ID: 954396122

View in Genome Browser
Species Human (GRCh38)
Location 3:50294418-50294440
Sequence ACACTCACCCAGCCCAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954396115_954396122 17 Left 954396115 3:50294378-50294400 CCATCTCAGGCTCCCAAAGTACT 0: 3
1: 192
2: 7393
3: 82182
4: 166288
Right 954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 115
954396120_954396122 4 Left 954396120 3:50294391-50294413 CCAAAGTACTGGGATTATAGGTG 0: 235
1: 9433
2: 97825
3: 236022
4: 260013
Right 954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 115
954396119_954396122 5 Left 954396119 3:50294390-50294412 CCCAAAGTACTGGGATTATAGGT 0: 262
1: 10456
2: 116202
3: 336976
4: 228977
Right 954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 115
954396114_954396122 21 Left 954396114 3:50294374-50294396 CCTTCCATCTCAGGCTCCCAAAG 0: 2
1: 146
2: 3891
3: 35879
4: 98585
Right 954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954396122 Original CRISPR ACACTCACCCAGCCCAAGTA GGG Intronic
901184876 1:7366444-7366466 ACACTCACCCAGCATCAGCATGG - Intronic
902176947 1:14657536-14657558 CAACTCACACAGCCCAAGTGGGG - Intronic
905314605 1:37073993-37074015 TTACACACCCAGCCCAAGGAAGG + Intergenic
907569610 1:55470801-55470823 ACACTCAACCAGGCCAGGCACGG - Intergenic
908260653 1:62337406-62337428 ACACTCCCACAGCCTAAGGAAGG + Intergenic
915163059 1:153933127-153933149 ACACTCACCCTGTCCAAGGCAGG - Intronic
919928454 1:202205978-202206000 ACACACACACACCCCTAGTATGG + Intronic
921367312 1:214385594-214385616 ACACACACACACCCCAAGGAAGG + Intronic
922470819 1:225876160-225876182 ATACCCACCCAGCCCAGCTAGGG + Intronic
1067222575 10:44354597-44354619 ACACTCACACAGGCTAAGTCTGG + Intergenic
1067275806 10:44833140-44833162 ACACTCATGCAGCCCATGTAGGG + Intergenic
1069633765 10:69913263-69913285 CCACTTCCCCAGCCCAAGTAAGG + Intronic
1071894482 10:90050983-90051005 ACAATCACACACCCCAAGGAGGG - Intergenic
1075064627 10:119281200-119281222 AGAATGACCCAGCCCAAGCATGG - Intronic
1076371027 10:129953747-129953769 CCATCCACCCAGCCCAAGCAAGG + Intronic
1077150133 11:1069354-1069376 CGGCTCACCCAGCCCAAGAATGG - Intergenic
1077300923 11:1846574-1846596 ACTCTCCCCCAGCCCCAGCAAGG + Intergenic
1079296340 11:19237996-19238018 ACACCTACCAAGCCCAAGGAAGG - Exonic
1079304680 11:19311785-19311807 ACAATTACCCAGCCCCTGTAGGG + Intergenic
1081047902 11:38298343-38298365 ACACTCACCTAGCACCAATAAGG + Intergenic
1081609973 11:44556005-44556027 ACACCCACCCAGCTCAGATAAGG - Intergenic
1089334354 11:117712880-117712902 ACACTCACTCAGCCCCAGAAAGG - Intronic
1089702754 11:120255284-120255306 ACACTCCACCTGCCCCAGTAGGG + Intronic
1091728044 12:2859031-2859053 TCACGCCCCCAGCCAAAGTAGGG - Exonic
1092896954 12:13021258-13021280 ACCCCCACCAAGCCCATGTAAGG - Intergenic
1096482926 12:51954132-51954154 TCACTCCTCCAGCCCACGTAGGG - Intronic
1097225828 12:57476356-57476378 ACACTCACCCAGCCTGAGGAGGG + Exonic
1097964211 12:65561856-65561878 ACACTTACACAGCACATGTAGGG + Intergenic
1105260045 13:18772439-18772461 ACACCAACCCAGCCCATGAAAGG + Intergenic
1106558861 13:30832224-30832246 ACCCTCAGGGAGCCCAAGTATGG + Intergenic
1107469528 13:40679253-40679275 ACTCTGATCCAGCCCAAGAAAGG - Intergenic
1112805623 13:103161490-103161512 GGACTCACCCTGCCCCAGTATGG - Intergenic
1118395986 14:65337088-65337110 GGACTCAGCCAGCCCAAGGAAGG + Intergenic
1119429927 14:74559978-74560000 AAACTCACCCAGCACAAGAATGG + Intronic
1120226840 14:81800264-81800286 ACACTCACCTCTCCAAAGTAAGG - Intergenic
1124913301 15:33944520-33944542 ACACTCAACCAGGCCAGGCACGG + Intronic
1127470236 15:59283405-59283427 ACTCTCACCCAGCACAGGTCAGG + Intronic
1128259634 15:66223907-66223929 ACACTCAGCCACCCCAAGGAGGG - Intronic
1129664745 15:77573293-77573315 ACCCTCTCCCAGCACAAGGAGGG + Intergenic
1131151513 15:90050183-90050205 CCACACACCCAGCTCGAGTACGG - Intronic
1131259217 15:90879968-90879990 ATCCTCACCGAGCCCAAGTGAGG + Exonic
1134698571 16:16244808-16244830 ACACCCACCCAGACCAATAATGG + Intronic
1134973264 16:18549865-18549887 ACACCCACCCAGACCAATAATGG - Intronic
1135454209 16:22583571-22583593 ACACTCACTCAGGCAAAGTTTGG + Intergenic
1137481942 16:48859141-48859163 CTCCTCACTCAGCCCAAGTAAGG - Intergenic
1138061477 16:53895683-53895705 ACTCTCACACAGCTCATGTAAGG - Intronic
1139559873 16:67735127-67735149 CAACTCTCCCAGCCCAAGCATGG - Intronic
1139659191 16:68409375-68409397 ACACAGACCCAGCCCGAGTCAGG - Intronic
1141091075 16:81130686-81130708 ACTCCCACCCAGTCCAAGTCAGG + Intergenic
1142920722 17:3182936-3182958 AACCTCACCCACCTCAAGTATGG + Intergenic
1142977472 17:3654381-3654403 AGTCTCACCCAGGCCAGGTATGG + Intronic
1144141197 17:12350150-12350172 GGCCTCACCCAACCCAAGTAAGG + Intergenic
1144636232 17:16910998-16911020 TCTCTGACCCAGCCCAAGTCAGG - Intergenic
1145062847 17:19743562-19743584 TCACTCACCCAGCCCAGGGTGGG + Intronic
1145347360 17:22049439-22049461 ACTCTGAGACAGCCCAAGTATGG + Intergenic
1146497155 17:33333103-33333125 CCAATCACCCTGCCAAAGTAAGG - Intronic
1148207447 17:45788006-45788028 ACACTCACCCAGAGCCAGTGAGG + Intronic
1148597890 17:48871549-48871571 ACACTCACCTAGGCCAGGCATGG - Intergenic
1148848046 17:50540707-50540729 CCAGTTACCCAGCCCAAGTTGGG - Intronic
1150067873 17:62126483-62126505 AGGCTCACCCAGCCCTAGGAAGG + Intergenic
1152482136 17:80561394-80561416 CCACGCACCCAGCCCTAGAATGG + Intronic
1152945164 17:83194108-83194130 ACACCCACACAGCCCCAGGAGGG - Intergenic
1154330780 18:13427410-13427432 AGACTCCACCAGCCCATGTATGG - Intronic
1161394367 19:4037490-4037512 GCACTCACCCAGCACGAGGATGG - Exonic
1163225456 19:15957580-15957602 ACACACACACAGCCCACGCATGG + Intergenic
1164963003 19:32452399-32452421 ACACTCACACAGACAAAGCAAGG + Intronic
1165468590 19:35989881-35989903 CCACTGACCCAGCCCAACCATGG + Intergenic
928655439 2:33446444-33446466 ACCCACACCCGGCCCAAGTAGGG + Intronic
929764909 2:44836406-44836428 TGACTCACCCAGCCCCGGTAAGG + Intergenic
932577184 2:72969174-72969196 ACACTCAGGCAGCCCCAGGAAGG + Intronic
936270600 2:111045852-111045874 AAACTCAGCCAGCCCACGAAGGG + Intronic
937354849 2:121191878-121191900 ACGCTCTCCCAGACCAAGCAGGG - Intergenic
938083115 2:128380742-128380764 ACATTCACACACCCCAAGGAGGG - Intergenic
938936451 2:136131803-136131825 ACTCTCTGGCAGCCCAAGTAGGG - Intergenic
943416732 2:187616265-187616287 ACATTCACCTAGCCAAAGGATGG + Intergenic
949078923 2:242080806-242080828 AGACACACACAGCCCAAGCAGGG - Intergenic
1169212994 20:3778051-3778073 ACGCTCACCCATCCCAAGGAAGG + Exonic
1170267131 20:14479174-14479196 ACAAGCACCCAGCCCAGGAAGGG - Intronic
1173522695 20:43711431-43711453 ACACACACACAGCCCGAGTGTGG + Intronic
1175199545 20:57267843-57267865 TCTCTCACCCAGCCCCAGGAGGG - Intergenic
1175861455 20:62152281-62152303 CCACTCACCCAGGCCTAGGATGG + Intronic
1175931955 20:62497655-62497677 ACACCCACCCATCCCCAATACGG - Intergenic
1176058518 20:63161460-63161482 ACACACATCCAGCCCCAGGAGGG + Intergenic
1179002517 21:37476493-37476515 GCACTCCACCAGCCCAAGAAAGG + Intronic
1182500552 22:30743611-30743633 GCACTCACACTGGCCAAGTAAGG + Intronic
1182600357 22:31458467-31458489 ACACTCACCGAAGCCAAGCATGG + Exonic
1184964972 22:47965062-47965084 ACAATCACCCAGCTCAAGGTAGG + Intergenic
949930414 3:9074074-9074096 AAAGTCATCCAGCTCAAGTATGG + Intronic
952763395 3:36934971-36934993 ACCCTCACCCAGCTCCAGCATGG + Intronic
952999716 3:38921303-38921325 ACACTCACAAAGGCCAAGTAAGG + Intronic
954396122 3:50294418-50294440 ACACTCACCCAGCCCAAGTAGGG + Intronic
955032830 3:55237496-55237518 ACGCCCACCCAGCCCATGGAAGG - Intergenic
957758907 3:84530099-84530121 ACACTCACCCACCACAAGAAGGG + Intergenic
958809474 3:98844052-98844074 ACACACACACACCCCAATTATGG + Intronic
958810405 3:98854350-98854372 ACACTCAACCACTCCAAGCAGGG - Intronic
961336697 3:126184609-126184631 GCACTTACACAGCCCAAGTCTGG + Intronic
961452074 3:127006739-127006761 ACACACTCCCTGCCCAAGCAGGG - Intronic
965534168 3:169808015-169808037 AGACTCACCCAGCTCAGGTTAGG + Intronic
978489838 4:109301612-109301634 ACACACAGCCACACCAAGTATGG + Intronic
981627857 4:146780292-146780314 ACACACACACACCCCAAGTTAGG - Intronic
988787882 5:34580876-34580898 CCACCCACCCAGCCCCAGTGTGG + Intergenic
989185624 5:38622655-38622677 ACACTAAGTCAGCCCAAGAATGG - Intergenic
992772440 5:80060863-80060885 CCTCCCACCCAGCCCAAGGAAGG + Intronic
997744208 5:136284696-136284718 AGAGGCACCCAGCCCAAGAAGGG + Intronic
1003552170 6:7108959-7108981 ACACTCACCCCGCCAACGGAAGG - Intronic
1004511065 6:16285176-16285198 ACATTAAACCAGCCCAAGTGTGG + Intronic
1007479200 6:42138891-42138913 GCCCTCTCCCAGCCCAAGCAAGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019831719 7:3336774-3336796 ACACTTTCCCAGCCAAAGTGTGG - Intronic
1020050831 7:5080516-5080538 ACATTCACCCAGGCCCAGTGCGG - Intergenic
1022446133 7:30472215-30472237 AGACACACTCAGGCCAAGTAGGG - Intronic
1023584284 7:41712925-41712947 TCTCCCACCCAGGCCAAGTATGG + Intergenic
1023648581 7:42344751-42344773 GCACTGACCCAGGCCAGGTATGG - Intergenic
1030173475 7:106627881-106627903 ACAGCCATCCTGCCCAAGTAGGG - Intergenic
1032689105 7:134265040-134265062 ACCCTCACCAACCCCAAGAAAGG - Intergenic
1035537186 8:400825-400847 AGACACACACAGCCCAAGCAGGG - Intergenic
1036753142 8:11455782-11455804 ACACTCACACAACCCCAGCAGGG - Intronic
1042236711 8:66620451-66620473 ACACTAATACAGCCCATGTATGG - Intergenic
1045145754 8:99341922-99341944 AAACTCTCCCAGCCCCAGTCGGG - Intronic
1045752560 8:105502807-105502829 GCACTCACCTAACCCAAGTATGG - Intronic
1049734988 8:144200027-144200049 ACAGACCCCCAGCCCAAGCAGGG - Intronic
1058566637 9:106292526-106292548 ACACCCACCCACCCCAACTTAGG - Intergenic
1061424408 9:130490065-130490087 TCACACACCCAGCCCATGTGTGG + Intronic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1190298280 X:49041289-49041311 ACACACACACAGAGCAAGTAGGG + Intronic
1192246006 X:69372116-69372138 ACACTGAACCAGACCAAGTAAGG - Intergenic
1196776474 X:119342798-119342820 TCACTCACCCACCCCAGGGAAGG + Intergenic
1199963494 X:152798990-152799012 ACACTCACCCCTCCCAAACAAGG - Intergenic