ID: 954407167

View in Genome Browser
Species Human (GRCh38)
Location 3:50351645-50351667
Sequence CAGAATTCCCTCAACCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954407167_954407172 10 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407172 3:50351678-50351700 ATGAGTGAGGTGGAGCAGGTAGG 0: 1
1: 0
2: 1
3: 35
4: 381
954407167_954407170 0 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407170 3:50351668-50351690 TGCTGGAGCGATGAGTGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 206
954407167_954407175 21 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407175 3:50351689-50351711 GGAGCAGGTAGGTATGGCCAGGG 0: 1
1: 0
2: 3
3: 28
4: 233
954407167_954407169 -3 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407169 3:50351665-50351687 CTGTGCTGGAGCGATGAGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 178
954407167_954407171 6 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407171 3:50351674-50351696 AGCGATGAGTGAGGTGGAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 221
954407167_954407174 20 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407174 3:50351688-50351710 TGGAGCAGGTAGGTATGGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 240
954407167_954407173 15 Left 954407167 3:50351645-50351667 CCTGGCTGGTTGAGGGAATTCTG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 954407173 3:50351683-50351705 TGAGGTGGAGCAGGTAGGTATGG 0: 1
1: 0
2: 2
3: 28
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954407167 Original CRISPR CAGAATTCCCTCAACCAGCC AGG (reversed) Intronic
901402832 1:9026080-9026102 CAGCATTCGCTCAGCCACCCTGG + Intronic
902472458 1:16658292-16658314 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG + Intronic
902796500 1:18803993-18804015 CAGGATTCTCCCATCCAGCCTGG - Intergenic
902864851 1:19271153-19271175 AAGAATTGCATGAACCAGCCGGG + Intergenic
904422485 1:30403177-30403199 CAGACTTCCCTGGACCAGCTGGG - Intergenic
904742425 1:32688674-32688696 CAGAATTGCCTGAACCCGCAAGG - Intronic
905206617 1:36346287-36346309 AATAATGCCCTTAACCAGCCAGG - Intronic
907512724 1:54973705-54973727 CAGAATTCCAGGAACCAGCAGGG + Intergenic
910047227 1:82932339-82932361 CAGAATTCAGTAAATCAGCCAGG - Intergenic
912937064 1:114012745-114012767 GAAAAGTCCCTCACCCAGCCTGG - Intergenic
913284277 1:117212632-117212654 AAGAATTCCTCCTACCAGCCAGG - Intergenic
915819243 1:159004407-159004429 AAGAATTCCCAAAACCAGCCGGG + Intronic
916810447 1:168301023-168301045 GAGGATTCCCTCCACCATCCTGG - Intronic
917654310 1:177111173-177111195 CTGAATTCTCACAACCATCCTGG + Intronic
919905928 1:202078297-202078319 CAGAATTCCCTGAATGAGGCAGG - Intergenic
920208054 1:204307486-204307508 CAGAATTCCCCCAGCCTTCCAGG + Intronic
920402201 1:205682985-205683007 CAGCAATCCCTCAGCAAGCCTGG + Intergenic
1063687753 10:8254815-8254837 CAGAATTCCATGAAAGAGCCAGG + Intergenic
1064303436 10:14143702-14143724 GAGAATTGCCTGAACCAGCGAGG - Intronic
1068771776 10:60829637-60829659 CAGGATTTCTTGAACCAGCCTGG + Intergenic
1073170313 10:101501101-101501123 CAGAATTGCCTGAACCTGCGGGG + Intronic
1073541972 10:104322226-104322248 CAGAATTACTACAACCAACCAGG + Intronic
1074065911 10:110013477-110013499 AACATTTCCCTCAACCAGCTAGG + Intronic
1076675572 10:132145942-132145964 GAGACTTCCCTGACCCAGCCAGG - Intronic
1084015060 11:66373518-66373540 CAGACTTGCCATAACCAGCCTGG - Intergenic
1084281274 11:68096065-68096087 CAGAAATACCTCAACCTGGCCGG + Intronic
1086494372 11:87386931-87386953 CAGAAGCCCCTCCCCCAGCCAGG - Intergenic
1089785880 11:120906822-120906844 CAGAATTCCCAGAACAAGGCTGG - Intronic
1090479675 11:127057077-127057099 CAGAATAGCCTCCACCAGTCTGG - Intergenic
1090711071 11:129386055-129386077 AATAATACCCTCAATCAGCCAGG - Intronic
1097253427 12:57653456-57653478 CAGAATTGCTTGAACCTGCCAGG + Intergenic
1097937518 12:65270569-65270591 CAAAATACCCTCAACAGGCCAGG + Intergenic
1102457202 12:113078035-113078057 CAGAACAACCTCAACCGGCCCGG + Exonic
1103391562 12:120577771-120577793 CAGAACACCCTCATCCATCCAGG - Intergenic
1103881247 12:124167479-124167501 CAGTGTTCCCTCTTCCAGCCTGG + Intronic
1106507359 13:30382899-30382921 CAGATGGCCCTCAACCAGACTGG - Intergenic
1107241540 13:38240725-38240747 CAGAATTCCCTCAACAAGGGAGG + Intergenic
1115301684 14:31892554-31892576 CAGAAATCCCTAAACCTGCATGG - Intergenic
1119330944 14:73793186-73793208 AAAAATTCCCACAACCAGCCAGG + Intergenic
1120204733 14:81575235-81575257 CAGAATTCCCTGGACCATCTGGG + Intergenic
1122223852 14:100261003-100261025 CAGAAGTTCCTAGACCAGCCTGG - Intronic
1123692223 15:22847885-22847907 GAGAATTGCCTCAACCAGGGAGG - Intronic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126926554 15:53594565-53594587 AAAAATTCTATCAACCAGCCTGG + Intronic
1129071309 15:72953585-72953607 AAAAATTCCATCATCCAGCCAGG + Intergenic
1133034310 16:3026516-3026538 GAGAATTCCCTCATCCTGGCTGG + Exonic
1134198573 16:12178460-12178482 CAGATTTCGCAAAACCAGCCTGG + Intronic
1135752356 16:25067230-25067252 TAGAATTCCTCCAACCACCCAGG + Intergenic
1136224850 16:28853294-28853316 CAGAATTGCTTCAACCTGGCAGG - Intronic
1137371004 16:47905786-47905808 AAGAATTCCCTCTCCCAGGCAGG + Intergenic
1138733802 16:59227592-59227614 CAGTATCCCCTCTAGCAGCCTGG + Intergenic
1139472205 16:67184309-67184331 AAGAATTCCCTCAACCCTCGTGG + Intergenic
1139744965 16:69066970-69066992 CAGTATAGCCTCAACCACCCAGG + Intronic
1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG + Intergenic
1147585661 17:41652815-41652837 CAGAATTCCCACGCCCACCCTGG + Intergenic
1147987232 17:44313634-44313656 CTGATTTCCCTCTTCCAGCCTGG + Intronic
1148241225 17:46000550-46000572 AAGAATTCCCTCTTCCCGCCAGG - Intronic
1148815778 17:50326935-50326957 CAGAATACCCTCTTTCAGCCAGG - Intergenic
1148934817 17:51156595-51156617 AAGAATTGCTTGAACCAGCCAGG + Intronic
1149553258 17:57555487-57555509 CAGCAGCTCCTCAACCAGCCAGG + Intronic
1150022231 17:61628933-61628955 GAGAATTGCTTGAACCAGCCAGG - Intergenic
1151482026 17:74375322-74375344 CAAAATTGTTTCAACCAGCCTGG - Intergenic
1151748226 17:76022844-76022866 CAGAATGCCCTGCTCCAGCCGGG + Intronic
1152446681 17:80348948-80348970 CAGACTCCCTTCACCCAGCCAGG - Intronic
1152554594 17:81046608-81046630 CAGAAGTCCCCCAACCCCCCTGG + Intronic
1156214047 18:34977850-34977872 CAGAAATCCCACAAAGAGCCAGG + Intronic
1156447770 18:37249768-37249790 CATAATTTCCTCACCCAGCTCGG - Intronic
1161934136 19:7360879-7360901 CAGAGTCCCTCCAACCAGCCCGG + Intronic
1162324564 19:9991474-9991496 CAACATTCCCTAAGCCAGCCCGG - Intronic
1162525341 19:11203370-11203392 CAGAGTTCCCTCAACCCCCAGGG + Intronic
1162919506 19:13892118-13892140 GAGACTTCCCTTGACCAGCCTGG - Intronic
1163677228 19:18661142-18661164 CAGCAGTCACTCAACCACCCAGG - Intronic
1163859056 19:19731277-19731299 AAGAATACCCACAATCAGCCAGG + Intronic
1167024405 19:46904758-46904780 CGGAATTCCCTTCTCCAGCCCGG + Intergenic
1202704853 1_KI270713v1_random:15114-15136 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
925854889 2:8119665-8119687 CAGATTTCCCTGAATCAGGCAGG - Intergenic
925997864 2:9306679-9306701 GACAATTCCCTCAGCGAGCCAGG - Intronic
931241266 2:60454384-60454406 CAGAGTTCTCTCAACCTGCTTGG - Intronic
931372455 2:61676488-61676510 CAAAATTCACTCAACTGGCCAGG - Intergenic
934686633 2:96326220-96326242 CAGAAAGCCCTGAACCTGCCTGG - Exonic
935050077 2:99517880-99517902 CACACTTCCCTCAGCCAGCCTGG + Intergenic
940712560 2:157179922-157179944 CAGACTTCTCTCAGCCATCCTGG + Intergenic
940857781 2:158743003-158743025 CAGAATTCAGTCAACAACCCCGG - Intergenic
943364877 2:186959212-186959234 GAGAATTGCCTCAACCCGCGAGG + Intergenic
946389278 2:219405633-219405655 CAGACTGCCCCCAACCGGCCTGG - Intergenic
946787113 2:223259126-223259148 CAGACTCCCCTCCCCCAGCCAGG + Intergenic
1170581346 20:17701780-17701802 GAAAACTCCCTCAACCAGCCTGG - Intronic
1170748410 20:19121490-19121512 CAGAATTGCCTCCACCAGGATGG - Intergenic
1173004249 20:39127397-39127419 CAGTACTCCCTCAACCACCCTGG + Intergenic
1174515298 20:51087492-51087514 CACACTTCCCTCAACCAGGCTGG - Intergenic
1178810811 21:35879326-35879348 CAGACGTCCCTCTCCCAGCCAGG + Intronic
1179265646 21:39800256-39800278 GAGAATTTCCTAAAACAGCCAGG - Intronic
1179543637 21:42100463-42100485 CAGAAAGCCCTCAAGCACCCCGG + Intronic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG + Intergenic
1182760285 22:32717244-32717266 CAGACTTCCCTGAAGCAGGCAGG - Intronic
1184452386 22:44590853-44590875 GACAATTACCTCCACCAGCCTGG - Intergenic
950099369 3:10347664-10347686 CATAGTTCCCTCAGTCAGCCTGG + Intronic
951678685 3:25271930-25271952 CAGAACTCTCCCAACCAGGCAGG - Intronic
952160001 3:30683905-30683927 CAGAAAGCCCTCTGCCAGCCAGG - Intronic
952625888 3:35402919-35402941 CAGCATGCCCTCAACCAGTCTGG - Intergenic
953557540 3:43958579-43958601 CAGAACCCCCTCTCCCAGCCCGG - Intergenic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954420430 3:50416239-50416261 CAAAATTCCCTCTACCCTCCAGG - Intronic
955314022 3:57920306-57920328 CAACATTCCCACAACAAGCCTGG - Intronic
956476044 3:69621404-69621426 CAGCATTCCCTTAGCCATCCTGG - Intergenic
957790444 3:84933601-84933623 GTGAATTCCCACAACCACCCTGG - Intergenic
959413956 3:106061471-106061493 CAGCATTCCCTTAACCACCTTGG - Intergenic
960101624 3:113747860-113747882 CACTCTTCCCTAAACCAGCCTGG - Intronic
968295792 3:197575574-197575596 CAGACCTCCCTCAGCCAGGCTGG - Intergenic
968635200 4:1674902-1674924 CAGACTTCCCTCACGCAGACTGG - Intronic
979351777 4:119651678-119651700 AAGTATTCCCTCAACAGGCCAGG - Intergenic
980223371 4:129948227-129948249 GGGAATTCCCTCCACTAGCCAGG - Intergenic
981436906 4:144734859-144734881 CAGAAGTCCCCCTCCCAGCCTGG - Exonic
981655936 4:147112365-147112387 CAGATGTCCCTCCCCCAGCCAGG - Intergenic
983405446 4:167323732-167323754 CAGGATTCCTTCAAACAGTCAGG - Intergenic
983531358 4:168812960-168812982 CAGCATTCTTTCAAACAGCCTGG - Intronic
985955652 5:3263608-3263630 CAGAAATCCCTCCACCTTCCTGG + Intergenic
987949796 5:24660452-24660474 CAGACATCCCTCCCCCAGCCAGG + Intergenic
993823812 5:92655872-92655894 CAGAGTTCCCCCAACCAACCTGG + Intergenic
994496336 5:100517843-100517865 CTGGATTCCCTGAACCAGCCTGG + Intergenic
995677674 5:114681469-114681491 CAGAATTCCCTGATGGAGCCTGG + Intergenic
995678160 5:114686439-114686461 CAGAATTCCCTGATGGAGCCTGG - Intergenic
995874691 5:116778174-116778196 CAGAACTCCCACAGCCAGCCGGG + Intergenic
997005693 5:129814034-129814056 CTGAAGTCCCACATCCAGCCAGG - Intergenic
999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG + Intergenic
1000497116 5:161998331-161998353 TAGAATTCCCACAACCATCTTGG + Intergenic
1001552915 5:172617422-172617444 CAGAATTTCCTAACTCAGCCAGG + Intergenic
1001930771 5:175671342-175671364 CAGAAGTCCTGCAACCAGCTGGG - Intronic
1002173186 5:177386477-177386499 CAGGATCCCCACCACCAGCCCGG - Exonic
1003432554 6:6053232-6053254 CAGAATTCCAAATACCAGCCAGG - Intergenic
1006406097 6:33845975-33845997 CAGAATTCCCTTAATCATACGGG - Intergenic
1007716287 6:43858058-43858080 CAAAGTTCACTCATCCAGCCAGG + Intergenic
1007965923 6:46003690-46003712 CAGTGTTCCCTTAACCAGACTGG + Intronic
1010664122 6:78607048-78607070 GAGAAGTCCCACAACCAGGCAGG + Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1013390247 6:109679260-109679282 CAGACTCCCCTCCCCCAGCCAGG - Intronic
1013667864 6:112366651-112366673 AAGAAGGCCCTCCACCAGCCAGG - Intergenic
1016646027 6:146409314-146409336 CTGAATTCCCTCAACCCACAGGG + Intronic
1017921093 6:158872697-158872719 CAGAATTCTGTCACCCAGGCTGG + Intronic
1023351004 7:39320204-39320226 CAGAGTTCCCTCAACCACCGTGG + Intronic
1024329219 7:48139751-48139773 CAGATTTTGCTCAGCCAGCCAGG - Intergenic
1024598266 7:50958029-50958051 CAGATTTCCCGCAATGAGCCAGG - Intergenic
1025249228 7:57340944-57340966 CAGAATGCCTTCAACAAGCTGGG + Intergenic
1025741756 7:64203406-64203428 CAGAAGTCCCTGAAACAGGCTGG - Intronic
1025746223 7:64245320-64245342 CAGAAGTCCCTGAAACAGGCCGG - Intronic
1028738302 7:94243435-94243457 CAGAAAACCTCCAACCAGCCTGG + Intergenic
1029274312 7:99395142-99395164 CAAAAGTTCCACAACCAGCCTGG - Exonic
1029562655 7:101313423-101313445 CAGAATTGCCTGAACCCGCGAGG - Intronic
1029946021 7:104533883-104533905 GAAAACTCCCTCAACCACCCAGG + Intronic
1032100046 7:128967890-128967912 CAGAAGTCCATCAACATGCCTGG + Intronic
1032283765 7:130526363-130526385 CATATTTCTCTCAACCACCCAGG - Intronic
1032284498 7:130530606-130530628 CATATTTCTCTCAACCACCCAGG - Intronic
1033405790 7:141071300-141071322 CTGCAGTCCCTCGACCAGCCGGG + Intergenic
1034023294 7:147669545-147669567 AAGAATTCCCACATCCAGCTTGG - Intronic
1034269139 7:149795238-149795260 CAGACTCCCCTCAGCCAGTCCGG - Intergenic
1034735669 7:153427181-153427203 CAGAATTTCCCAAACCTGCCTGG + Intergenic
1035666967 8:1386479-1386501 CAGAATTCCCTCCAGAATCCTGG + Intergenic
1036642697 8:10593996-10594018 CTGAATTCCCACAACCACCAAGG + Intergenic
1036940143 8:13043981-13044003 CAGAATTCTATAAACCAGCTGGG - Intergenic
1038229933 8:25690407-25690429 CAGCACTCCCTCACCCAGCCTGG - Intergenic
1039459411 8:37730882-37730904 CACCATTCACTCAACCATCCAGG - Intergenic
1039527891 8:38232131-38232153 CAGACTTACCTCAGCCACCCTGG - Intronic
1042632358 8:70832209-70832231 CAGTATGCCCTCATCTAGCCTGG - Intergenic
1044758805 8:95495065-95495087 TAGAATTCCCTCAGACAGCATGG + Intergenic
1049137550 8:140917296-140917318 CAGAACTGCTTGAACCAGCCTGG + Intronic
1051542003 9:18230328-18230350 CAGAATTCCCTAAAACTTCCAGG - Intergenic
1052398502 9:27971470-27971492 AAGAATTGCTTGAACCAGCCAGG - Intronic
1057034966 9:91805317-91805339 CAGCATTCCTTCTCCCAGCCTGG + Intronic
1057988192 9:99739551-99739573 CAAAACACCCTCAATCAGCCTGG + Intergenic
1058912412 9:109533439-109533461 CAGAAAACCCTAAACCGGCCAGG - Intergenic
1059786438 9:117591338-117591360 CAGATTTCCCTGAACCCTCCAGG - Intergenic
1060042005 9:120308115-120308137 CAGAATACCCTGATCCAGGCTGG - Intergenic
1062091096 9:134679286-134679308 CACAGTACCCCCAACCAGCCCGG - Intronic
1188539697 X:31235978-31236000 CTCAATTCCCTGATCCAGCCAGG + Intronic
1188846361 X:35076988-35077010 CAGAACTCCCTTAGCCACCCTGG + Intergenic
1189091600 X:38089165-38089187 CAGCATTCTCTCAGCCAGTCTGG - Intronic
1190537840 X:51447098-51447120 CAGAACTCCCTTAGCCACCCTGG + Intergenic
1190622261 X:52299135-52299157 CAGACGTCCCTCCCCCAGCCAGG - Intergenic
1193490761 X:82145068-82145090 CAATATTCCCTCAGCCAGGCTGG + Intergenic
1195747370 X:108132192-108132214 AAGAGTTCCAACAACCAGCCAGG - Intronic
1197661601 X:129179446-129179468 CAGAATCCCCTTAGCCACCCTGG + Intergenic
1198073633 X:133173982-133174004 CGGAATTAGCTGAACCAGCCTGG - Intergenic
1200184525 X:154173572-154173594 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200190177 X:154210710-154210732 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200195930 X:154248512-154248534 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200201584 X:154285630-154285652 CAGAAGTGTTTCAACCAGCCAGG - Intronic