ID: 954401352

View in Genome Browser
Species Human (GRCh38)
Location 3:50321360-50321382
Sequence GTGGCGCCCCGCGCGAGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954401352_954401362 9 Left 954401352 3:50321360-50321382 CCTCACCTCGCGCGGGGCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 954401362 3:50321392-50321414 CGCCAGGGCCACCGCCATCCCGG 0: 1
1: 0
2: 1
3: 11
4: 191
954401352_954401370 30 Left 954401352 3:50321360-50321382 CCTCACCTCGCGCGGGGCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 954401370 3:50321413-50321435 GGGCCCAGCCCAGCCCGCTCCGG 0: 1
1: 0
2: 10
3: 54
4: 435
954401352_954401357 -7 Left 954401352 3:50321360-50321382 CCTCACCTCGCGCGGGGCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 954401357 3:50321376-50321398 GCGCCACCGGGACCGGCGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 253
954401352_954401358 -6 Left 954401352 3:50321360-50321382 CCTCACCTCGCGCGGGGCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 954401358 3:50321377-50321399 CGCCACCGGGACCGGCGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 102
954401352_954401363 10 Left 954401352 3:50321360-50321382 CCTCACCTCGCGCGGGGCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 954401363 3:50321393-50321415 GCCAGGGCCACCGCCATCCCGGG 0: 1
1: 0
2: 6
3: 59
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954401352 Original CRISPR GTGGCGCCCCGCGCGAGGTG AGG (reversed) Exonic
900162857 1:1232529-1232551 GCGGGGCCCCGGGCGACGTGTGG + Exonic
903318522 1:22527375-22527397 GTGGCGGCCTGCGGGAGGTGAGG - Exonic
906168924 1:43707644-43707666 GTGGCGCCCGGCCCGACGCGGGG - Exonic
906678333 1:47708974-47708996 GTGGCGCCCCCCGCCTGCTGCGG + Intergenic
914490908 1:148149613-148149635 GTGGGGGCCGGCGCGGGGTGAGG - Intronic
922513303 1:226187014-226187036 GTGGAGCCCCGCGCGGGGGTCGG + Intergenic
923506430 1:234609698-234609720 GGGGCGGCGGGCGCGAGGTGAGG + Intergenic
1064397861 10:14995959-14995981 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1069438556 10:68407346-68407368 GCGGCGCCCCGGGCGGGGCGGGG + Intergenic
1069583024 10:69577957-69577979 CAGGCGCCGCGCGCGAGCTGCGG - Intergenic
1076355322 10:129848353-129848375 GTGGCACCCCGCTCATGGTGGGG - Intronic
1077328129 11:1972415-1972437 GCGGTGCCCGGCACGAGGTGGGG - Intronic
1082076947 11:47981495-47981517 GTGGGGCCCTGGGCGAGGCGCGG + Intronic
1083940010 11:65890711-65890733 GTGGCGCCGGGCCCGACGTGGGG + Exonic
1084228384 11:67732032-67732054 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1084228407 11:67732110-67732132 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1084285573 11:68128526-68128548 GCGGGGCCTCGCGCGAGGGGCGG + Intergenic
1084806776 11:71584619-71584641 GAGGCGCCCCCCGCGATGCGGGG + Intronic
1084846805 11:71907347-71907369 GAGGCGCCCCCCGCGATGCGGGG + Intronic
1089845151 11:121452486-121452508 AGGGCGACCCGCGCGAGCTGCGG + Exonic
1090293990 11:125569931-125569953 GTGGAGCCCCGTGGGAAGTGAGG + Intronic
1202811108 11_KI270721v1_random:27595-27617 GCGGTGCCCGGCACGAGGTGGGG - Intergenic
1092433031 12:8424178-8424200 GAGGCGCCCCACGCGATGCGGGG - Intergenic
1092436276 12:8449213-8449235 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1092537586 12:9403513-9403535 GAGGCACCCCCCGCGAGGTGGGG + Intergenic
1092538066 12:9404940-9404962 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092538441 12:9405894-9405916 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092539098 12:9408626-9408648 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092556580 12:9567705-9567727 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1092557196 12:9570211-9570233 ATGGCACCCCCCGCGAGGTGGGG - Intergenic
1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG + Intronic
1094514072 12:31117851-31117873 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514258 12:31118403-31118425 GTGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514601 12:31119565-31119587 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514891 12:31120448-31120470 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515066 12:31121045-31121067 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515328 12:31122458-31122480 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515359 12:31122538-31122560 GAGGCACCCCCCGCGAGGGGGGG + Intergenic
1094515477 12:31122854-31122876 GAGGCACCCCCCGTGAGGTGGGG + Intergenic
1094515507 12:31122933-31122955 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1107545162 13:41428013-41428035 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1107545191 13:41428095-41428117 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1107545213 13:41428176-41428198 GGGGCGCCCCCCGCGACGCGGGG - Intergenic
1107631266 13:42344815-42344837 GTGGCACCCGTGGCGAGGTGTGG + Intergenic
1107940490 13:45377606-45377628 GAGGCACCCCCCACGAGGTGGGG - Intergenic
1107941691 13:45382166-45382188 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1108053190 13:46464580-46464602 GAGGCACCCCCAGCGAGGTGGGG + Intergenic
1108053371 13:46465425-46465447 GTGGCACCCCCTGCGAGGCGGGG + Intergenic
1108053804 13:46467260-46467282 GTGGCACCCCCTGCGAGGCGGGG + Intergenic
1109538151 13:63741694-63741716 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1109546515 13:63841428-63841450 GAGGCACCACCCGCGAGGTGGGG + Intergenic
1109546712 13:63842329-63842351 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1110891890 13:80705756-80705778 GAGGCACCCCTCGCGAGGCGGGG + Intergenic
1110891976 13:80705993-80706015 GAGGCACCCCCAGCGAGGTGGGG + Intergenic
1110892303 13:80707253-80707275 GAGGCACCCCCCGTGAGGTGTGG + Intergenic
1117037496 14:51743756-51743778 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1117037734 14:51744795-51744817 GAGGCGCCCCCCGCGATGCGGGG + Intergenic
1117041732 14:51774527-51774549 GAGTCGCCCCTCGCGATGTGGGG - Intergenic
1119325662 14:73758603-73758625 GTGGAGCCTCGCGCGGGGGGCGG - Intronic
1122231049 14:100306467-100306489 GGGGCGCGCGGCCCGAGGTGAGG - Exonic
1122418230 14:101560524-101560546 GTGGCGCCCCGCGCCCGGGTCGG + Intergenic
1122456692 14:101859043-101859065 CTGGAGCCCAGCGCGAGGTTTGG - Intronic
1125535977 15:40441378-40441400 GTGGCGCGGCGCGCTCGGTGGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133269558 16:4604017-4604039 GTGGAGCCACGAGCAAGGTGAGG - Intergenic
1136470138 16:30474244-30474266 GTGCCTCCCGGCGCGCGGTGGGG - Exonic
1139908236 16:70381060-70381082 GTGGCGCCCTCTGCGGGGTGGGG - Exonic
1142350362 16:89576713-89576735 CTGGCGCCCCGCGCGGACTGGGG - Intronic
1147319534 17:39637388-39637410 GCGCCGCCCCGCGCGGGTTGGGG + Intronic
1152092409 17:78254355-78254377 GGGGCGCTCCGGGCGGGGTGTGG - Intergenic
1152197210 17:78924920-78924942 GTGGGGCCCCGCGCGGGGGCTGG + Intronic
1153263639 18:3247341-3247363 TTGACGCCCCGCGCGGGGTCTGG - Intergenic
1160780723 19:876881-876903 GTGGGGCCCCGTGGCAGGTGGGG - Intronic
1160780748 19:876934-876956 GTGGGGCCCCGTGGCAGGTGGGG - Intronic
1160994677 19:1877131-1877153 GTGGGGGCCGGCGCGGGGTGAGG + Exonic
1161304122 19:3557497-3557519 GGGGTGCCCGGCGCGTGGTGGGG - Exonic
1164624053 19:29715063-29715085 GCCGCGCCCCGCGAGAGGAGGGG - Intronic
1165050000 19:33135025-33135047 GTGTCGCCATGCGCGAGCTGGGG + Intronic
928091390 2:28377173-28377195 CTGGCCCCACGTGCGAGGTGAGG + Intergenic
928511967 2:32010679-32010701 GGGGAGCCCCGCGGGGGGTGGGG - Intronic
942928087 2:181457344-181457366 GTGGGGTCCCGGGCGTGGTGCGG - Exonic
946328646 2:218997679-218997701 GAGGCGACCCGCTCGAGGAGGGG - Intergenic
1174053895 20:47785364-47785386 GCGGCGCCCCGCTCCGGGTGAGG - Intronic
1176061330 20:63174183-63174205 GTGGGGCCCCGTGCCTGGTGGGG - Intergenic
1176088801 20:63309899-63309921 GTGGCACCCCCAGGGAGGTGAGG + Exonic
1176547582 21:8208378-8208400 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176566533 21:8391425-8391447 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176574409 21:8435612-8435634 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176611021 21:8986904-8986926 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1183149935 22:36029020-36029042 GTGGCGGCCCGCGGGGGGGGCGG + Intergenic
1203252455 22_KI270733v1_random:124663-124685 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1203260512 22_KI270733v1_random:169749-169771 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
949883466 3:8678495-8678517 GAGGCACCCCCCGCGAGGCGGGG + Intronic
949883522 3:8678653-8678675 GAGGCACCCCCCGCGAGGCGGGG + Intronic
949883625 3:8678977-8678999 GAGTCACCCCCCGCGAGGTGGGG + Intronic
954378029 3:50205176-50205198 CTGGCGGCCCGCGGGAGGAGGGG - Intergenic
954382508 3:50227234-50227256 GTGGGGCCCCGCGCGGGGCAAGG + Intronic
954401352 3:50321360-50321382 GTGGCGCCCCGCGCGAGGTGAGG - Exonic
954900484 3:54014964-54014986 GGGGCGCCCAGGGCCAGGTGAGG - Intergenic
957079537 3:75624073-75624095 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
961274432 3:125715908-125715930 GAGGCGCCCCCCGCGATGTGGGG + Intergenic
961277349 3:125738460-125738482 GAGGCGCCCCCCGCGATGCGGGG + Intergenic
961277398 3:125738621-125738643 GAGGCGCCCCCCGCGATGCGGGG + Intergenic
961877028 3:130031047-130031069 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
961877074 3:130031205-130031227 GAGGCGCCCCTCGCGATGCGGGG - Intergenic
962432163 3:135329622-135329644 GTTGGGCCCCGAGCCAGGTGAGG - Intergenic
966868530 3:184275963-184275985 GCGGAGCCCCGCCCGGGGTGGGG - Intronic
968509592 4:989565-989587 GGGGGGCCCTGCGCAAGGTGTGG - Exonic
968989306 4:3898237-3898259 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
969022559 4:4147857-4147879 GAGGCACCCCCCGCGATGTGGGG - Intergenic
969788242 4:9474632-9474654 GGGGCGCCCCGTGCGATGCGAGG + Intergenic
989178726 5:38556243-38556265 GGGGCGGCCCGGGCGGGGTGGGG - Intronic
990955436 5:61333847-61333869 GTGGTGCCCCGGGCGAGCCGCGG + Intronic
999768480 5:154757179-154757201 GTGCCTCCCCGCGCGGGGAGCGG + Intronic
1005826053 6:29632533-29632555 GCGGAGCCCCGCGCGGGGTGGGG + Intronic
1006337520 6:33428173-33428195 GGGGCGCCGCGCGCGTGGGGCGG + Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1019534943 7:1523929-1523951 GGGGCGCCCCGGGAGGGGTGGGG - Intergenic
1019562213 7:1664750-1664772 GTCGCGCCCAGCGCGCGCTGGGG + Intergenic
1020106152 7:5423256-5423278 GGGGCGCCCCGGGAGGGGTGGGG - Intronic
1020312146 7:6876345-6876367 GAGGCGCCCCCCGCGATGCGGGG - Intergenic
1024312251 7:47979737-47979759 GTCACGCCCCGGGGGAGGTGGGG + Intergenic
1025829580 7:65038077-65038099 GAGGCGACGCGCGCGAGGGGTGG - Intergenic
1027001642 7:74658189-74658211 GCGGCCCGCCGCGCGCGGTGTGG + Intronic
1029079217 7:97959177-97959199 GAGGCGCCCCCCGCGATGTGGGG - Intergenic
1034303314 7:150034060-150034082 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034303490 7:150034883-150034905 GAGGCACCCCCCGCGAGGTAGGG - Intergenic
1034304172 7:150037360-150037382 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304398 7:150038066-150038088 GAGGCACCCCCCGCGAGGTGGGG - Intergenic
1034304544 7:150038788-150038810 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304658 7:150039178-150039200 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304940 7:150040042-150040064 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305234 7:150041535-150041557 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305573 7:150042566-150042588 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034801629 7:154059196-154059218 GAGGCACCCCCCGCGAGGTAGGG + Intronic
1034801806 7:154060018-154060040 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034801944 7:154060415-154060437 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034802623 7:154062816-154062838 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1035199178 7:157249243-157249265 GTGGCTGCCTGCGGGAGGTGGGG - Intronic
1037789001 8:21919999-21920021 GCAGCCCCGCGCGCGAGGTGTGG - Intronic
1047262433 8:123274580-123274602 TTGGCGCACCGCGGGAGGTAGGG + Intronic
1048001876 8:130385494-130385516 GTGGCTCAGCGCCCGAGGTGGGG + Intronic
1049752365 8:144291372-144291394 GTGGCGGCCGGCGCGCGGTGGGG - Intergenic
1053736142 9:41104214-41104236 GAGGCACCCCCCGCGAGGAGGGG + Intergenic
1053736227 9:41104675-41104697 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736253 9:41104755-41104777 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736619 9:41106845-41106867 GAGGCACCCCTCGCGAGGCGGGG + Intergenic
1053736688 9:41107081-41107103 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736727 9:41107186-41107208 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736756 9:41107262-41107284 GTGGCACCCCCCGCGTGGCGGGG + Intergenic
1053737030 9:41108408-41108430 GAGGCACCCCTCGCGAGGTGGGG + Intergenic
1053737228 9:41108968-41108990 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1054691121 9:68322351-68322373 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691318 9:68322909-68322931 GAGGCACCCCTCGCGAGGTGGGG - Intergenic
1054691344 9:68322989-68323011 GAGGCACCCCTCGCGAGGTGGGG - Intergenic
1054691591 9:68324056-68324078 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691646 9:68324214-68324236 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691683 9:68324319-68324341 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691752 9:68324555-68324577 GAGGCACCCCTCGCGAGGCGGGG - Intergenic
1054692120 9:68326645-68326667 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692147 9:68326725-68326747 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692232 9:68327186-68327208 GAGGCACCCCCCGCGAGGAGGGG - Intergenic
1056078078 9:83062135-83062157 CTGGCGCCCCGCGCGAGTTTAGG - Intronic
1056864794 9:90219877-90219899 GAGGCGCCCCCCGCGATGCGGGG + Intergenic
1057551029 9:96050940-96050962 GTGAGGCCCCGCCCGTGGTGAGG - Intergenic
1061040708 9:128139243-128139265 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061040841 9:128139644-128139666 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1203468860 Un_GL000220v1:107814-107836 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1203476681 Un_GL000220v1:151786-151808 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1189332777 X:40153551-40153573 GGAGCGCCCCGCGGGGGGTGGGG - Intronic
1200787552 Y:7273753-7273775 GGGGCGCCCCGGGCGCGGAGGGG + Intergenic