ID: 954395318

View in Genome Browser
Species Human (GRCh38)
Location 3:50290336-50290358
Sequence CCTTGATCACACTTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954395318 Original CRISPR CCTTGATCACACTTGGAGCT GGG Intronic
902809444 1:18879910-18879932 GGTTGGTCACACTTGGAGCCTGG - Intronic
902925079 1:19690603-19690625 CCTTGGCCACACTTGCAGCAGGG - Intronic
905822170 1:41001778-41001800 CCTTGATCTCCCAAGGAGCTGGG - Intronic
907299769 1:53479381-53479403 CCTTGCTCACACCTTGATCTTGG + Intergenic
907710614 1:56877172-56877194 CCTTGATAACACCTTGATCTTGG + Intronic
912866825 1:113264985-113265007 CCTGGGTTACCCTTGGAGCTTGG + Intergenic
916803109 1:168232712-168232734 CATTGATCACACTCTGTGCTGGG + Intronic
916902408 1:169243511-169243533 CCTTTATCACATTGGGAGTTAGG - Intronic
922819886 1:228476912-228476934 CCTTGTTCACACCTTGATCTCGG + Intergenic
922962527 1:229661165-229661187 TCTTGTTCACAATTGGAGATGGG + Intergenic
1062877383 10:954072-954094 CCTTGCTCACACCAGCAGCTGGG + Intergenic
1063002437 10:1937050-1937072 CCATGATGACACATGGAGGTGGG - Intergenic
1065021111 10:21502070-21502092 ACTTGCTCCCACTTGGAGTTTGG - Intergenic
1067282301 10:44881608-44881630 CCCTGGTCACACTTGGGCCTGGG - Intergenic
1069059923 10:63884804-63884826 CCTAGAGAACACTTGGAGATGGG - Intergenic
1069994829 10:72335768-72335790 CCTGGCTCATACTTGGACCTCGG + Exonic
1074881576 10:117663519-117663541 CCAAGATCACAATGGGAGCTGGG - Intergenic
1080037072 11:27721199-27721221 CGTGGAACAAACTTGGAGCTGGG - Intronic
1081326346 11:41749996-41750018 GCTTGATCACTGTTGGTGCTTGG + Intergenic
1081605611 11:44525511-44525533 GCTTGATCTCACTTGGGGCCTGG - Intergenic
1083968910 11:66060494-66060516 CCATGATCTCATTTGGAGTTGGG + Intronic
1085303517 11:75472487-75472509 CCCAGATCACCCTGGGAGCTGGG - Intronic
1087760940 11:102103855-102103877 CCTTGATCAGACTTGCATGTTGG + Intergenic
1090989304 11:131801835-131801857 CCTTGATCAGAATGTGAGCTGGG + Intronic
1095825080 12:46522731-46522753 GCTTGATCAGAATTGGGGCTTGG + Intergenic
1103421529 12:120788533-120788555 CCTTGATTATAATAGGAGCTAGG - Intronic
1104610323 12:130222258-130222280 CCCTGCTGACACTTTGAGCTTGG - Intergenic
1106077099 13:26469882-26469904 CCTTGCTCACATTTGGTGCCTGG + Intergenic
1107927287 13:45275260-45275282 ACTTGATCATACTTGGATTTTGG - Intronic
1109041917 13:57349364-57349386 GCTTGCCAACACTTGGAGCTGGG - Intergenic
1116153881 14:41178267-41178289 CCTTGATAAAGCTGGGAGCTAGG - Intergenic
1117243753 14:53862602-53862624 CCTTAAACACACTTGGAATTAGG - Intergenic
1119212142 14:72839903-72839925 TCCTGATCGCACCTGGAGCTGGG - Intronic
1121013867 14:90536604-90536626 GGTTGCTCACACATGGAGCTGGG - Exonic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1123945705 15:25237868-25237890 GCTTCAGCACACTTGGAGCTGGG - Intergenic
1124393795 15:29283003-29283025 CCATGCTCACACAGGGAGCTGGG + Intronic
1126638213 15:50800174-50800196 CTGTGATCACAATTGCAGCTAGG - Intergenic
1126694333 15:51313468-51313490 CCTTGCTCACGTTTGGACCTCGG + Intronic
1126856467 15:52844309-52844331 CCTTGCCAACACTTTGAGCTTGG + Intergenic
1129237108 15:74230220-74230242 CCTTGGTCAGATTTGGAGGTTGG + Intergenic
1138108117 16:54301756-54301778 TCTTGATCACACCTGGAATTGGG - Intergenic
1141479078 16:84294491-84294513 CCTTGTTCACATTTCGAGCTGGG - Intergenic
1141697033 16:85625020-85625042 CCTTGATCGCTGTTGGTGCTGGG + Intronic
1141784141 16:86187203-86187225 CCCTGGTCTCACTTGCAGCTGGG + Intergenic
1141939425 16:87265007-87265029 CCTGCCTCCCACTTGGAGCTTGG - Intronic
1142008923 16:87704036-87704058 CCGTGATCACAGCTAGAGCTCGG + Intronic
1143353049 17:6303388-6303410 CCTTCATCACACTTGGTCCCAGG + Intergenic
1144136766 17:12302552-12302574 CCTTGCTCACACCTTGATCTTGG - Intergenic
1144752585 17:17659697-17659719 CCTTGCCCACACTTTGATCTTGG + Intergenic
926612403 2:14959467-14959489 CCTTGATCACAGTTGCAATTTGG - Intergenic
935427914 2:102940464-102940486 CCTTGATCCCAATTGAAGTTAGG + Intergenic
937707747 2:124940961-124940983 TTGTGATCACATTTGGAGCTAGG + Intergenic
940515169 2:154675346-154675368 CATTTCTCACACTTGAAGCTTGG + Intergenic
943429630 2:187783091-187783113 CCTGGATCAGAGTTGGAGCTGGG + Intergenic
947265373 2:228273740-228273762 CCCTGATTACACTTTGATCTTGG - Intergenic
948754758 2:240152612-240152634 CCATGGTCACACTGGAAGCTGGG + Intergenic
948883077 2:240870194-240870216 CCTTGACCTCTGTTGGAGCTGGG - Intronic
1171290740 20:23981630-23981652 CCTTGATCACCCTGGGGGGTTGG - Intergenic
1175910389 20:62402582-62402604 CACTGCCCACACTTGGAGCTGGG - Intronic
1177424008 21:20898920-20898942 CCTTGCTGACACTTTGATCTTGG + Intergenic
1182062292 22:27406871-27406893 CCTTGCTCACATCTGGAGCAGGG - Intergenic
1182375136 22:29841286-29841308 CCTTGAGATCTCTTGGAGCTTGG - Intergenic
1183395078 22:37566885-37566907 CTTGGAGCTCACTTGGAGCTTGG - Intronic
1184259573 22:43306930-43306952 TCATCAGCACACTTGGAGCTGGG - Intronic
1185310572 22:50152011-50152033 TCTAGATCACATTTGGAGTTTGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
954271160 3:49510512-49510534 ACTTGAGCAAACTTGGACCTGGG + Exonic
954395318 3:50290336-50290358 CCTTGATCACACTTGGAGCTGGG + Intronic
955390274 3:58517562-58517584 CCTTGATCAGACCCAGAGCTAGG - Intronic
956095427 3:65711116-65711138 CCTAGAACACACTTGGTGTTTGG - Intronic
961015594 3:123465822-123465844 CCCTCGTGACACTTGGAGCTAGG + Intergenic
964119925 3:153173085-153173107 CCCTGTTCACATTTTGAGCTAGG + Intergenic
965156905 3:165071829-165071851 CCTTGATGACACCTTGATCTTGG + Intronic
965963633 3:174458585-174458607 CCTTGACCTACCTTGGAGCTTGG - Intronic
966449439 3:180041167-180041189 CATTGGTCACAGTTGGAGATGGG + Intergenic
966630700 3:182071206-182071228 CCCTGATGACACTTCGAACTTGG - Intergenic
966854514 3:184184960-184184982 CATTGATCATAGTTGAAGCTGGG - Intronic
969182179 4:5450749-5450771 CATTCATCAGTCTTGGAGCTGGG - Intronic
974102020 4:57427608-57427630 CCATGATCCAACTTGGAGTTGGG + Intergenic
975771001 4:77722445-77722467 CCTTGACCTCCCTAGGAGCTGGG - Intronic
976824824 4:89249180-89249202 CCTTGATTTCACTTTCAGCTTGG + Exonic
977159922 4:93621180-93621202 CCCAGATAACACTAGGAGCTAGG - Intronic
978533118 4:109733917-109733939 CCTTGATCTCCCTAGGTGCTGGG - Intergenic
985625308 5:982516-982538 CCTGGACCTCACTTGCAGCTGGG - Intergenic
985691326 5:1314343-1314365 CCACCATCACACTTGGATCTTGG + Intergenic
990845185 5:60129660-60129682 CATTCATCACACTTGAAACTTGG - Intronic
994112048 5:96017274-96017296 CTTTGATAACACTTTGATCTTGG - Intergenic
1002433729 5:179219075-179219097 CCTTGGGCACTCCTGGAGCTGGG - Intronic
1002910803 6:1489567-1489589 CCCTGCTCACACCTGGACCTTGG - Intergenic
1003523690 6:6881041-6881063 CCTCGGTCTCACTTGGATCTAGG - Intergenic
1012290027 6:97442861-97442883 TCATTATCACACTGGGAGCTGGG + Intergenic
1013313705 6:108921425-108921447 CCTTGATAACACTCGGTGCCTGG - Intronic
1015289398 6:131520886-131520908 CCTGGATCTCACTTGGAGAGAGG - Intergenic
1018473152 6:164114037-164114059 CCCTGCTGACACTTGGATCTTGG - Intergenic
1019363736 7:619698-619720 CCTTGATCATAAATGGAGCCAGG - Intronic
1024832272 7:53474631-53474653 CCTTGTTCTCATCTGGAGCTTGG - Intergenic
1026031737 7:66800298-66800320 CCTGGATGACCCTTGGGGCTAGG - Intronic
1026582421 7:71629528-71629550 CCATGATCACACTTGATTCTGGG - Intronic
1041551646 8:59109363-59109385 CCTTTATCACACAAGTAGCTTGG + Intronic
1042172654 8:66007635-66007657 ACTTGAAGACCCTTGGAGCTAGG - Intergenic
1042940290 8:74100456-74100478 CCTTGATGCCACTTTGATCTTGG + Intergenic
1045793932 8:106020598-106020620 CCCTGATTACACTTTGACCTTGG + Intergenic
1047958712 8:129995291-129995313 CTTTGTTCACACTTGGCTCTGGG - Intronic
1051877873 9:21810172-21810194 CCTTGATCTCACCTTGATCTTGG - Intronic
1055155735 9:73060877-73060899 CTTTGATGAGACTTGGACCTTGG - Intronic
1059805868 9:117799677-117799699 CCTTCACCAAACTTGAAGCTAGG - Intergenic
1060533306 9:124362328-124362350 CCTTGAAAACCCTTGGAGCTGGG - Intronic
1060973900 9:127754070-127754092 CCTTGATCTCACCTCGACCTGGG + Intronic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1187185572 X:16981638-16981660 GCTTGATCACACTTGGAAGAAGG - Intronic
1190477060 X:50839036-50839058 CCTTGGTCTCAGTAGGAGCTGGG + Intergenic
1190597064 X:52061143-52061165 CCTTGAACACACCAGGACCTAGG + Intergenic
1190611760 X:52192930-52192952 CCTTGAACACACCAGGACCTAGG - Intergenic
1192066427 X:67890031-67890053 CATTGCTCACACTGGGAGCTGGG + Intergenic
1199805356 X:151294395-151294417 CCATGATCACACTTGCAAATGGG - Intergenic