ID: 954396209

View in Genome Browser
Species Human (GRCh38)
Location 3:50294782-50294804
Sequence GCCTTCCGTGTGGCCCTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954396209_954396222 22 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396222 3:50294827-50294849 AAGGCCTGGTGGTGGGCAGGTGG 0: 1
1: 0
2: 8
3: 79
4: 756
954396209_954396215 3 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396215 3:50294808-50294830 CTCCAGGCGATGTCGGACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 34
954396209_954396224 30 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396224 3:50294835-50294857 GTGGTGGGCAGGTGGCAGCCTGG 0: 1
1: 0
2: 4
3: 70
4: 578
954396209_954396219 14 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396219 3:50294819-50294841 GTCGGACAAAGGCCTGGTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 122
954396209_954396217 8 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396217 3:50294813-50294835 GGCGATGTCGGACAAAGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 57
954396209_954396221 19 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396221 3:50294824-50294846 ACAAAGGCCTGGTGGTGGGCAGG 0: 1
1: 1
2: 3
3: 32
4: 450
954396209_954396220 15 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396220 3:50294820-50294842 TCGGACAAAGGCCTGGTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 159
954396209_954396212 -4 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396212 3:50294801-50294823 AGGCCTCCTCCAGGCGATGTCGG 0: 1
1: 0
2: 1
3: 9
4: 105
954396209_954396218 11 Left 954396209 3:50294782-50294804 CCAACAAGGGCCACACGGAAGGC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 954396218 3:50294816-50294838 GATGTCGGACAAAGGCCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954396209 Original CRISPR GCCTTCCGTGTGGCCCTTGT TGG (reversed) Exonic
900295514 1:1947183-1947205 GCCATCCGTGTGGCCCCTTGGGG + Intronic
900741742 1:4334324-4334346 CTCTTCCTTGTGGCCCTTGTAGG + Intergenic
901403888 1:9033165-9033187 GGCTTTCCTGTGCCCCTTGTTGG + Intergenic
902303919 1:15522901-15522923 GCCTTCTGTGTGGCCCCTACTGG - Intronic
913830187 1:123229654-123229676 GACATCCTTGTGGCCCTCGTTGG + Intergenic
916044685 1:160990608-160990630 GGCTTCCATGTGGTCCTTATTGG + Intergenic
919472937 1:198001196-198001218 TCCTTCCTTGTAGCCCCTGTGGG + Intergenic
921740390 1:218678070-218678092 GCCTTCCCTGTGCACATTGTGGG - Intergenic
924356587 1:243183465-243183487 GCCTTCCTTCTGGCTGTTGTTGG + Intronic
924738251 1:246778753-246778775 ACCTGCCGTGTGGACCCTGTGGG - Intergenic
1073484129 10:103805977-103805999 GCTGTCCTTGTGGCCCTTGCCGG + Intronic
1075101020 10:119506328-119506350 GCCTTCTGTGTGGCCCGTCCTGG - Intronic
1076865503 10:133164437-133164459 GCCTGCCGTGGGGCCCTCGTGGG + Intronic
1076888318 10:133272548-133272570 AACTTCCGTGTGGTCCTGGTGGG - Exonic
1078275344 11:9839654-9839676 GCCTTCAGGGTGGTACTTGTGGG + Exonic
1078369868 11:10735731-10735753 TCTTACCGTGGGGCCCTTGTTGG - Intergenic
1078621072 11:12908439-12908461 TCTTTCCATGTGGCCCTTGATGG + Intronic
1079083333 11:17428781-17428803 CCCTTCAGTGTGGGCTTTGTGGG - Intronic
1080297828 11:30750786-30750808 ACCTTCCTTGTGGCCCCAGTGGG - Intergenic
1082005911 11:47418886-47418908 GCCTTCCATGTAGTCCTCGTGGG + Exonic
1085232151 11:74981532-74981554 GCCTACCCTGTGGCACTTGGGGG + Intergenic
1089947037 11:122486842-122486864 TCCTTCCGAGTGGTCCCTGTTGG + Intergenic
1090069456 11:123530878-123530900 GCCTGCTGTGTGGCCCTGGTAGG + Intronic
1091767102 12:3128568-3128590 GCCTTTCGTGGGGCTTTTGTTGG - Intronic
1096584638 12:52611882-52611904 GCCTTCCGTGATGCCCTGGTTGG + Intronic
1104940041 12:132390739-132390761 GGCTGCAGGGTGGCCCTTGTTGG - Intergenic
1108825343 13:54406878-54406900 GCCTTCCTGGTATCCCTTGTGGG - Intergenic
1111500308 13:89110441-89110463 GCATTAAGTGTGGCCCTGGTTGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1118661194 14:68014932-68014954 GCATCCCGGGTGGCCCTAGTGGG - Intronic
1127653252 15:61029836-61029858 GTCTTCCTCGTGGCCCTTTTTGG - Intronic
1129152386 15:73697121-73697143 GGCCTCAGGGTGGCCCTTGTGGG + Intronic
1132578532 16:674872-674894 GCCCTCTGAGTGGCCCTTGCAGG + Intronic
1132959249 16:2612951-2612973 ACCTTCCGTGTGGCTCTGCTGGG - Intergenic
1132972309 16:2694926-2694948 ACCTTCCGTGTGGCTCTGCTGGG - Intronic
1133032049 16:3015741-3015763 GCCCTCCTTGTGGCCCTGTTCGG - Exonic
1133712078 16:8411204-8411226 GCATTCCATGGGTCCCTTGTGGG + Intergenic
1136174300 16:28506794-28506816 GCCTGCCGTCTGGCCCATGGCGG + Exonic
1138347826 16:56330912-56330934 GCCTTCCGTGTCTCCCCTCTGGG + Intronic
1138605534 16:58086057-58086079 ACCTTCCGTGTGGCGCTGGTTGG + Intergenic
1140161633 16:72501736-72501758 GTCTTCTATGTGGCCTTTGTTGG - Intergenic
1144947490 17:18977402-18977424 GCCTTCCATATGGCCCTGGCCGG + Intronic
1147686082 17:42287721-42287743 GCCTACTGTGTGGCCCTGGGTGG + Intronic
1147863073 17:43535057-43535079 GCCTTTCCTGTGGCCCCTGCGGG + Intronic
1151497111 17:74464784-74464806 TCCTTCCCTCTGGCCCTTTTTGG - Intergenic
1151569773 17:74920497-74920519 GCATTCCATGTGGCCCTTCATGG + Exonic
1158107020 18:53897423-53897445 GCTTTCAGTGTGCCCCTTATAGG + Intergenic
1158527011 18:58224001-58224023 GTCCTCCCTGTGGCCCCTGTGGG - Intronic
1160018819 18:75164814-75164836 CCATTCTGGGTGGCCCTTGTGGG + Intergenic
1164946740 19:32301192-32301214 ACTTTCCGTGTGTCTCTTGTAGG + Intergenic
927247156 2:20966508-20966530 CCCTTCAGTGTTGGCCTTGTGGG - Intergenic
928573142 2:32628238-32628260 GACTCCCGTGTGGCCCTCGTGGG + Exonic
931133273 2:59364169-59364191 CCCTTCCTTGTGGCCCATTTTGG + Intergenic
933700838 2:85254401-85254423 GTCCTCTGTGTGTCCCTTGTAGG + Intronic
936415464 2:112305377-112305399 GCCTTCTATGTGGCCACTGTGGG + Intronic
937465122 2:122125541-122125563 GCCTTCTGTGTTGGTCTTGTTGG + Intergenic
938526519 2:132139251-132139273 TCCTTCCATGTGGTCTTTGTAGG + Intergenic
944488451 2:200232341-200232363 GCCATCTGTGTGGCCCTCCTGGG + Intergenic
945517480 2:210780220-210780242 TCCTTCCCTGTTGCCTTTGTTGG - Intergenic
945915614 2:215701202-215701224 GCTTTCCATGTGGCCTTTCTGGG + Intergenic
1173851716 20:46222736-46222758 GCCATCCCTGTCGCCCCTGTGGG + Intronic
1175517597 20:59578813-59578835 GCCTTCTGTGGTGCCCTTGGAGG + Intronic
1176156753 20:63626262-63626284 GCCTGCCGGGTGGCCCCTGCGGG + Intronic
1176156831 20:63626467-63626489 GCCTGCGGGGTGGTCCTTGTGGG + Intronic
1179722229 21:43322347-43322369 GGCCTCCGTGTGGCGCCTGTCGG - Intergenic
1179910229 21:44443590-44443612 GCCTTCCCTGTGGCACCTGGAGG - Intergenic
1179987542 21:44930022-44930044 GCCTTCCATGGGGGCCTTGTGGG - Intronic
1180198900 21:46213253-46213275 GCCTTGGGTGTGGCCCTTCTGGG - Intronic
1181993581 22:26857254-26857276 GCCTTTCGGGGGGCCCTTGATGG + Intergenic
1183187990 22:36303382-36303404 CCTTACCGTGTGACCCTTGTGGG - Intronic
1184171375 22:42761688-42761710 GGCACCCGTGTGGCCCTTGCAGG + Intergenic
952189266 3:31005285-31005307 GAATTCAGTGTGGCCCTTGTTGG - Intergenic
954396209 3:50294782-50294804 GCCTTCCGTGTGGCCCTTGTTGG - Exonic
964292093 3:155192881-155192903 GACTTACGTGTGGGCCATGTAGG - Intergenic
964309906 3:155381420-155381442 GGGTTCCGTGTGGCCCTGGAAGG - Intronic
969621276 4:8280154-8280176 TCCTACCGTGTGGCCTTTGTCGG - Intronic
979245233 4:118496140-118496162 GCCTTCCTTCTGGCTGTTGTTGG - Intergenic
986965767 5:13268568-13268590 TCCCTCCGTGTGTCCGTTGTGGG - Intergenic
991140366 5:63233665-63233687 ACTTTCATTGTGGCCCTTGTTGG + Intergenic
995254667 5:110032724-110032746 GCCTTCCATGTAAACCTTGTTGG + Intergenic
996103487 5:119470285-119470307 GCCTTCTGTGTGGGCATGGTGGG + Intronic
1007815909 6:44525470-44525492 TCCTTGCGTGTGGCCCTAGATGG + Intergenic
1017955533 6:159174490-159174512 CCCTTCCGTGCAGCCCTAGTTGG + Intronic
1021071589 7:16248635-16248657 GCCTTCCGCGTGGATCTTGCTGG - Intronic
1023824165 7:43997640-43997662 GCCATCCCTGTGGCCCCTCTGGG - Intergenic
1026740503 7:72975863-72975885 GCCTTCCTCGCGGCCCCTGTTGG - Intergenic
1027103229 7:75389208-75389230 GCCTTCCTCGCGGCCCCTGTTGG + Intergenic
1029752430 7:102550969-102550991 GCCATCCCTGTGGCCCCTCTGGG - Intronic
1029770382 7:102650062-102650084 GCCATCCCTGTGGCCCCTCTGGG - Intronic
1030088889 7:105840127-105840149 CCCCTCACTGTGGCCCTTGTGGG - Intronic
1035057208 7:156043608-156043630 GCCTTCCGAGTGCCCCTCGTGGG - Intergenic
1036215771 8:6878510-6878532 GCCCCCAGTGTGGCCCTTGGAGG + Intergenic
1036837629 8:12088783-12088805 GGGCTGCGTGTGGCCCTTGTGGG + Intergenic
1036859422 8:12335031-12335053 GGGCTGCGTGTGGCCCTTGTGGG + Intergenic
1038542550 8:28402025-28402047 GCCATCCGTCTGGCCCTTCCTGG + Intronic
1042768722 8:72355527-72355549 CCCTTCCATGTGGCCAGTGTGGG - Intergenic
1042877196 8:73449946-73449968 GCCCTCCCTGTAGCCCTGGTGGG - Intronic
1044365484 8:91340459-91340481 GCTTTCGGAGTGGCACTTGTAGG + Exonic
1044813048 8:96083365-96083387 GCCTACCATATGGCCCTAGTAGG + Intergenic
1049787919 8:144459986-144460008 GCCTTCTGCGTGTCCCTGGTTGG - Intronic
1051618377 9:19028061-19028083 GCCTTCCATGTAGTCCTCGTGGG - Intronic
1053061548 9:35036058-35036080 CCCTTCCGTGAGGGGCTTGTGGG - Intergenic
1054735345 9:68744915-68744937 GCTGTCCAGGTGGCCCTTGTTGG + Intronic
1059734834 9:117090734-117090756 CCCTTCCATGTGGCCCTGGGTGG - Intronic
1061823927 9:133246230-133246252 GCCTTCCCTGTGGCCCGAGAAGG - Intergenic
1061846235 9:133389896-133389918 GCCTGCCGTGGGGCCAGTGTGGG + Intronic
1203403489 Un_KI270522v1:261-283 GCCTGCTTTGTGGCCTTTGTTGG - Intergenic
1191689009 X:63920961-63920983 TCCATGTGTGTGGCCCTTGTGGG - Intergenic
1192233740 X:69283438-69283460 GCCATCCGCGTGGCCCTACTTGG - Intergenic
1199978973 X:152910801-152910823 GGCTTCCTGGTGGCTCTTGTGGG - Intergenic
1200420307 Y:2958020-2958042 GCTTTCCATGTGGCCACTGTAGG + Intronic