGG + Intronic
1009198187 6:60712231-60712253 TGAACCCATCTATTCCTTGAAGG - Intergenic
1012445673 6:99304829-99304851 ATAACACAGCACTCCCTTGATGG + Intronic
1020210730 7:6156283-6156305 CGAAACCAGTAGTTACTTGAAGG - Intronic
1021058926 7:16085502-16085524 GGAAGCAAGCACTTTCTTGATGG - Intergenic
1022418277 7:30196991-30197013 CTAACCCAACAATTTCTTGAGGG - Intergenic
1028593170 7:92520200-92520222 AGTACCCAGCACTTCCCTGTGGG - Intronic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1034274540 7:149818289-149818311 CAAGCACAGCACTTCCTTGCAGG - Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1043402345 8:79896321-79896343 CGACCCCCGCTTTTCCTTGATGG - Intergenic
1046723489 8:117649138-117649160 TAAACACAGCACTCCCTTGAGGG - Intergenic
1050077154 9:1877221-1877243 CAAACCCAGGATTTCCATGAAGG + Intergenic
1050314688 9:4389330-4389352 GAAATCCAGTACTTCCTTGAAGG - Intergenic
1061753499 9:132797102-132797124 TGCAGCCAGCACTTCCTGGAAGG + Intronic
1061840046 9:133353387-133353409 GGACCCCAGCCCTACCTTGAGGG - Intronic
1062541426 9:137043348-137043370 AGAACTCAGCACTGCCTGGACGG - Intronic
1188978992 X:36709385-36709407 TGAACCAAGCACCTCCTTCAAGG - Intergenic
1191871895 X:65753068-65753090 CTAACCGAGCAATCCCTTGATGG + Intergenic
1201077095 Y:10196629-10196651 CAAACCCAGCTCTGCCTTGTGGG + Intergenic