ID: 954403969

View in Genome Browser
Species Human (GRCh38)
Location 3:50334872-50334894
Sequence TCGGATGCACAGCAGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954403961_954403969 19 Left 954403961 3:50334830-50334852 CCAAAGCTGCCTGCTGGAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 235
Right 954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 9
4: 105
954403963_954403969 10 Left 954403963 3:50334839-50334861 CCTGCTGGAAGAGGATTTCAACA 0: 1
1: 0
2: 2
3: 9
4: 140
Right 954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954403969 Original CRISPR TCGGATGCACAGCAGGACCA TGG Intronic
902721595 1:18307893-18307915 TCTGAAGCACAGCATGAGCAAGG - Intronic
903344004 1:22673041-22673063 TCTGGTGCACGGCAGGTCCACGG + Intergenic
904083156 1:27884761-27884783 GGGGATCCACAGCAGGGCCAAGG - Intronic
907096838 1:51789733-51789755 TCAGATGCTAAGCAGGTCCAGGG - Intronic
916832852 1:168510659-168510681 TCTGATGCACGGCAAGATCATGG + Intergenic
918127414 1:181596616-181596638 TCAGATGCCCTGCAGGCCCAGGG + Intronic
924386094 1:243498862-243498884 TGGGACGCACTGCAGGGCCAGGG - Intronic
1066614020 10:37278424-37278446 TCGGATTCTCAACAGGGCCATGG + Intronic
1073071780 10:100798859-100798881 ACGGCGGCACAGCAGGACCAGGG - Intronic
1073941472 10:108703611-108703633 TAGGATTCAAAGCAGGAACATGG + Intergenic
1076508985 10:130998918-130998940 TGGGATGCAGAGCTGGACCCCGG - Intergenic
1089073940 11:115721936-115721958 TCAGATGCACAGAGGAACCAAGG - Intergenic
1090079294 11:123600850-123600872 TAGGAAGCACAGCAGGATGAGGG + Intronic
1090835201 11:130448972-130448994 TAGGATGCCCAGCAGAAGCATGG - Exonic
1091251589 11:134148466-134148488 AAGGAGGCACAGCAGGGCCAGGG + Intronic
1093162019 12:15758439-15758461 TCTGTTGAACAGCACGACCATGG - Intronic
1093345823 12:18037499-18037521 TCGGATTCTCAACAGGGCCATGG - Intergenic
1096935663 12:55271430-55271452 TCTAATGGACAGCAGGACCATGG - Intergenic
1097686995 12:62700368-62700390 TAGGAAGAATAGCAGGACCAAGG - Intronic
1101303310 12:103503506-103503528 GCAGATGCACAGCGTGACCAGGG - Intergenic
1105007445 12:132730028-132730050 TCTGAATCACAGCAGGACCCTGG - Exonic
1112302269 13:98240953-98240975 TGAGATGCACAGCAGGACTCTGG + Intronic
1115581197 14:34760422-34760444 TCGGATACGCAGCAGGATTAAGG - Intronic
1117654898 14:57945056-57945078 TTGGATGCAAAGGAAGACCAAGG - Intronic
1119406413 14:74402321-74402343 GCGGATAGACAGCAGGTCCATGG - Intergenic
1121712756 14:96051733-96051755 TGGGATACGCAGCAGGACCCGGG - Intronic
1128612668 15:69086617-69086639 TGGGATGCCCAGCATGGCCACGG + Intergenic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1132040686 15:98522490-98522512 AGGGATGCACATCAGGACGATGG - Intergenic
1132357266 15:101181040-101181062 TCGGAGGCACAGCAGTTACAAGG + Intronic
1132506429 16:311806-311828 TCGGAAGCACGGCAGCTCCAGGG + Intronic
1136402586 16:30026618-30026640 TGGGAAGCACACCAGCACCATGG + Exonic
1136637227 16:31532170-31532192 TCAGATTCACAGCAGGTTCAAGG - Intergenic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1140306461 16:73807476-73807498 TGGGAGACACAGCAAGACCATGG - Intergenic
1140468557 16:75201427-75201449 TCGGAAGCAGAGCAGAACCCTGG - Intergenic
1142187933 16:88703339-88703361 TCGGCTGCACAGCACGGCCACGG + Intronic
1143253772 17:5540999-5541021 GAGGAGGCCCAGCAGGACCAGGG + Intronic
1143682937 17:8491153-8491175 GGGGGTGCACAGCAGCACCAAGG - Intronic
1144857508 17:18277868-18277890 TGGGATGCCCACCAGGCCCAGGG - Exonic
1147774859 17:42893478-42893500 TGGGATACAGACCAGGACCAAGG + Intergenic
1148821621 17:50363408-50363430 TTGGAAGCACTGCAGGACCCAGG + Intergenic
1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG + Exonic
1152262447 17:79274474-79274496 TCGGCCTCACAGCAGGACAAAGG - Intronic
1160543643 18:79638727-79638749 TCGGACGCACGGCAGGGCCCGGG - Intergenic
1164455135 19:28400455-28400477 TGGGATTCACACCAGGGCCAAGG + Intergenic
1164543766 19:29142245-29142267 TCGGATCCACTGCAGGTCTATGG + Intergenic
1166981707 19:46635285-46635307 TCGGATGGACAGAGGGACAACGG + Intergenic
925404455 2:3596923-3596945 TCAGACGCACAGCAGGAACCAGG - Intronic
925907472 2:8547907-8547929 TGGGGTGCACACCAGGACCCCGG + Intergenic
926108052 2:10164797-10164819 CCAGATGGACTGCAGGACCAGGG - Intronic
926112931 2:10194367-10194389 GAGGAGGCACGGCAGGACCAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
938480461 2:131658108-131658130 ACTGAGGCACAGCAGGACCGGGG - Intergenic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948675641 2:239594999-239595021 TCTGATGCACAGCAGGAGGGCGG + Intergenic
1169711774 20:8572573-8572595 TCGGGTGCACAGAATGTCCATGG - Intronic
1172860365 20:38044900-38044922 TCTCATGCACAGCAGGCCTATGG - Intronic
1173016061 20:39226752-39226774 TGGCCTGCACAGCAGGACCCAGG - Intergenic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1175577808 20:60075682-60075704 TCAGGTGAACAGCAGGACCCAGG - Intergenic
1175891155 20:62316623-62316645 TCAGATGCCCAGCAGGCCTAAGG + Intronic
1179710829 21:43212049-43212071 AAGGATGAACAGCAGAACCAAGG - Intergenic
1180741150 22:18054024-18054046 TGGGATGCTCTGCAGCACCAGGG - Intergenic
1183032070 22:35113841-35113863 GAGGAAGCACAGAAGGACCAGGG - Intergenic
1184975586 22:48059141-48059163 GCTGATGCAGAGAAGGACCATGG + Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG + Intronic
958900440 3:99879900-99879922 TCTGAAGCAATGCAGGACCATGG - Intronic
961366254 3:126401802-126401824 TGGGAGCCACAGAAGGACCAGGG - Intronic
961523935 3:127484572-127484594 TAGGATGCAGAGCTGGTCCAGGG + Intergenic
965638486 3:170808667-170808689 ACTGATACACAGCAGAACCAGGG - Intronic
968145685 3:196296900-196296922 TGGGAGACACAGCAGGACCCTGG + Intronic
968145730 3:196297154-196297176 TGGGAGACACAGCAGGACCCTGG + Intronic
968979813 4:3841172-3841194 TCTGATGCCCACCAGGACAAGGG - Intergenic
970142083 4:12993980-12994002 TTGGAGGCACAGCAGTACCTGGG + Intergenic
978746584 4:112201792-112201814 TGGGATTCACAGATGGACCAAGG - Intergenic
979665089 4:123302645-123302667 TGGGAAGCAGAGCAGGACCAAGG + Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
993733630 5:91450426-91450448 TCAGATGCTAAGCAGAACCAGGG - Intergenic
995195999 5:109369056-109369078 TGGAATGCAGAGCAGGAACAAGG - Intronic
996322896 5:122239334-122239356 TTGGATGGACTGCAGGACTAAGG + Intergenic
1001771714 5:174301844-174301866 TCAGATGCACAGAAAGACTAGGG - Intergenic
1001982577 5:176046976-176046998 ACAGATGAACAGCAGGTCCAAGG + Intergenic
1002174544 5:177394094-177394116 GCAGGTGCACAGCAGCACCAGGG - Exonic
1002234885 5:177797081-177797103 ACAGATGAACAGCAGGTCCAAGG - Intergenic
1007764292 6:44151917-44151939 TGGGATGCGCAGCAGGTCCATGG - Exonic
1009595933 6:65736505-65736527 CCAGATGGACAGCAGGATCAGGG + Intergenic
1010382093 6:75236998-75237020 ATGGATGCACAACAGGACCCAGG + Intergenic
1018081614 6:160263680-160263702 TGGGATGTGCTGCAGGACCAGGG + Intronic
1019465413 7:1185538-1185560 TCGGGGCCACAGCATGACCATGG - Intergenic
1021796788 7:24263594-24263616 TCCGAGCAACAGCAGGACCATGG - Intergenic
1024219546 7:47277154-47277176 TAGGATGCACCGCAGGCCCCTGG - Exonic
1024479400 7:49848412-49848434 TGGGATGCACAGCTGGTCCGGGG - Intronic
1027761707 7:82286918-82286940 TCAAAAGCACAGCAGGTCCAGGG + Intronic
1032192641 7:129773435-129773457 TTGACTGCACAGCAGGAACATGG - Intergenic
1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG + Intronic
1033528861 7:142243720-142243742 TCGGATCCACTGAAGGTCCAAGG + Intergenic
1034925961 7:155122083-155122105 TCCGAAGCCCAGCAGGGCCATGG - Intergenic
1035843067 8:2833323-2833345 TTAGATCCACAGCAAGACCAAGG + Intergenic
1045463626 8:102448585-102448607 TGGGATGCAGAGCAGGCCCATGG - Intergenic
1047725153 8:127678106-127678128 TCTGCTTCCCAGCAGGACCAGGG + Intergenic
1047775644 8:128068092-128068114 ATGCATGCACAGCAGGAACAGGG - Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1050427005 9:5521902-5521924 TGGGAGGTACAGCAGGACCAAGG + Intronic
1050867960 9:10528267-10528289 ACGGATGCACAGCAGGTCTGTGG - Intronic
1052600440 9:30621442-30621464 TCTGCTGCACTGCAGAACCAGGG + Intergenic
1058569383 9:106324398-106324420 TCGGATGGAAAGCAGGCCCTGGG - Intergenic
1058938169 9:109788641-109788663 TGTGATGCACATCAGGACCCAGG - Intronic
1062386069 9:136311991-136312013 TCGGGAGCACAGCAGGGGCATGG - Intergenic
1191678163 X:63813633-63813655 TTGGTTGTTCAGCAGGACCATGG - Intergenic
1193158736 X:78204026-78204048 TCAGATGGACAGCAAGAACAGGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1201378245 Y:13344826-13344848 TCTGACTCACAGAAGGACCATGG - Intronic