ID: 954406040

View in Genome Browser
Species Human (GRCh38)
Location 3:50345551-50345573
Sequence GACCTGGAACTGCTGCTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 269}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954406040_954406060 29 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406060 3:50345603-50345625 CCTGGGCAGCAGCCGGGGTGGGG 0: 1
1: 0
2: 13
3: 59
4: 625
954406040_954406051 12 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406051 3:50345586-50345608 GCCGGGGTCCGGCGGATCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 69
954406040_954406049 4 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406049 3:50345578-50345600 ATATCGAGGCCGGGGTCCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 44
954406040_954406047 1 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406047 3:50345575-50345597 CCCATATCGAGGCCGGGGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 49
954406040_954406043 -6 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406043 3:50345568-50345590 CAGGTCTCCCATATCGAGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 68
954406040_954406045 -4 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406045 3:50345570-50345592 GGTCTCCCATATCGAGGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
954406040_954406058 28 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406058 3:50345602-50345624 TCCTGGGCAGCAGCCGGGGTGGG 0: 1
1: 0
2: 6
3: 34
4: 374
954406040_954406055 23 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406055 3:50345597-50345619 GCGGATCCTGGGCAGCAGCCGGG 0: 1
1: 0
2: 4
3: 22
4: 243
954406040_954406054 22 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406054 3:50345596-50345618 GGCGGATCCTGGGCAGCAGCCGG 0: 1
1: 0
2: 1
3: 15
4: 278
954406040_954406050 11 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406050 3:50345585-50345607 GGCCGGGGTCCGGCGGATCCTGG 0: 1
1: 1
2: 0
3: 13
4: 169
954406040_954406044 -5 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406044 3:50345569-50345591 AGGTCTCCCATATCGAGGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 52
954406040_954406041 -10 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406041 3:50345564-50345586 GTTCCAGGTCTCCCATATCGAGG 0: 1
1: 0
2: 0
3: 4
4: 53
954406040_954406057 27 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406057 3:50345601-50345623 ATCCTGGGCAGCAGCCGGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 317
954406040_954406056 24 Left 954406040 3:50345551-50345573 CCGGGCAGCAGCAGTTCCAGGTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 954406056 3:50345598-50345620 CGGATCCTGGGCAGCAGCCGGGG 0: 1
1: 0
2: 0
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954406040 Original CRISPR GACCTGGAACTGCTGCTGCC CGG (reversed) Exonic
900404177 1:2485314-2485336 GACCTGCAACTCCTGCCACCAGG - Intronic
900774700 1:4573831-4573853 GACCAGGAAGGGCTGCAGCCTGG - Intergenic
900934338 1:5755809-5755831 GCCCTGGAGCTCCTGCTGTCAGG - Intergenic
903389397 1:22953518-22953540 GGCCTGGTGCTGCTGCTGGCAGG - Exonic
904809746 1:33155605-33155627 GACTTGGAAATGCTACAGCCAGG - Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906383792 1:45349631-45349653 GCCCAGGCACTGTTGCTGCCTGG + Intronic
906640665 1:47438847-47438869 CACCCGGAGCTGCTGCTGCGTGG + Exonic
907525457 1:55051332-55051354 GCCCTGGAACCCCTGCAGCCAGG - Intronic
907561979 1:55399561-55399583 GACCTGGGAATGCTTCAGCCAGG + Intergenic
908055647 1:60283891-60283913 GTCCTGCAGCTGCTGGTGCCAGG + Intergenic
908547577 1:65176820-65176842 CACCAGGAACTACTACTGCCAGG - Intronic
911153971 1:94621538-94621560 GACCTGGGTGTGGTGCTGCCTGG - Intergenic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
912468039 1:109887410-109887432 GGCCTGGAAATGAAGCTGCCTGG + Intergenic
912726095 1:112060029-112060051 CAACTGGAACTAGTGCTGCCAGG + Intergenic
913565351 1:120068541-120068563 GAGCAGCAAATGCTGCTGCCAGG + Intronic
913632780 1:120725021-120725043 GAGCAGCAAATGCTGCTGCCAGG - Intergenic
914285940 1:146227896-146227918 GAGCAGCAAATGCTGCTGCCAGG + Intronic
914546972 1:148678649-148678671 GAGCAGCAAATGCTGCTGCCAGG + Intronic
914619536 1:149391713-149391735 GAGCAGCAAATGCTGCTGCCAGG - Intergenic
915238195 1:154501521-154501543 GAGCTGGAGCTACTGCTGCTGGG + Exonic
915599019 1:156910691-156910713 GAACGGGACCTGCTACTGCCTGG + Exonic
916211773 1:162365536-162365558 GAGCTGGAACTGAAGCTGTCAGG + Exonic
916788084 1:168100853-168100875 GACCTGGAACTCCAGCAGCTTGG + Intronic
917367015 1:174243095-174243117 GACCTGGAAAATCTGCTGCTTGG + Intronic
918204976 1:182300248-182300270 GGCCTGCAGCTGTTGCTGCCTGG + Intergenic
918998076 1:191789004-191789026 GCCATGTAACTGCTGCTACCTGG + Intergenic
919664397 1:200278419-200278441 GCCCAGTAACTGCTGCTGGCTGG - Intergenic
920178223 1:204116660-204116682 TACCTGCTCCTGCTGCTGCCGGG - Exonic
920351003 1:205337964-205337986 TACCTGGAAGCCCTGCTGCCTGG + Intronic
920382210 1:205541731-205541753 GAACTGGAACTGGTGCTGCAGGG - Intergenic
921158728 1:212458041-212458063 GGTAAGGAACTGCTGCTGCCGGG - Intergenic
923591615 1:235324850-235324872 GATCTGTAACTGCTGCCTCCTGG - Intronic
924530809 1:244892178-244892200 GACCTCGAACTGCTGATCTCAGG + Intergenic
924710700 1:246527973-246527995 GACCTGTGACTTCTGCTTCCTGG + Intergenic
1065129346 10:22604881-22604903 GACCTGGGGCTTCAGCTGCCTGG - Intronic
1065874505 10:29985163-29985185 AAGCTGGTACTGCTGATGCCTGG - Intergenic
1067941400 10:50659971-50659993 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1069792141 10:71029713-71029735 GAGCTGGCCCTGCAGCTGCCTGG - Intergenic
1070411681 10:76148009-76148031 GAACTGCAAATGCTGCTGCCTGG + Intronic
1070657831 10:78283366-78283388 GACCTGGAGCTGCTGCAGGTGGG + Intergenic
1070662364 10:78316507-78316529 GCCCTAGAACTGCTGGAGCCAGG + Intergenic
1070862638 10:79684933-79684955 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1071720243 10:88136616-88136638 TATCAGGAACTGCTGCTGCTGGG - Intergenic
1073061748 10:100737515-100737537 TTCCCGGAGCTGCTGCTGCCTGG - Intronic
1073307542 10:102515092-102515114 GGTCTGGAACTGCCGCTGACCGG + Intronic
1075405602 10:122193725-122193747 CAACTGCGACTGCTGCTGCCAGG + Intronic
1076150997 10:128161891-128161913 GGCCTGGAAGGGATGCTGCCTGG - Intergenic
1077103623 11:832799-832821 GACCTGGCACTGCGGAGGCCGGG - Intergenic
1077128127 11:953580-953602 GACTTCCAACTGCAGCTGCCAGG - Intronic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1079837467 11:25351524-25351546 GAGCTGCAGCTGCTGGTGCCAGG + Intergenic
1079940872 11:26678794-26678816 GACCTGGAATAGCTGATACCTGG - Exonic
1080531720 11:33182721-33182743 GACCTTGACCTGCTGCTGGAAGG - Intergenic
1080892963 11:36425437-36425459 ACCCTGGAACTCCTCCTGCCTGG - Intronic
1081489005 11:43553092-43553114 GACCTGGAACTGCAGCTGCTCGG + Intergenic
1082725999 11:56737426-56737448 GACCTGGGATTGCTGGTGCTGGG + Intergenic
1083920402 11:65779153-65779175 TACCTGGAAGAGCTGCTGGCTGG - Exonic
1084376564 11:68782235-68782257 GATCTGGGTCTGCTGCTTCCTGG - Intronic
1085014939 11:73167740-73167762 GAGCTGGACCTGCTGCTGCAGGG + Intergenic
1085033130 11:73284554-73284576 GCCCTGGGGCTGCTTCTGCCTGG - Intronic
1086059997 11:82690736-82690758 GAACCGGAACAGCTGCTGCAGGG + Intergenic
1090330129 11:125924833-125924855 CACATGGAACTCCTGCTGCTCGG + Intergenic
1090557360 11:127890830-127890852 GACCAGGGCCTGCTGCTGACTGG - Intergenic
1101340896 12:103841191-103841213 GCTCTGCGACTGCTGCTGCCCGG + Exonic
1101721636 12:107355369-107355391 CACGTGGAACAGCTGGTGCCTGG + Intronic
1101998163 12:109539869-109539891 GAACTGCAACTGCTGGTCCCCGG - Intergenic
1103076259 12:117985294-117985316 TACATGTAACTGCTGCCGCCTGG + Intergenic
1103505856 12:121442149-121442171 GACCTGGAACCGCTGGTGAGCGG - Exonic
1103524583 12:121559315-121559337 GACCTGGAAGTCCAGCTTCCAGG - Intronic
1104015683 12:124960215-124960237 GAGCTGGGTCTGCTGGTGCCTGG - Intronic
1104886003 12:132108663-132108685 TACCTGGAGCGGCTGCTGCTGGG - Exonic
1106930223 13:34655224-34655246 CACATGGAAGTGCTGCTGTCAGG - Intergenic
1107817775 13:44259568-44259590 GCCCTGGAGCTGCTGCTGTGTGG - Intergenic
1108107166 13:47023397-47023419 GAACTGGAACTGCTGGTTCTGGG + Intergenic
1108689919 13:52850851-52850873 CGCCTGGCGCTGCTGCTGCCGGG + Intergenic
1108889997 13:55245201-55245223 GACCTGTGGCTGCTACTGCCTGG - Intergenic
1112319818 13:98395872-98395894 GGACTTGAACTGCTGCTGCTGGG - Intronic
1113888650 13:113725078-113725100 GACCTGGAGATGCTGCCGTCAGG + Intronic
1113907253 13:113825516-113825538 GAGCTGTAACTGCTTCTGTCCGG + Intronic
1117189429 14:53275970-53275992 GCCATAGTACTGCTGCTGCCTGG - Intergenic
1117237668 14:53795449-53795471 GAACTGGAAAAGTTGCTGCCAGG - Intergenic
1118171613 14:63394798-63394820 GTCCTTGAACAGCTGCAGCCTGG - Intronic
1118366796 14:65102871-65102893 GAGCTGGAACTCCTGGAGCCGGG + Intergenic
1120129896 14:80794221-80794243 GACCTGGAACCTCTGCTGTTGGG - Intronic
1122782008 14:104147662-104147684 GACCTGCGAGGGCTGCTGCCTGG + Intronic
1122986411 14:105213729-105213751 GGCCTGGCACAGCTGCTTCCTGG - Intronic
1124007953 15:25809861-25809883 CACCTTGGACCGCTGCTGCCTGG + Intronic
1125469937 15:39992999-39993021 AAACTGGCACTGCTGCTGCCAGG + Intronic
1125510707 15:40291070-40291092 GAGCTGGAGCTGCTGCGGCAGGG - Exonic
1125578233 15:40769160-40769182 TAGCTGGGACTGCTGCAGCCGGG - Intronic
1128910598 15:71510604-71510626 GATGTGGCAATGCTGCTGCCTGG + Intronic
1130287628 15:82569178-82569200 GATCTGGCACTGCAGCTGGCTGG + Intronic
1131679775 15:94709340-94709362 AAAGTGGAACTGCTGCTCCCAGG + Intergenic
1132115236 15:99131194-99131216 GACCTCCACCAGCTGCTGCCGGG - Exonic
1133273899 16:4625245-4625267 TACCTGGCGCTGCTACTGCCCGG + Intronic
1133420372 16:5641626-5641648 GACCTGGCACTGCAGTGGCCTGG + Intergenic
1136536450 16:30902504-30902526 GACCTGGGCCAGCTGCTGCCCGG + Exonic
1136589285 16:31207721-31207743 GACCTGAAACTGCTGCAGGAGGG - Intergenic
1137531483 16:49281434-49281456 GTCCTGGAGCTGCTGCTGCTGGG - Exonic
1139559391 16:67732110-67732132 GAGCTGGAACTGCTGAGGGCAGG - Intronic
1140189155 16:72800069-72800091 GATCTGGAACAGCTGCTGGGAGG + Exonic
1141048551 16:80739566-80739588 ATCCTGGGACTGCTGGTGCCCGG - Intronic
1143421931 17:6800150-6800172 GACCTGGATCTCCTCCTGCAGGG + Exonic
1144728685 17:17514594-17514616 GCCCTGATCCTGCTGCTGCCCGG + Intronic
1146728716 17:35175896-35175918 GGCCTGCTGCTGCTGCTGCCTGG + Intronic
1146788988 17:35741140-35741162 GACCTGGAAGTGCGGCTACGTGG + Exonic
1147538410 17:41335542-41335564 GACCTGCAGCTTCTGCTTCCTGG + Intergenic
1152739067 17:82011233-82011255 GACCTTGGGCTGCTGCCGCCCGG - Intronic
1155721462 18:29017996-29018018 GACAAGGAACTGCTGAAGCCAGG - Intergenic
1156524555 18:37754495-37754517 AACTTGGAATTGATGCTGCCAGG - Intergenic
1158711820 18:59844574-59844596 GCCCTGTAACTTCTGCTTCCTGG + Intergenic
1160099467 18:75906511-75906533 GACGTGGAGCAGCTGCTGCTGGG - Intergenic
1160441233 18:78894454-78894476 GACAGGGAAGGGCTGCTGCCAGG - Intergenic
1161208394 19:3054026-3054048 GGCTTGGAGCTGCTGCTGCAGGG + Exonic
1161459550 19:4388712-4388734 GAAATGCACCTGCTGCTGCCCGG - Intronic
1161507549 19:4652074-4652096 AAGCTGGGACTGCTGCTGCGTGG + Exonic
1162519763 19:11172948-11172970 CACCTGGATCTGCAGCAGCCGGG + Intronic
1163969215 19:20776310-20776332 GACCTGGAGCTCCAGCTGCAGGG - Intronic
1164148984 19:22532595-22532617 CACCTGGACGCGCTGCTGCCTGG - Intergenic
1165080027 19:33301785-33301807 GATCTGGAACTGCAGGTGCGGGG + Exonic
1165829220 19:38722273-38722295 GGCCTGGGCCTCCTGCTGCCTGG - Intronic
1165882078 19:39051422-39051444 GGCCTGTAACTCCTGCTGCCAGG - Intergenic
1166539325 19:43595088-43595110 GTGCTGGTACTGGTGCTGCCCGG - Exonic
1167456677 19:49599868-49599890 GCCCTGGAACTGCAGCCGCGGGG - Exonic
1167641035 19:50681561-50681583 GACCTAGAACTGTGGCTGCCTGG + Intronic
1168092832 19:54096861-54096883 GTCCTGGAGCTGCTGGTGACAGG - Exonic
925443860 2:3910657-3910679 CACCTGGACCTGTTGCTTCCAGG + Intergenic
926846601 2:17147843-17147865 GACCCACAAGTGCTGCTGCCCGG + Intergenic
929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG + Exonic
929887002 2:45887895-45887917 TATCTGGAACTGCAGCTGCAGGG + Intronic
930741998 2:54841269-54841291 GACCCTGAACTACTGTTGCCAGG + Intronic
931505696 2:62923533-62923555 GACCTGGGAGTGTTTCTGCCAGG - Intronic
932352944 2:71046618-71046640 CTCCTAGTACTGCTGCTGCCTGG - Intergenic
933162802 2:79044733-79044755 GACCTGCAAGTTCTGCAGCCTGG - Intergenic
933719611 2:85389711-85389733 GAGCTGGAGTTGCTGCTGACTGG + Intronic
935848036 2:107187788-107187810 GTCCTGCCACTGCTGCTGACAGG + Intergenic
936514907 2:113175190-113175212 GACCCAGTACAGCTGCTGCCTGG - Intronic
937243209 2:120475777-120475799 AACCTGGAGCTGCTGCTCCCCGG - Intergenic
937333094 2:121044292-121044314 GCCCTGGAACTCCTGGGGCCTGG - Intergenic
937955273 2:127418649-127418671 GACCTGAGACTGTGGCTGCCAGG - Intronic
937964229 2:127489188-127489210 GACCTGGAAAAGGTGCTGACAGG - Exonic
938305601 2:130252273-130252295 GTCCAGGCACTGCTGCTGCTCGG - Intergenic
938448550 2:131395508-131395530 GTCCAGGCACTGCTGCTGCTCGG + Intergenic
939629203 2:144514088-144514110 GCCCTGGCACTGCCTCTGCCAGG + Intronic
940446603 2:153785057-153785079 GGTTTGGAACTGCTGCTGGCTGG - Intergenic
942133961 2:172906998-172907020 GGCCTGGGGCTGCTCCTGCCTGG - Intronic
942565887 2:177264548-177264570 GACTTGGAGCTGCCGCCGCCGGG - Exonic
943092342 2:183390102-183390124 GTCCTGCCACTGCTGCTGGCAGG - Intergenic
943676833 2:190723950-190723972 GCCCTGGATCTGCTGCTTACTGG + Intergenic
943906146 2:193502728-193502750 CACCCGGAACTGGTGCTGGCCGG + Intergenic
946486924 2:220109764-220109786 GAGGTGGAAGTGATGCTGCCTGG + Intergenic
946866750 2:224047724-224047746 GCACTGGATCTGCTGGTGCCTGG + Intergenic
946872852 2:224100412-224100434 GAATTGTAACTGCTGCTTCCTGG + Intergenic
947862997 2:233375640-233375662 GGCCTGAAGCTGGTGCTGCCTGG - Intronic
948482113 2:238256727-238256749 GACCTGGACAGGTTGCTGCCTGG + Intronic
948705871 2:239792190-239792212 GGACTGGACCTGCTGCTGCAGGG - Intronic
1170692309 20:18626834-18626856 GACCTTGAATTTCTGTTGCCAGG - Intronic
1172233019 20:33349798-33349820 GACCTGGAACAGCTCTTGCTGGG + Intergenic
1172360759 20:34311425-34311447 GACCGGGACCTGCTTCTGCCTGG - Intronic
1174087223 20:48018068-48018090 GACCCAGATCTGGTGCTGCCTGG - Intergenic
1174149765 20:48477851-48477873 GACCTGGGACTCCTGCTCCTGGG + Intergenic
1174767915 20:53271212-53271234 GTCCTGGAACTGCTGGAGTCTGG + Intronic
1175786606 20:61716018-61716040 GCACTGGGGCTGCTGCTGCCTGG - Intronic
1176059988 20:63168302-63168324 GACCAGGAGGTGCTGCTGCCTGG - Intergenic
1178671646 21:34596181-34596203 TTCCTGGCACTGCTGCTCCCTGG - Intronic
1178904422 21:36624742-36624764 GAGCTGGTTCTGCTGCTACCTGG - Intergenic
1179504332 21:41830920-41830942 GACCTGGGGCTGCTGCTGCAGGG - Intronic
1180198320 21:46210359-46210381 GAACTGGAACTGCTTGGGCCAGG - Intronic
1180468130 22:15635252-15635274 GTCCGGGAGCTGCAGCTGCCTGG + Intergenic
1180938640 22:19642257-19642279 GACCTGGCACCGCTGCTGCGTGG - Intergenic
1181005035 22:20009273-20009295 GAGCTGGGTCTGCTGCCGCCTGG - Intronic
1181104305 22:20564582-20564604 TGCTTGGAACTGCTGCTGCATGG - Exonic
1181499195 22:23306230-23306252 AACCTGGTACTGATGCTGCCAGG - Intronic
1183149720 22:36028325-36028347 GAGCTGGAGCTGCCGGTGCCCGG - Exonic
1183508938 22:38223848-38223870 GATGTGAAAGTGCTGCTGCCCGG - Intronic
1183626144 22:39003436-39003458 CACCTGGGCCTGCAGCTGCCAGG + Intergenic
1185108162 22:48885797-48885819 GCCCAGGACCTGCTGCTCCCTGG + Intergenic
950422280 3:12906163-12906185 GACCTGGGACAGCTGCTCTCAGG + Intronic
950530217 3:13548873-13548895 GACCTGGCACTGCTGCCCACAGG - Intergenic
950604311 3:14064795-14064817 GTGCTGGAGCTGCTGCTGCTGGG - Exonic
950673357 3:14540153-14540175 GACCTGGGACTGCCACTCCCTGG - Intronic
950782693 3:15405826-15405848 TACCTGGCAGGGCTGCTGCCAGG - Intronic
951524608 3:23641921-23641943 GCCCTGGATCTCCTGCTCCCTGG - Intergenic
951770441 3:26250230-26250252 CACCTGCAGCTGCTGCTGCTCGG + Intergenic
952967100 3:38628191-38628213 GCCTTGACACTGCTGCTGCCTGG - Intronic
953541946 3:43828269-43828291 CACCTGGAGCTGCATCTGCCAGG + Intergenic
953593192 3:44280791-44280813 GGCCTGCAGCTGCTGCTGCCAGG - Intronic
953793814 3:45967777-45967799 CTCCAGGAACTGCAGCTGCCGGG + Exonic
954406040 3:50345551-50345573 GACCTGGAACTGCTGCTGCCCGG - Exonic
955239863 3:57168932-57168954 GGTCTGGAACTCCTGATGCCAGG + Intronic
956850336 3:73223085-73223107 GAGAAGGAACTGCTGCTGCCAGG - Intergenic
957074058 3:75587840-75587862 CACCTGGAACTCCAGCTGGCAGG - Intergenic
958760125 3:98296729-98296751 GACCTGGAACTGGGGCCTCCTGG - Intergenic
958996833 3:100915169-100915191 ATCCTGGAACTGCTGCTGGAGGG - Intronic
959552208 3:107674604-107674626 GATTTGGTACTGCTGCCGCCAGG - Intronic
959579740 3:107971266-107971288 TGCCTGGAGCTGCTTCTGCCTGG - Intergenic
960572115 3:119195417-119195439 GACATGGCACTGTTGCTGACAGG + Intronic
961222858 3:125213270-125213292 GGCGTGGAACTGCTTTTGCCAGG + Intergenic
961562441 3:127740042-127740064 GGCCTGGACCTGCTGAGGCCAGG - Intronic
961988054 3:131158375-131158397 GCCCTGCTACTGCTGCTGACAGG + Intronic
962010053 3:131383282-131383304 GACTTGGGACTGCTGCAGTCTGG + Exonic
962105358 3:132383434-132383456 GACCTGGGCCTCCTGCTCCCTGG - Intergenic
962702519 3:138013234-138013256 GACCTGGTCCTCCTCCTGCCTGG + Intronic
964462619 3:156952196-156952218 GACCTGGAATAGCTGCTGATGGG + Intronic
964730133 3:159856332-159856354 TACATGGAACTGATGCTGCCTGG + Intronic
964743267 3:159988876-159988898 GTCCCGGAACGGCTGCGGCCGGG + Exonic
965623145 3:170660446-170660468 GACCTGGAATGGCTTTTGCCCGG + Intronic
966315829 3:178644496-178644518 CACCTGGAACTCCACCTGCCTGG + Intronic
967795222 3:193592407-193592429 TCCCTGGAACTGCTGCTCCCAGG - Intronic
968644781 4:1735033-1735055 CACCTGGAGGTGCTGCTGGCAGG + Intronic
972358385 4:38303689-38303711 GACCTGGACCTCCTGCTCCATGG - Intergenic
972953778 4:44363644-44363666 AACATGGAAGTGTTGCTGCCAGG + Intronic
976483587 4:85573484-85573506 GTCCTGGCCCTGCTGCTGCATGG - Intronic
977586420 4:98779901-98779923 GATATGGAACAGCTGCAGCCTGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978138351 4:105289949-105289971 GCACTGCAGCTGCTGCTGCCAGG - Intergenic
982079594 4:151776065-151776087 GACCTGGAATATCTGCTGTCTGG + Intergenic
982435855 4:155383181-155383203 GACCTGCAGCTTCTGCTTCCTGG - Intergenic
986668512 5:10123912-10123934 CACTGGGAACTGCTGCTTCCTGG + Intergenic
991086126 5:62649675-62649697 GAACTGAATCTGCTGATGCCTGG + Intergenic
991292869 5:65049578-65049600 TAAATGGAGCTGCTGCTGCCAGG - Intergenic
992073535 5:73170605-73170627 AAACTGGAACTGTTACTGCCAGG + Intergenic
993348249 5:86812891-86812913 AACCTGGACTTGCTGCTACCAGG + Intergenic
994157823 5:96523219-96523241 CACATGGCACTGCTGCTGACTGG + Intergenic
994681060 5:102888258-102888280 GACCAGGAAGTGTTGCTGTCTGG - Intronic
995260483 5:110098434-110098456 GGCCTGTAACTGCAGCTGCCTGG + Intergenic
995913623 5:117216940-117216962 GACCTGGCTCTGCGGCTGACTGG + Intergenic
996274856 5:121652463-121652485 CACCTGGAAGTGTTGCAGCCTGG + Intergenic
997590054 5:135066946-135066968 GAGATGGGACTGCTGCTGCCAGG + Intronic
998092787 5:139380868-139380890 GGCCTGGAACAGCGGCAGCCTGG + Exonic
998128212 5:139638087-139638109 GTCCTGGAACTGTTGCTGTGTGG + Intergenic
999325786 5:150642545-150642567 GATCTTGAGCAGCTGCTGCCTGG + Intronic
999419821 5:151431301-151431323 CACCCGGAGCTCCTGCTGCCAGG - Intergenic
999566894 5:152873953-152873975 GCCCTGCCACTGCTGCTGGCAGG + Intergenic
999613349 5:153395028-153395050 GGCATGGGATTGCTGCTGCCAGG + Intergenic
999874375 5:155786327-155786349 AACCTGGGACTGTTTCTGCCTGG - Intergenic
1003067767 6:2918201-2918223 GCCATAGAACTGCAGCTGCCAGG + Intergenic
1004638615 6:17492410-17492432 AACATGGAACTGCAGCTGGCAGG + Intronic
1004906963 6:20245088-20245110 CACCTGGAACTCCAGCTGGCCGG + Intergenic
1006189784 6:32200866-32200888 GCCCTGGAGCCCCTGCTGCCTGG - Exonic
1006316062 6:33292438-33292460 GAGCTGGTACAGCTGCTACCAGG - Exonic
1007532015 6:42551572-42551594 GACCTGGATCCACTCCTGCCTGG - Intergenic
1012556162 6:100514779-100514801 TGCCTGGAACGGCTGCTGACTGG - Intronic
1014717124 6:124879550-124879572 GAGCTGCAGCTGCTGGTGCCAGG - Intergenic
1015029387 6:128575860-128575882 TACCTGGAACTGCTGATACTTGG + Intergenic
1017822590 6:158060173-158060195 CTCCTGGACCTGCTGCTGCTGGG + Intronic
1019157572 6:170049581-170049603 AACGTGGAACTGCTGGTTCCCGG - Intergenic
1021461931 7:20898509-20898531 GACCTGTAACTGTTTCTCCCAGG + Intergenic
1022468635 7:30668025-30668047 GCCCTCGGGCTGCTGCTGCCTGG + Intronic
1022834811 7:34103303-34103325 GACCTGGCACTTCTGCTCCCAGG + Intronic
1025111406 7:56219491-56219513 TACTTGGAACTGGTTCTGCCTGG - Intergenic
1025976764 7:66376664-66376686 GGCCTGGAAAGGCTGCTGCGAGG + Intronic
1025991730 7:66502737-66502759 GGCCAGGGGCTGCTGCTGCCTGG + Intergenic
1026512958 7:71042389-71042411 GGACTGGAAATGCAGCTGCCAGG + Intergenic
1027928990 7:84506793-84506815 GCCCTGTATCTGTTGCTGCCTGG - Intergenic
1029979239 7:104862708-104862730 GACCTGGACCTGCTGAACCCTGG + Intronic
1030991617 7:116307963-116307985 GACCAGGACCTGCTCTTGCCTGG + Intronic
1034456962 7:151175859-151175881 GAGCTGGGCCTCCTGCTGCCAGG + Exonic
1035740585 8:1925385-1925407 CACCTTGAACTCCTGCTGCTTGG - Exonic
1036139324 8:6191884-6191906 GAACCGCAAATGCTGCTGCCTGG - Intergenic
1037546753 8:19930964-19930986 GAACCGCAAATGCTGCTGCCTGG - Intronic
1038026464 8:23595361-23595383 GACGTGGAACTGTTGCAACCTGG + Intergenic
1038316091 8:26485561-26485583 GACCTGGAACTGTTGCTATCTGG + Intronic
1040865073 8:52040657-52040679 GACCTTGGACTCCTGCTGGCAGG - Intergenic
1045321320 8:101083745-101083767 GACCTGGACCGGCTGGTCCCAGG - Intergenic
1045343738 8:101276022-101276044 GCTCTTGATCTGCTGCTGCCAGG + Intergenic
1045905268 8:107337666-107337688 GACCTGGAAATACTTCTGCCAGG + Intronic
1047541743 8:125774247-125774269 AGCCTGTGACTGCTGCTGCCAGG + Intergenic
1049237268 8:141518589-141518611 GGCCTCGTCCTGCTGCTGCCCGG + Exonic
1049659470 8:143813303-143813325 GATCTGGAAGTGCTGGTGCGTGG - Exonic
1051725946 9:20088531-20088553 GGTTTGGAACTGCTGCTGACTGG - Intergenic
1052257450 9:26475054-26475076 GACCTGGAAGGGCTGCTGTTAGG - Intergenic
1052654348 9:31335586-31335608 GACCTGGGCCTTCTGCTCCCTGG - Intergenic
1053072636 9:35110335-35110357 GACCTGGAAGTGGTGGTGCTAGG - Exonic
1053412596 9:37925320-37925342 GTCCTGGGACTGTTGCTGACTGG - Intronic
1057080803 9:92173135-92173157 GACCTTGCACTGCTGCTGGTAGG - Intergenic
1057510954 9:95679031-95679053 CACCTGGAGTGGCTGCTGCCAGG - Intergenic
1058426188 9:104876874-104876896 CACCTGCATCTGCTCCTGCCAGG - Intronic
1058747500 9:108006392-108006414 GACCTGGAAATTTTGCTTCCAGG - Intergenic
1058750133 9:108031910-108031932 GAACCGCAAATGCTGCTGCCTGG + Intergenic
1058760132 9:108122540-108122562 GCCCTTGAGCTGCTGCTGCTTGG + Intergenic
1058764539 9:108168614-108168636 AACCAGGACCTGCTGCTGCCAGG + Intergenic
1059229986 9:112711292-112711314 GTCATGGAACTGCTGCTACTAGG - Intronic
1060509437 9:124221366-124221388 GACTTGGAACTGCAGATGACCGG - Intergenic
1060778167 9:126391954-126391976 GACCTGCCACTTCTGCTGCCAGG + Intronic
1061364946 9:130167796-130167818 GACCTGGAACCTCTGCTTCTTGG + Intergenic
1062100167 9:134723839-134723861 CACCTGGCAGAGCTGCTGCCTGG + Intronic
1185705683 X:2264666-2264688 GCCCTGGAAATGGTGCTCCCTGG - Intronic
1187603736 X:20861354-20861376 CAGCTGGAGCTGGTGCTGCCGGG - Intergenic
1190032224 X:46984910-46984932 GAACTGTCACTGCTGCTGACAGG - Exonic
1192266876 X:69544583-69544605 GACCAGGATCTACTTCTGCCAGG - Intergenic
1195355991 X:104040334-104040356 GCCGTGCGACTGCTGCTGCCGGG + Exonic
1196828559 X:119759073-119759095 GAGCCGGAGCTGCTGCTGCGGGG + Exonic
1198417438 X:136434812-136434834 CACCGGGAAAGGCTGCTGCCAGG - Intergenic
1200829985 Y:7680121-7680143 GACCTGGAAGTGAAGGTGCCAGG + Intergenic