ID: 954407556

View in Genome Browser
Species Human (GRCh38)
Location 3:50353910-50353932
Sequence CAGAGAAAGGGGAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1261
Summary {0: 1, 1: 0, 2: 14, 3: 124, 4: 1122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954407556_954407568 22 Left 954407556 3:50353910-50353932 CCCATTTCCTTCCCCTTTCTCTG 0: 1
1: 0
2: 14
3: 124
4: 1122
Right 954407568 3:50353955-50353977 TCATGTGTCTGGATGAAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 196
954407556_954407569 23 Left 954407556 3:50353910-50353932 CCCATTTCCTTCCCCTTTCTCTG 0: 1
1: 0
2: 14
3: 124
4: 1122
Right 954407569 3:50353956-50353978 CATGTGTCTGGATGAAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 251
954407556_954407567 21 Left 954407556 3:50353910-50353932 CCCATTTCCTTCCCCTTTCTCTG 0: 1
1: 0
2: 14
3: 124
4: 1122
Right 954407567 3:50353954-50353976 ATCATGTGTCTGGATGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 178
954407556_954407563 -3 Left 954407556 3:50353910-50353932 CCCATTTCCTTCCCCTTTCTCTG 0: 1
1: 0
2: 14
3: 124
4: 1122
Right 954407563 3:50353930-50353952 CTGTCATCCCAGAGGAACATAGG 0: 1
1: 0
2: 0
3: 14
4: 151
954407556_954407566 11 Left 954407556 3:50353910-50353932 CCCATTTCCTTCCCCTTTCTCTG 0: 1
1: 0
2: 14
3: 124
4: 1122
Right 954407566 3:50353944-50353966 GAACATAGGCATCATGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954407556 Original CRISPR CAGAGAAAGGGGAAGGAAAT GGG (reversed) Exonic
900141481 1:1140991-1141013 CAGACAAAGGTGCGGGAAATGGG + Intergenic
900324550 1:2102044-2102066 AGGAGACAGGGGATGGAAATTGG - Intronic
900491778 1:2952896-2952918 GAGAGAGAGGGGCTGGAAATGGG - Intergenic
900743756 1:4346171-4346193 CAGGGAGAGAGGAAGGAAAGAGG - Intergenic
901456897 1:9368236-9368258 CAGAGAGAGGGGACTGAAACAGG - Exonic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902058710 1:13623688-13623710 CAGAGTCAGGGGAAGAAAAGTGG - Intergenic
902098514 1:13966134-13966156 CAGAGGAAGGGGAGAGAAATAGG - Intergenic
902376781 1:16033582-16033604 CAGAGAAAGGGGGTGGAGGTGGG - Intronic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902634881 1:17728697-17728719 CAGAGGCAGGGGATGGAAGTAGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902821602 1:18946745-18946767 CAGAGGCAGGGGAGGGAACTGGG - Intronic
902843198 1:19088633-19088655 CAGAGTAGGAGGAAGGAACTAGG - Intronic
902906002 1:19557849-19557871 AAGGGGAAGGGGAAGGGAATGGG - Intergenic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903275462 1:22218614-22218636 CAGAGAAGTAGGAGGGAAATGGG - Intergenic
903331791 1:22600338-22600360 AGGAGAAAGGAGAAGGAAGTGGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
904356894 1:29946183-29946205 CAGAGAGATGGGGAGGGAATGGG + Intergenic
904439986 1:30524022-30524044 GAGTGAATGGGGAAGGAAAGGGG + Intergenic
904578330 1:31521005-31521027 CAGGCAAAGGGGAAGAAAAATGG + Intergenic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
905514959 1:38555850-38555872 GAGGGAAAGGGGAGGGAAAGAGG + Intergenic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
905709584 1:40089834-40089856 CTGGGGGAGGGGAAGGAAATGGG - Intronic
905772087 1:40644890-40644912 CACAGAAAGGGGAGGGAGAATGG + Intronic
905834792 1:41108377-41108399 CAGAGCAAGGGGAAGTCAAGTGG + Intronic
906277455 1:44527322-44527344 CAGATAACGGGGAAAGAAAAAGG - Intronic
906801703 1:48743493-48743515 CAGAGAAACAGGATGAAAATGGG + Intronic
907022286 1:51080000-51080022 GAGAGAAAAGGAAAGGAAAGGGG - Intergenic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907338137 1:53714015-53714037 TGGAGAAAGTGGAGGGAAATGGG - Intronic
907595093 1:55712491-55712513 CAGAGAAGGGGACAGGAAAAAGG - Intergenic
907999720 1:59668353-59668375 CAGGGCAAGGGGAGGGAAAGTGG + Intronic
908171117 1:61505490-61505512 TGGGGGAAGGGGAAGGAAATGGG + Intergenic
908600355 1:65732163-65732185 CAGAGAAAGGAGGAGCAAAAGGG - Intergenic
909062526 1:70895693-70895715 CAGAGAACAGGAAAGGAATTTGG + Intronic
909088041 1:71191205-71191227 CAGAGCAGGGTTAAGGAAATGGG - Intergenic
909230848 1:73087761-73087783 CAGAGACAGGGAAGGGGAATGGG - Intergenic
909928670 1:81469607-81469629 TAGATAAAAGGGAAAGAAATAGG - Intronic
910175226 1:84423052-84423074 CCTAGAAAGGGTGAGGAAATAGG + Intergenic
910210710 1:84789681-84789703 CAGTGATAGGGTAAGAAAATAGG - Intergenic
910349569 1:86280169-86280191 AAGAGAAATGGGAAAGAAAGTGG + Intergenic
910465446 1:87494222-87494244 AAGAGCAAGAGGAAAGAAATTGG + Intergenic
910927616 1:92412772-92412794 CAGAGAAAGGGAAAGGGATTTGG - Intergenic
910977366 1:92920918-92920940 GAGAGTAAGAGGAAGGAAAGAGG + Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912504728 1:110148705-110148727 CATGGAAAGGGGAAGGACTTTGG - Intergenic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
912920034 1:113857671-113857693 AAGAAAAAGGAGAGGGAAATTGG - Intronic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
914771661 1:150691626-150691648 AAGGGATAGGGGAAGGAAAAGGG - Intronic
914998045 1:152561822-152561844 TAGGGAAAGGGAAAGGGAATGGG - Intronic
915101001 1:153500015-153500037 AAGAGAAAAGGTAAGGAACTGGG + Intergenic
915122873 1:153642462-153642484 AAGAGAAAAGGGAAGGGAGTAGG - Intronic
915162396 1:153929729-153929751 GTGAGAAAGGGAAGGGAAATAGG - Exonic
915356010 1:155255464-155255486 TAGAGAAGGGGGATGGGAATGGG + Intronic
915532691 1:156512278-156512300 GAGAGAAATGGGAAGAAAATAGG - Intergenic
915579650 1:156805784-156805806 CAGAGAATGGGGAAGCAAGAGGG + Intergenic
916350450 1:163843710-163843732 CAAAGAAATGGGAAGTAAATGGG - Intergenic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
916997022 1:170312103-170312125 CAGAGAAAGGGGATTGGATTTGG + Intergenic
917000738 1:170355566-170355588 CAGAGAAAGAGAAGGAAAATAGG - Intergenic
917069757 1:171137511-171137533 AAAAGAAAGGGGTAGGAAAAAGG - Intergenic
917366700 1:174239322-174239344 CAGAGAAAGGGAGAGGAAAGTGG - Intronic
917508831 1:175652889-175652911 CACAGCAAGGGAAAGCAAATTGG + Intronic
918102931 1:181392106-181392128 CACAGAAAGGGTAAGGAATAGGG + Intergenic
918133071 1:181646025-181646047 CAGTGAGTGGGGAAGGAAAGAGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918168267 1:181971238-181971260 TAAAGAAATGGGAAGGACATTGG + Intergenic
918178536 1:182066340-182066362 CAGAGCATGGGGAAGAACATAGG - Intergenic
918184920 1:182118598-182118620 GAGAGAAAGGGGACGCAAAAAGG + Intergenic
918335849 1:183511981-183512003 TAGAGATAGGGGATGGGAATGGG + Intronic
918462049 1:184786871-184786893 CAGAGAAAGAGGAAGTAAAAGGG - Intergenic
919056945 1:192583031-192583053 GGGAGAAAGGGAAAGGAAAAGGG + Intergenic
919109898 1:193205806-193205828 AAGAAAAAAGTGAAGGAAATAGG + Intronic
919302556 1:195789579-195789601 CTGATCAAGGGAAAGGAAATTGG + Intergenic
919347377 1:196401649-196401671 AAGAGAAAAGGTAAGGAAAAGGG + Intronic
919425929 1:197430447-197430469 CAGAGAAATGGGATGGTAACTGG - Intronic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919509765 1:198447630-198447652 AAGGGAAAGGGAAAGGAAAGGGG - Intergenic
919694645 1:200561910-200561932 GAGAGGAAGGGGAAGCAAAAGGG + Intronic
919912534 1:202120604-202120626 AAGAGAAAAGGAAAGGAAGTTGG - Intergenic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920368985 1:205465460-205465482 AGGAGGAAAGGGAAGGAAATAGG - Intergenic
920542044 1:206786023-206786045 AAGTGAAAGGGGAGGGATATAGG + Intergenic
920597572 1:207288153-207288175 GAGAGAAAAGGGAAATAAATAGG + Intergenic
920758816 1:208761907-208761929 AAGAAAAGGAGGAAGGAAATAGG - Intergenic
921101738 1:211934445-211934467 CAGTGAAAGGAGAAAGGAATGGG - Intergenic
921396836 1:214677595-214677617 CAGAGAAGGGATATGGAAATAGG - Intergenic
921518527 1:216128908-216128930 CAGAGCCTGGGGAAGGAAATGGG - Intronic
921542555 1:216433971-216433993 CAGATAACAGGGAAGGAAATGGG + Intergenic
921548718 1:216506484-216506506 GAAAGAAAGGGAAAGGAAAGGGG + Exonic
921714447 1:218403353-218403375 CATATATAGGGGAAGGAGATGGG + Intronic
921729082 1:218556487-218556509 AAGAGAAGGGGGAAAGGAATGGG - Intergenic
921773223 1:219068215-219068237 AAGAGAGAGAGAAAGGAAATGGG - Intergenic
921940142 1:220830664-220830686 CTGAGAAAGGGGAAGTGACTTGG - Intergenic
922174688 1:223188219-223188241 CATTGACAAGGGAAGGAAATGGG + Intergenic
922434142 1:225586297-225586319 GAGAGGAGGGGGAAGGAAAAGGG + Intronic
922453085 1:225752282-225752304 CAGAACAGGGGGAAGAAAATGGG - Intergenic
922490614 1:226013631-226013653 CAGAGCCAGGGCAAGGAAAGGGG - Intergenic
922663386 1:227449011-227449033 CAGAGAATGGGGAAAGATAGTGG + Intergenic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
923563394 1:235058897-235058919 GAGAGAAAGAGGAAAGAAAGAGG + Intergenic
924197503 1:241623750-241623772 CAGAGCAAAGGGAATGAAAGAGG - Intronic
924222986 1:241897444-241897466 CATAGAAAGGGGACTGAAAGAGG + Intergenic
924328183 1:242916601-242916623 AAGAGAAAGGGAAAGGGAAAGGG + Intergenic
924428175 1:243972887-243972909 CACAGAAAGGGGGAGCAACTGGG + Intergenic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
924750958 1:246889252-246889274 AAGAGAAAAGAAAAGGAAATAGG - Intronic
1063113679 10:3057849-3057871 CCGGGAAAGGGGGAGGAAAATGG + Intergenic
1063370886 10:5522333-5522355 CAGAGAAAGAGAAAGAATATTGG + Intergenic
1063799787 10:9561706-9561728 AAGAGAATAGGGAAGGAAAGTGG - Intergenic
1063886113 10:10580768-10580790 CAGAGAAAAGGGAATCAAAGTGG + Intergenic
1063901266 10:10734668-10734690 AAGAGAAAAGGGAAGGAAATAGG + Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1063960061 10:11299534-11299556 AAGAGAAAGGGCAAGGACAGGGG - Intronic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065031373 10:21589885-21589907 AAGGGAAAGGGAAAGGAAAGGGG - Intronic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065213029 10:23422919-23422941 GAGAGGAAGGGAAAGGAAAGGGG + Intergenic
1065265128 10:23966688-23966710 CAGAGAAAGAGGAAGAAGACTGG + Intronic
1065321859 10:24517546-24517568 GAGGGAGAGGGGAAGGAAAGAGG - Intronic
1065360026 10:24880920-24880942 GAAAGAAAGGGGAAAGAAAGAGG - Intronic
1065694840 10:28370250-28370272 GAGAGAAAGAGAAAGGAAAGAGG + Intergenic
1065745385 10:28836419-28836441 GAGAGAAAGGGAAAGAAAAAAGG - Intergenic
1065745392 10:28836457-28836479 GAGAGAAAGGGAAAGAAAAAAGG - Intergenic
1066720384 10:38331291-38331313 AAGAGAAAGGGAAAGGGAAAGGG - Intergenic
1067050853 10:43019455-43019477 AAGAGAAAGGGAAAGGGAAAGGG + Intergenic
1067355538 10:45521868-45521890 CAGAGAAAGAAAAAGTAAATGGG - Intronic
1067997849 10:51295625-51295647 AAGAGGAAAGGAAAGGAAATCGG - Intronic
1068262459 10:54600256-54600278 AGGAGAAAGTGGGAGGAAATGGG + Intronic
1068492537 10:57742084-57742106 CAGAGATAGGGAAAGGAAAAGGG - Intergenic
1069854373 10:71431732-71431754 TAGAGCAGGGGGAAGGAAAAGGG - Intronic
1069879126 10:71580851-71580873 CAGAGAAAGGGGTAGGAATGGGG - Intronic
1070068227 10:73059179-73059201 CATAGAAAAAGGAAGGGAATAGG + Intronic
1071136736 10:82462321-82462343 CAGAGACAGAAGAAGAAAATGGG - Intronic
1071193455 10:83129074-83129096 CAAAGAAAGGGAAAGCATATTGG + Intergenic
1071660916 10:87502032-87502054 GAGAGAAATGGGAAAGTAATGGG - Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072411210 10:95203676-95203698 CAGATAAAGAGGAATGATATTGG - Intronic
1072591316 10:96831360-96831382 AGGAGAAAGGGAAAAGAAATGGG - Intergenic
1073002036 10:100293068-100293090 CCCTGAAAGGGAAAGGAAATAGG + Exonic
1073072265 10:100802191-100802213 CAGAGAATGGGGAAGAATACTGG + Intronic
1073314299 10:102567644-102567666 AAGAGAAAAGGGAGGGAATTCGG + Intronic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1074087786 10:110221819-110221841 GGGAGAAAGGGAAAGGACATGGG - Intronic
1074224466 10:111470439-111470461 CAGAGATGGGGGCAGGACATAGG - Intergenic
1074356402 10:112788941-112788963 CAAAGGAAGAGGGAGGAAATTGG - Intronic
1074360147 10:112819421-112819443 CAGCCAAAGGGGAAGGCAAGTGG - Intergenic
1074785283 10:116834029-116834051 CAGGCAAAGGGGAAGGACTTGGG + Intergenic
1074866739 10:117548341-117548363 CCGAGAAAGGGAGAGGGAATCGG + Exonic
1075531998 10:123237449-123237471 CAGAGAAATGGAAAGAAAATGGG + Intergenic
1075807577 10:125201298-125201320 GAGAGAAAGAGGAAGGACCTGGG + Intergenic
1075990312 10:126832620-126832642 AAGAGAAAGGGGGAGCAAAAGGG - Intergenic
1076640317 10:131911530-131911552 CAGGGAAAAGGGAAAGAAAAAGG - Intronic
1076666815 10:132097917-132097939 AAGGGGAAGGGGAAGGAAAGGGG - Intergenic
1077003200 11:335703-335725 GAGAAAATGGGGCAGGAAATAGG - Intergenic
1077075711 11:701033-701055 AAGGGCAAGGGGAAGGAAAGGGG - Intronic
1077948196 11:6925904-6925926 GAGAGAAAATAGAAGGAAATGGG - Intergenic
1078050534 11:7961752-7961774 CAGAGAGAGGGGAAAGGAAAGGG + Intronic
1078317054 11:10303069-10303091 AAGTGAAAGGAAAAGGAAATGGG + Intergenic
1078391430 11:10938607-10938629 AAGAGGAAGGGGAAGGAGATGGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078580524 11:12536232-12536254 GGGAGAAAGTGGAAGGACATGGG - Intergenic
1078766237 11:14301117-14301139 TATAGAAAGGGGAAGGGAAAAGG + Intronic
1078953191 11:16159009-16159031 CAAAGAAAGGAGATGGAAAATGG - Intronic
1079477863 11:20850012-20850034 TAGAAAGAGGGGAAGGAATTTGG + Intronic
1080062773 11:27974518-27974540 CAGAGGAAGGTAAAGGAGATTGG - Intergenic
1080141233 11:28922798-28922820 CAGATAAGGGGGAAGCAAACTGG - Intergenic
1080956319 11:37099879-37099901 GAGAAAAAAGGGAAGGAAGTAGG - Intergenic
1081207743 11:40294117-40294139 CAGAGAAAGGGAAAGGAAAAGGG - Intronic
1081335070 11:41855377-41855399 AAGAAAAAGGGACAGGAAATTGG + Intergenic
1081351092 11:42053084-42053106 CAAAGAAGGAGGAAGGAAGTGGG - Intergenic
1081408222 11:42722990-42723012 AGGACAAAAGGGAAGGAAATAGG + Intergenic
1081492000 11:43576541-43576563 AAGAGAAAGTGGATGGAAAGAGG - Intronic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1082103577 11:48195174-48195196 CAAAGAAAGGGAGAGAAAATGGG + Intergenic
1082984601 11:59157741-59157763 GGGGCAAAGGGGAAGGAAATTGG - Intergenic
1083022544 11:59521681-59521703 AAGAGAAAGGGAAAGGGAAGGGG + Intergenic
1083141847 11:60728702-60728724 GAGAGAGAGGGAAAGGAAAAGGG - Intergenic
1083190706 11:61050068-61050090 AACTGGAAGGGGAAGGAAATGGG - Intergenic
1084549121 11:69830555-69830577 CAGGGAGAGGGAAAGGAAAGGGG - Intergenic
1084732000 11:71079815-71079837 AAGAGAAAGGGAAAGGGAAAGGG + Intronic
1084885481 11:72203062-72203084 CAGAGCCAGGGGAAAGAAAAAGG + Intergenic
1085095318 11:73755738-73755760 CCAAGAAGGGGGAAGGAAATGGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1085542603 11:77286493-77286515 CAAGGAAAGGGGTAGGAAATGGG - Intronic
1085583826 11:77681430-77681452 CAGGGAAGAGGGAAGGAAAGGGG - Intronic
1086477133 11:87189127-87189149 AAGGGAAAGGGAAAGGAAAAGGG - Intronic
1086507809 11:87524220-87524242 CAGGGAAGGGGCTAGGAAATGGG - Intergenic
1087223723 11:95574696-95574718 AATAGAAAGGGGCAGGAAATTGG - Intergenic
1087240792 11:95775522-95775544 CAGATAATGGGAAAGGAGATGGG - Intronic
1087393953 11:97573174-97573196 GAGAGAAAGGGAAAAGAATTGGG + Intergenic
1087726664 11:101725914-101725936 GAGAGGAAAGGGAGGGAAATAGG + Intronic
1087846228 11:102976611-102976633 GAGAAAAAGGGAAAGGAAAAAGG - Intergenic
1088456676 11:110039995-110040017 CTGAGAAAGGGAAATGAAAAAGG + Intergenic
1089119073 11:116119102-116119124 CAGGGAGAAGGGAAGGAAAGGGG - Intergenic
1089324356 11:117647236-117647258 CAGCGTAAGGGCAAGGGAATGGG - Intronic
1089772660 11:120814839-120814861 AAGAAAAAGGGAAAGAAAATGGG - Intronic
1089991532 11:122865638-122865660 CATAGAAAATGGAAAGAAATTGG - Intronic
1090071414 11:123547597-123547619 AAGAGAGAGGGGAAGCAAAAGGG - Intronic
1090118169 11:123996852-123996874 CAGAGGATGTGGAAGGAAATAGG + Intergenic
1090183801 11:124722882-124722904 CAGAGAAAGGGCAAAGACAAAGG - Intergenic
1090271659 11:125390099-125390121 CCAGGAAAGGGAAAGGAAATGGG + Intronic
1091192451 11:133706914-133706936 AAGGGAAAGGGAAAGGAAAAGGG + Intergenic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1091416841 12:295254-295276 AGGAGAAAGGGGAAGGAAAAAGG + Intronic
1091609244 12:1989412-1989434 AAGGGAAAGGGAAAGGAAAGGGG + Intronic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1092253312 12:6913447-6913469 CAGAGATGGGGGAAGAAAAGAGG + Intronic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1093150755 12:15618315-15618337 CAGAGCAAAGGGAAGGGATTAGG - Intergenic
1093534830 12:20210309-20210331 GAGAGAAAGGGGAAGGGAAGGGG - Intergenic
1093566456 12:20610889-20610911 CAGGGGAAGGGTCAGGAAATGGG + Intronic
1093746101 12:22742413-22742435 GAGAGAAAGGGGCAGCCAATTGG + Intergenic
1094564100 12:31584228-31584250 GAGAGAAAGGGAAAGAAAAGGGG - Intronic
1095044283 12:37483105-37483127 CAGAGGAAGCAGAAGGCAATGGG + Intergenic
1095429650 12:42119440-42119462 AAGAGAAAGGGAAAGGCAAAGGG + Intronic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1095531966 12:43198396-43198418 GAAAGAAAGGGAAAGGAAAAGGG + Intergenic
1096115822 12:49054498-49054520 AGGAGAATGGGGCAGGAAATGGG - Intronic
1096249367 12:50018532-50018554 CAGAAACAGGGGCAGGACATTGG + Intronic
1096396299 12:51269412-51269434 GAGAAAAAGGGGAAGGGACTTGG - Intronic
1096662878 12:53139769-53139791 CAGGGATAGGGGAGGGAGATGGG - Intergenic
1097087659 12:56480399-56480421 CAGAGAATGGGGAGGAAAGTGGG + Intronic
1097210029 12:57360657-57360679 AAGAGGAAAGGGAAGGAAAAAGG + Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1097704754 12:62856373-62856395 CTGAAAGATGGGAAGGAAATGGG - Intronic
1097742054 12:63254675-63254697 AAAAAAAAGAGGAAGGAAATTGG - Intergenic
1097988443 12:65808924-65808946 CTGAGAAAGAGGATGGAACTGGG - Intergenic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1098243404 12:68490795-68490817 CAGAGAAAGGGCATGGATCTGGG + Intergenic
1098370166 12:69750280-69750302 CAGGGAGAGAGGAAGGGAATGGG - Intronic
1098474943 12:70889866-70889888 CAGTGAAACGGCATGGAAATGGG - Intronic
1098475948 12:70903100-70903122 CAGGGAATGGGGAAGGAATGAGG + Intronic
1099070621 12:78041989-78042011 CAGAGAAAAAGGAAGTAGATGGG - Intronic
1099420289 12:82449881-82449903 AAGGGAAATGGGAAAGAAATTGG - Intronic
1099493868 12:83320395-83320417 GAGAGAAAGAGGAAGGTAACTGG - Intergenic
1099539433 12:83887899-83887921 CAAAGAGAGGGGAAGGAAATGGG - Intergenic
1099544806 12:83965201-83965223 CAAAGAAAGGGGAAGCAAACAGG + Intergenic
1099691520 12:85959406-85959428 GAGAGAAAGGGGAAGAGAAAAGG - Exonic
1099773280 12:87092385-87092407 CAGAGGAAGGCTGAGGAAATTGG - Intergenic
1099841198 12:87969693-87969715 AAGCGAAAAGGGAAGGTAATGGG + Intergenic
1100011318 12:89956990-89957012 GAAAGAAAGGGAAAGGAAAAGGG - Intergenic
1100491078 12:95078644-95078666 CAGAAAAAGGGAAAAGAGATTGG + Exonic
1100743536 12:97620867-97620889 AAGAGACTGGGGAAGGAACTTGG - Intergenic
1101247286 12:102896112-102896134 CAGAGCAGGGGGAAGCAAATGGG + Intronic
1101528931 12:105556924-105556946 CTGAGGTAGAGGAAGGAAATGGG - Intergenic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101995026 12:109519139-109519161 CAGAGACAGGGGAAAGGACTGGG - Intronic
1102040575 12:109798256-109798278 CCCAGAAAAGGGAAGGAACTGGG + Intronic
1102102240 12:110288880-110288902 AAGAGAAAGGGGAGGAAAACTGG - Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102573031 12:113839124-113839146 CAGAGCCAGGGGAGGGAACTGGG + Intronic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102766369 12:115437003-115437025 CAAAGCAAGGGGAAGGAAATAGG + Intergenic
1102902161 12:116647176-116647198 AAGGGAAGGGGGAAGGAAAGGGG - Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102981874 12:117248037-117248059 GAGAGAAAGAGAAAGGAAAGAGG - Intronic
1103006409 12:117423853-117423875 CAGAGAAAGGGGAAGAACAAAGG + Intronic
1103193633 12:119023754-119023776 CAAAGAAATGGGAGGGAAAATGG - Intronic
1103229906 12:119320693-119320715 CAGAGCAAGGTGAAGAAAAGTGG - Intergenic
1103793817 12:123490030-123490052 AGGAGAAAGGGGATGGAAAAGGG - Intronic
1103806217 12:123575221-123575243 AAGAGAAAGGGGAGGGGAAGTGG - Intergenic
1104010918 12:124929387-124929409 TAGGGAAAGGGGAAAGAAAGGGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104569911 12:129916125-129916147 CTCAGAAAGGGGAAGTAACTTGG - Intergenic
1104814528 12:131638112-131638134 CGGAGGAAGGGAAAGGGAATTGG + Intergenic
1104939456 12:132388039-132388061 CAGAGAGAGGGGAGGGAGATGGG + Intergenic
1104939492 12:132388224-132388246 CAGAGAGACGGGAGGGAGATGGG + Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105727299 13:23177207-23177229 CAGAGAATGGGGAGGGGAAGGGG + Intergenic
1106303508 13:28490499-28490521 TTGAGGGAGGGGAAGGAAATTGG - Intronic
1106742906 13:32665983-32666005 CAGAGACTGGGAAAGGAACTGGG + Intronic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1107607901 13:42079973-42079995 AAAAGAAAGTGGAAGGAAAATGG - Intronic
1107968060 13:45615189-45615211 GAGAGGTAGGGGAAGGAAACAGG + Intronic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108298053 13:49045040-49045062 AAGGGAAAGGGAAAGGAAAAGGG - Intronic
1108298058 13:49045058-49045080 AAGGGAAAGGGAAAGGAAAAGGG - Intronic
1108609561 13:52070797-52070819 TACAGCAAGGGGAAGGAAAAGGG + Intronic
1108778006 13:53790412-53790434 AGGAGGAAGGGGTAGGAAATGGG - Intergenic
1109151075 13:58847909-58847931 CATAGAACAGGGAAGGAAATAGG + Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1110331921 13:74282733-74282755 AATAGAAAGGGTAATGAAATAGG + Intergenic
1110789863 13:79575767-79575789 CAGAGAAATGGAAAGAGAATGGG + Intergenic
1110811427 13:79815191-79815213 AAGGGAAAGGGAAAGGAAAGAGG - Intergenic
1111293437 13:86198451-86198473 TAGAGAAAATGGAAAGAAATGGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1111667717 13:91290878-91290900 TACAGAAAGTGGAAGGAAAAAGG - Intergenic
1111971365 13:94920303-94920325 CAAAGAAAGGTCAAGGAATTTGG + Intergenic
1112532218 13:100216087-100216109 AAGGGAAAGGGGAAGGAGAGGGG - Intronic
1112794133 13:103036297-103036319 CAGAAAAATGGGAGGAAAATGGG + Intergenic
1112844680 13:103625549-103625571 CAGAGAAAGGAGAATGACTTTGG - Intergenic
1113035117 13:106039692-106039714 GAAAGAGAGTGGAAGGAAATGGG - Intergenic
1113077562 13:106482524-106482546 AAGTGAAAGAGGAAGGAAATTGG + Intergenic
1113084501 13:106554448-106554470 GAGAGGAAGGGGAAGGAAAAAGG + Intronic
1113884004 13:113647876-113647898 CAGAGAAAGGGAAGGAAATTAGG - Intergenic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114290921 14:21287641-21287663 CAGAGAAAAGGGATGGTCATCGG + Intergenic
1114359685 14:21958008-21958030 GAGAGAAAGAGAAAGGAACTTGG - Intergenic
1114642080 14:24230592-24230614 AAGAGAGAGGGGGAGAAAATAGG - Intronic
1114683709 14:24507919-24507941 CAGAGCAAGTGGAAGGAAAAGGG - Intronic
1114862319 14:26539614-26539636 GAGAGAAATGGGAAGAAAACAGG + Intronic
1115427215 14:33273932-33273954 CAGGGAAAGAGTTAGGAAATTGG - Intronic
1115726535 14:36223303-36223325 CAGAGGAAGGATAAGGAAAGAGG + Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1116422521 14:44749357-44749379 CATTGAAAGAGGAAGGACATGGG + Intergenic
1116726674 14:48569885-48569907 CAGAGAACCTGGAAGGATATGGG + Intergenic
1116806858 14:49502045-49502067 AATAGAAAGGGGAAGGAAGACGG + Intergenic
1117435689 14:55713304-55713326 CAGAAAAATGGGAATGACATGGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117833023 14:59772508-59772530 GGGAGAAAGAGGAAGGAATTGGG - Intronic
1118057549 14:62096956-62096978 CAGGGTAAGGGAAAGGAATTTGG - Intronic
1118089571 14:62458232-62458254 GAGAGAAAGAGGAAGGAAAGAGG + Intergenic
1118313938 14:64713757-64713779 CAGAGAAAAAAAAAGGAAATGGG - Intronic
1118343444 14:64915420-64915442 TAGGGAAAGGGGAGGGCAATAGG + Intronic
1118440406 14:65806651-65806673 CAGAGAGAAGGGAAGGAGTTGGG - Intergenic
1118533899 14:66737197-66737219 AAGAGGAAGGGGAAGGGAAAGGG - Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118893970 14:69930628-69930650 AAGAGAAAGGGTCAGGAAATGGG + Intronic
1119100115 14:71871721-71871743 CAAAAAAAGGGAAAGGAAAGAGG - Intergenic
1119235404 14:73015314-73015336 GAGGGAAGGGGGAAGGAAAGGGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119451243 14:74712853-74712875 CAGAGAGAGAGGGAGGAAAAGGG - Intronic
1119562162 14:75599204-75599226 CACAGCATGGGGGAGGAAATGGG - Intronic
1119771336 14:77221993-77222015 CAGGGTGAGGGGAAGGATATGGG - Intronic
1120038265 14:79723263-79723285 AAGACAAAGGGGACTGAAATGGG + Intronic
1120765878 14:88326134-88326156 CTGAGAAAGGAGAATGAAAGTGG - Intronic
1120873773 14:89360471-89360493 GAGAAAGAGGGGAAGGAAAGAGG + Intronic
1120941447 14:89954372-89954394 GAGAGAAAGGAGATGGAACTTGG + Intronic
1121593262 14:95137156-95137178 AAGAGGAAGGGGAAGGAAAAGGG + Intronic
1121593286 14:95137241-95137263 AAGAGAAAGGGGAAATAAAAAGG + Intronic
1121593317 14:95137346-95137368 AAGGGAAAGAGGAAGGAAAAGGG + Intronic
1121593367 14:95137500-95137522 AAGGGGAAGGGGAAGGAAAAGGG + Intronic
1121651383 14:95561464-95561486 TAGAGAGAGGGGCAGGAATTTGG + Intergenic
1121760299 14:96439290-96439312 TAGGGAAATGGGAAGGAATTAGG + Intronic
1121761043 14:96445357-96445379 CTGAGAAATGGGTAGAAAATAGG + Intronic
1121860190 14:97310070-97310092 GAAAGAAAGGGGAATGAAAAAGG - Intergenic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122251647 14:100444210-100444232 CCGTGAAAATGGAAGGAAATTGG + Intronic
1122298520 14:100718875-100718897 CAGAGAAAGGGCAAAGCTATAGG + Intergenic
1122358619 14:101142330-101142352 GAGAGACAGAGTAAGGAAATTGG - Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1124378910 15:29148133-29148155 CTGAGAGGTGGGAAGGAAATAGG + Intronic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125334919 15:38617565-38617587 AAAAGAAAGGGGAAAGAAAGAGG - Intergenic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125695577 15:41634592-41634614 CTCAGTAAGGGGAAGGAAAGGGG - Intronic
1126032288 15:44511077-44511099 CAGAGAATGAGGGAGGAAAGTGG - Intronic
1126238091 15:46409098-46409120 TGGAGAAAGGGGATGGAAAAAGG - Intergenic
1126508512 15:49437978-49438000 TAGAGAAGAGGGTAGGAAATGGG + Intronic
1126780896 15:52138069-52138091 AAGAGAGAGGGGAAGAAAAAGGG - Intronic
1126856160 15:52841401-52841423 CAGGGAAAGAGGAAGGAAAAGGG - Intergenic
1126887127 15:53163146-53163168 CAGAAGAAGGGGAAGAAATTGGG + Intergenic
1127308456 15:57730295-57730317 AAGAGAAAGGCGAGGGAGATTGG + Intronic
1127576649 15:60298360-60298382 GAAGGAAAGGAGAAGGAAATAGG + Intergenic
1127582709 15:60352232-60352254 GAGAGAAAGGTGAGGGAAAATGG + Intronic
1127903517 15:63358988-63359010 CTGAGAAAGGGCAGGGAAACGGG - Intronic
1128317137 15:66668068-66668090 CAGAGAAAGGGATAGGATAAGGG + Intronic
1128489453 15:68132899-68132921 CAGAGAATGGGATAAGAAATAGG - Intronic
1128756947 15:70189646-70189668 CACACAAAGGCCAAGGAAATGGG + Intergenic
1129061286 15:72862313-72862335 CAGAGAGATGGGAAGAAAATAGG - Intergenic
1129219070 15:74121004-74121026 GAGAGGAAGGGGAAGGGAAGAGG - Intronic
1129275447 15:74442429-74442451 CAGAGAAAGGTAGAGGAAAAGGG - Intergenic
1129521478 15:76189214-76189236 CAGAGAAAGAGAAAGGAGAGAGG + Intronic
1130090815 15:80819714-80819736 TAGAGAAAGAGGAAGGGAATGGG + Intronic
1130350488 15:83087082-83087104 CACAGAAAGGTTAAGTAAATTGG - Intergenic
1130642208 15:85688050-85688072 GAGAGAGAGAGGAAAGAAATAGG + Intronic
1130723796 15:86417610-86417632 CAGAGAAAGGGGACCTAATTTGG + Intronic
1130955335 15:88623400-88623422 AAGAGAAATGGGAAGGGGATGGG - Intronic
1131375270 15:91917933-91917955 CAGAGCACAGGGAATGAAATGGG + Intronic
1131441207 15:92461036-92461058 GAGAGAAAGGGGCATGAAATGGG + Intronic
1131441372 15:92462036-92462058 CAGAGAAAGTGCGAGGAAAGGGG + Intronic
1131457099 15:92590069-92590091 CAGAGAAGGGCAAAGCAAATCGG - Intergenic
1131583963 15:93673513-93673535 AGGAGGAAGGGGAAGGAAAAGGG - Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1132325756 15:100968769-100968791 GAAGGAAAGGGGAAGGAAAGGGG - Intronic
1132325760 15:100968780-100968802 AAGGGGAAGGGGAAGGAAAGGGG - Intronic
1132336701 15:101052569-101052591 GAGAGAATCGGGGAGGAAATAGG + Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133397070 16:5456661-5456683 CAAGGAAATGGGAAGAAAATGGG - Intergenic
1133489598 16:6254833-6254855 CAGAGAACAGGGCAGGAAAGAGG - Intronic
1134215578 16:12314468-12314490 CAGAGAAAGGCTAGGGAACTCGG - Intronic
1134342569 16:13358560-13358582 TAAAGGAAAGGGAAGGAAATGGG - Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135282975 16:21169303-21169325 CAGAAAAAGGGGAAAAAAAAAGG - Intronic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1135591769 16:23710306-23710328 CTGAGAAATTGGAAGGAATTTGG - Intronic
1135607776 16:23837743-23837765 CAGAGAAAGGGGAACTAAGGAGG - Intronic
1135618890 16:23936089-23936111 CAGAGAAGGGGGTGGGAAATGGG - Intronic
1135830455 16:25768396-25768418 CAGAGAGAGGGAAAGGAAGGGGG - Intronic
1135873562 16:26175711-26175733 CACAGAAAGGGGAAGGGAAGAGG - Intergenic
1135938745 16:26803026-26803048 AAGAGAAGGAGGAAGGAAAGAGG + Intergenic
1136088537 16:27902548-27902570 CAGAGCAAGGGGAGGGAGAGGGG + Intronic
1136115331 16:28090970-28090992 CCCAGGAAGGGGAAGGAACTGGG + Intergenic
1136250138 16:28999006-28999028 GGGAGAAAGGGAAAGGAAAAGGG - Intergenic
1137461755 16:48670984-48671006 CAGAGAAATGGTTAGGAAAGTGG + Intergenic
1137689709 16:50414414-50414436 GAGAGAAAGGGGAAGGGGAAGGG - Intergenic
1137927870 16:52558384-52558406 CAGAGAACTGGGAAGCCAATAGG + Intergenic
1137993413 16:53183407-53183429 GAGAGAAAGGGGAAGGAACAGGG + Intronic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138218546 16:55227414-55227436 CAGAGAAATAGGAAAGGAATAGG - Intergenic
1138276608 16:55739612-55739634 CAGGAAAAGGAGGAGGAAATTGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138437339 16:57010733-57010755 AAGAGAAATAGGAAGGCAATAGG - Intronic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139191505 16:64868613-64868635 CATGGAGAAGGGAAGGAAATAGG + Intergenic
1139800087 16:69515452-69515474 GAGAAAAAGGGGCAGGAGATAGG - Intergenic
1140153773 16:72401152-72401174 GAGAGAAAGGGAGAGGAAAAGGG + Intergenic
1140195945 16:72855518-72855540 CAGAGACAGAGGAACGAAAACGG + Intronic
1140345517 16:74209315-74209337 CAGACAAAGGAGAAAGAAAATGG + Intergenic
1140580320 16:76223759-76223781 CATAGAAAGGGGAAGGACTCTGG - Intergenic
1140655129 16:77132344-77132366 AAGGGGAAGGGGAAGGGAATGGG - Intergenic
1140655147 16:77132382-77132404 AAGAGGAAGGGGAAGGGGATGGG - Intergenic
1141212651 16:81995495-81995517 CAGGGAATGGGGAAGGAATGTGG - Exonic
1141478725 16:84292145-84292167 GAGAGAGAGAGGCAGGAAATGGG + Intergenic
1141623261 16:85248252-85248274 CAGAGAAGGGGAAAGGTAAAGGG - Intergenic
1141657207 16:85422611-85422633 GAGAGAAAGGGGCAGGAGAGAGG + Intergenic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142173683 16:88635306-88635328 GAGAGGAAGGGGGAGGGAATAGG - Intergenic
1142177426 16:88651513-88651535 CAGAGCCAGGGGGAGGAAATGGG - Intergenic
1142255062 16:89009735-89009757 CAGAGAAAGGGAAAAGAATCAGG + Intergenic
1142535872 17:617394-617416 AACAGAAAAGGAAAGGAAATAGG - Intronic
1142922297 17:3199836-3199858 GAGACTAAGGGGATGGAAATGGG + Intergenic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143644242 17:8219685-8219707 GCAAGAAAGGGGAAGGAAAGCGG + Intergenic
1144108522 17:12008852-12008874 AAGAGAAATAGGAAGGAATTTGG + Intergenic
1144497446 17:15757470-15757492 CAGAGAAAGTGGGAGAAACTCGG + Intergenic
1144629237 17:16861954-16861976 CAGAGAAAGTGGGAGAAACTCGG + Intergenic
1144652189 17:17014159-17014181 CAGAGAAAGTGGGAGAAACTCGG - Intergenic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1144759958 17:17701549-17701571 AAGAGAGAGGGGAGGGAAAGGGG - Intronic
1144833229 17:18143370-18143392 CAGAGAAAAGGGGAGGGAAAAGG - Intronic
1145029244 17:19492060-19492082 CAGAAATAGTGGCAGGAAATAGG + Intergenic
1145160808 17:20572520-20572542 CAGAGAAAGTGGGAGAAACTCGG + Intergenic
1145851690 17:28105179-28105201 CAGCTAAAGGGAAAGGAAACAGG + Intronic
1145922399 17:28620080-28620102 TAGAGAAAGGAGAAAGAAATGGG + Intronic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146694822 17:34900634-34900656 CACAGAAAGGGAAATGAAAATGG + Intergenic
1146784699 17:35709113-35709135 GAGAGAAAGAGGAAGGAAATAGG + Intronic
1146962655 17:36997261-36997283 CAAAGAAAGGGGAAGTTTATAGG + Intronic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147414496 17:40278739-40278761 TGGAGAAAGGGCAAGGAATTGGG + Exonic
1147535307 17:41316921-41316943 CAAAGAAAGGGAAATGAAAAGGG - Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148006399 17:44434298-44434320 AAGAAAAAGGGGAAAGAAAAAGG + Intronic
1148073336 17:44921377-44921399 AAGAGCAAGGGGAAGGGACTTGG - Intergenic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148742838 17:49902396-49902418 CAGAGAAAGGGGGAGGGCAGGGG - Intergenic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1148767157 17:50046124-50046146 AAGAGAAAGGGGAAGGGGAACGG + Intergenic
1148839529 17:50485853-50485875 CAGAGAAAGGGGAGAGAATTCGG + Exonic
1148952317 17:51324171-51324193 GAGAGAGAGGGGTAGGCAATTGG - Intergenic
1149050174 17:52295103-52295125 CAGGGAAGGGGGACAGAAATGGG + Intergenic
1149649591 17:58268599-58268621 CAGAGAAAGGGGAGGGGCAGGGG + Intergenic
1150007538 17:61479133-61479155 CAGAGACAGGGGTAGGGAATGGG + Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1150924145 17:69514988-69515010 CAGAAAAAGGCAAAGGAAAATGG - Intronic
1151154219 17:72113547-72113569 CAGAGACAGGAGAAGGGAATAGG + Intergenic
1151291566 17:73154342-73154364 AAGAGAAATGGGGAGAAAATTGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151459503 17:74246103-74246125 AGAAGGAAGGGGAAGGAAATGGG + Intronic
1151527286 17:74679405-74679427 CAGAGAAGGAGGAAGGATCTGGG - Intronic
1152059601 17:78060944-78060966 CAGAGAAAAGGCCAAGAAATAGG - Intronic
1152609266 17:81307555-81307577 CAGAGAAGGGGGAGGGGAAGAGG - Intergenic
1154492645 18:14933445-14933467 GAGAGCAAGGGGCAGGAAATTGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155619276 18:27758164-27758186 CAGAGAGAGTGGAAAAAAATGGG + Intergenic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156088843 18:33440890-33440912 AAGAGAAAGGGAAAGGCACTGGG - Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156418181 18:36921048-36921070 CAGAGAAAAGGTAAAAAAATTGG - Intronic
1156488334 18:37480867-37480889 GAAAGAAAGGAGGAGGAAATGGG + Intronic
1156546107 18:37965209-37965231 GAGAGAAAAGGGATGGAAAGGGG - Intergenic
1156580067 18:38364391-38364413 TAGAGAAATAGGAAGGAAGTTGG + Intergenic
1156658236 18:39312993-39313015 AAGAAAATGGGGAGGGAAATTGG + Intergenic
1156785158 18:40902935-40902957 GAGAGAAAGAGAGAGGAAATGGG + Intergenic
1156807712 18:41206325-41206347 CAGAAATATGGGAATGAAATAGG + Intergenic
1157006925 18:43594289-43594311 TAGAAAAAGAGGAAGGAAAATGG - Intergenic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157535253 18:48452941-48452963 CAAAGAAAGGGGAAGAAGAGAGG + Intergenic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158236564 18:55322396-55322418 CGGAGAAAGGGGAGGGAAAGGGG + Intronic
1158286132 18:55885380-55885402 CAGAAAATAGTGAAGGAAATGGG + Intergenic
1158288533 18:55912709-55912731 CAGAGAAAGGAGAAAGGAAAGGG - Intergenic
1158547134 18:58405873-58405895 AAAAGAAAAGGGAAGGAAATGGG + Intergenic
1159156465 18:64589546-64589568 CAGAGAAAGAGGAAGTAAATGGG + Intergenic
1159267665 18:66104357-66104379 AAAATAAAGGGGAAAGAAATTGG + Intergenic
1159367192 18:67483610-67483632 CAAAGAAAAGGGAAGGCAAAAGG - Intergenic
1159463715 18:68752407-68752429 CAGGGAAAGGGGAAGGGAAAAGG + Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160561603 18:79762018-79762040 CAAAGAAGTGGGAATGAAATGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161705263 19:5817533-5817555 AAAAGAAAGAGAAAGGAAATAGG + Intergenic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1161957949 19:7506691-7506713 CAGAGAAAGGGGGAGGAGCTTGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162189029 19:8930250-8930272 CAGACGACGGGGAAAGAAATGGG - Intronic
1162686189 19:12386491-12386513 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1162690508 19:12426029-12426051 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1162870874 19:13585699-13585721 CAGAGAATGGAAAAGAAAATAGG + Intronic
1162935415 19:13979307-13979329 CCGGGAAAGGGGAAGGATGTAGG + Intronic
1163072773 19:14858393-14858415 CAGAGAGAGATGAATGAAATAGG + Intergenic
1163238520 19:16043782-16043804 CAGAGCAAGGGCCCGGAAATGGG + Intergenic
1163565841 19:18050971-18050993 CAGGGAGGGAGGAAGGAAATAGG + Intergenic
1164524567 19:29003921-29003943 CAGAGAAAGGGGGTGGGGATGGG - Intergenic
1164698605 19:30265552-30265574 CACAGAAATGGGCAGGAACTGGG + Intronic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1164854519 19:31510836-31510858 CAGAGAAAGAGGAAGCACATGGG - Intergenic
1164882783 19:31749024-31749046 AAGAGAAAGAGGAACGAAGTGGG - Intergenic
1164914409 19:32039314-32039336 CAGAGTAATGGGCAGAAAATGGG - Intergenic
1165078384 19:33293628-33293650 CAGAGAAAGGGGGTGGGGATGGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165736483 19:38179596-38179618 CAAAAAAGGGAGAAGGAAATAGG - Intronic
1165850515 19:38847866-38847888 CAGTTAAAGGGCAAGGAATTTGG - Intronic
1165922301 19:39307038-39307060 GAGAGAAAGGAGAGGCAAATAGG + Exonic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166665671 19:44678822-44678844 GAAAGAGAGGGGAAGAAAATTGG - Intronic
1166856444 19:45784671-45784693 CCCAGACAGGGGAAGGAAGTTGG - Exonic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167526670 19:49988556-49988578 GAGAGAGAGGGGAAGGAAGGGGG - Intronic
1167703712 19:51065942-51065964 CGGGGTAGGGGGAAGGAAATGGG - Intergenic
1167775622 19:51552933-51552955 GAGAGAAAGGGGTAGGAGAGAGG + Intergenic
1167791955 19:51688761-51688783 CAGAGAAAGAGGATGGAGATAGG + Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
925369965 2:3337080-3337102 AAGAGAAAAGGGAAGGGAAAAGG + Intronic
925440763 2:3883339-3883361 CGGAGAAAGTGGGAGGAAAGGGG - Intergenic
925445363 2:3922647-3922669 AAGAGGAAGGGGAAGGAAAGAGG + Intergenic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
926479185 2:13367592-13367614 CAGAGAATGGGAATGGCAATAGG + Intergenic
926922027 2:17948345-17948367 CACAGAGAAGGGAAGAAAATTGG + Intronic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
927728866 2:25452134-25452156 AAGAGAAAGGGGCATGAAAAGGG - Intronic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
928001551 2:27527172-27527194 CAGAGTATGGGAAAGGGAATGGG + Intergenic
928142345 2:28740671-28740693 CAGAGGAAGTGGTAGGAAATAGG - Intergenic
928327158 2:30328462-30328484 CAGGGGAAGGGGATAGAAATGGG + Intergenic
928554424 2:32408619-32408641 TAGAAAAAGGGTAAGAAAATTGG - Intronic
928616229 2:33042432-33042454 CAGAGCAAAGGGAGAGAAATAGG + Intronic
929460531 2:42099675-42099697 GAGAGAAAGAGGAAGGAATTGGG - Intergenic
929481220 2:42310299-42310321 AAGGGAAAGGGGAAGGGAAAGGG - Intronic
930288555 2:49465433-49465455 AAGGGAAAGGGGAAGGGAAAGGG - Intergenic
930741031 2:54832658-54832680 CAAATAAAAGGGAAGGAAAGAGG + Intronic
930770054 2:55121696-55121718 CAGGGAAGGAGGAAGGAAAATGG + Intergenic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931077692 2:58734981-58735003 GAGAGAAGGAGGGAGGAAATAGG - Intergenic
931427107 2:62181234-62181256 CATATAAAAGTGAAGGAAATGGG + Intergenic
931443620 2:62308512-62308534 CTGAGAGAGAGGAAGGAAAAGGG + Intergenic
931502206 2:62881473-62881495 AAGGGGAAGGGGAAGGAAAAAGG + Intronic
931732337 2:65164383-65164405 CAGAGAGAAGGGAAGAAAATGGG + Intergenic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932770105 2:74496294-74496316 CAGAGAAAGGGGAGGAGAAAGGG - Intergenic
932947757 2:76257105-76257127 CTGAGAAAAGGGTAGGAATTGGG + Intergenic
933671901 2:85016209-85016231 CAGAGAAAGAGAAATGAAATAGG - Intronic
933787346 2:85854078-85854100 TAGAGAAAGAGGAAGGAATGGGG - Intronic
933950170 2:87322500-87322522 CAGAGAAAGTGGATAGAAATAGG - Intergenic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
935240493 2:101173935-101173957 CAAGAAAAAGGGAAGGAAATGGG + Intronic
935322780 2:101905448-101905470 TAGAGAAATGGGCAGGAGATAGG - Intergenic
935359662 2:102236751-102236773 CAGAGCAATGGGGAGGCAATGGG - Intronic
935586864 2:104808548-104808570 AAGAGACAGGGGAAGGATATTGG + Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
935660229 2:105460489-105460511 GAGGGAAAGGGGAAAGAAGTGGG + Intergenic
935815825 2:106844807-106844829 CAGAGAAAGGGTAACAAAAGGGG + Intronic
936034559 2:109100532-109100554 CCAAGAAAGAGGAAGGAAACAGG + Intergenic
936330018 2:111539097-111539119 CAGAGAAAGTGGATAGAAATAGG + Intergenic
936658158 2:114512289-114512311 ATGTGAAAGGTGAAGGAAATTGG - Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
937403606 2:121607338-121607360 CAAAAAAAGAGAAAGGAAATAGG + Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
938367742 2:130748199-130748221 CAGATAAAGTTCAAGGAAATTGG + Intergenic
938588056 2:132711200-132711222 GAGAGAAAGGGAAAGCACATGGG - Intronic
938648405 2:133354267-133354289 GAGAGAAAAGGGAAAGAAAAAGG - Intronic
938703879 2:133902887-133902909 CTGCGAAAGAGGAAGAAAATGGG + Intergenic
938732726 2:134158825-134158847 CAGATAAAGGGGAAGAGAAGGGG - Intronic
938980709 2:136523746-136523768 CAGAGGAAAGGGAAGCATATTGG + Intergenic
939339196 2:140871409-140871431 CAGAGAAAGGGAGAGAAAAAGGG + Intronic
939552765 2:143636120-143636142 CAGAGGAATGGGCTGGAAATGGG - Intronic
939669145 2:144988251-144988273 CAGAAAAAGAGAAAGAAAATAGG - Intergenic
939715138 2:145574528-145574550 CAGGGAAAGGGGAAAGGATTCGG + Intergenic
940247874 2:151638747-151638769 CACTGAAAGTGAAAGGAAATGGG + Intronic
940259546 2:151765802-151765824 CACAGAGTGGGGAAGGAGATGGG + Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940884107 2:158973931-158973953 CAGAGAGAGGGGAGTGTAATGGG - Intronic
940912767 2:159223723-159223745 CAAAGAGATGTGAAGGAAATTGG - Intronic
941040373 2:160614943-160614965 TAGAGAAAGGGAAGGAAAATAGG + Intergenic
941052803 2:160754047-160754069 TAGAGAAAGGAGAATGGAATGGG - Intergenic
941078472 2:161033088-161033110 AAGGGAAAGGGAAAGGAAAACGG + Intergenic
941215838 2:162707992-162708014 AAGAGAAATGGGAAGTAGATGGG - Intronic
941410811 2:165155386-165155408 AAGGGAAAGGGAAAGGGAATGGG - Intronic
941906740 2:170723805-170723827 TAAAGAAAGGGGAAACAAATGGG + Intergenic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942280368 2:174356622-174356644 AAGGGGAAGGGGAAGGAAAGAGG + Intronic
942761513 2:179404108-179404130 CAGAGGAAGGGGTAGGATATGGG - Intergenic
942948617 2:181697356-181697378 CAGGGATAGGGGAAGAAAAAAGG - Intergenic
943121034 2:183735967-183735989 TACAGAATGGGGAAGGAGATGGG - Intergenic
943265075 2:185719519-185719541 GAGAGAATGGGGAACAAAATGGG + Intergenic
943702044 2:190997077-190997099 CAGGGAGATGGGAAGGAAAGTGG - Intronic
943730332 2:191296172-191296194 CAGAGAAAGTGGAAGAATACAGG + Exonic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944036129 2:195296680-195296702 AAGAGAAAGGGAAAGGGAAAGGG + Intergenic
944564424 2:200973126-200973148 TAAAGAAAGGGAAAGGAAAAAGG + Intergenic
944641017 2:201725704-201725726 CAGAGATAGGTGAAGGACACAGG - Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945054144 2:205853369-205853391 TAGTGACAGGGAAAGGAAATAGG - Intergenic
945064980 2:205940743-205940765 CACAGAAATTGGAAGGAAAAGGG + Intergenic
945071939 2:205999481-205999503 CAGAGAGAGAGCAAGCAAATTGG - Exonic
945307073 2:208268759-208268781 AAGAGGAAGGGGAAGGAAAGAGG - Intronic
945372657 2:209038551-209038573 AAGAAAAAAGGAAAGGAAATTGG - Intergenic
945590916 2:211730449-211730471 TAGGGAAAGAGGAAGGAGATGGG - Intronic
945592352 2:211749149-211749171 CAAAGAATAGGGAGGGAAATAGG + Intronic
945823918 2:214697654-214697676 AAGGGAAAGGGGAAGGGAAATGG - Intergenic
945825060 2:214711716-214711738 CAGAGAAAGGGACAGTCAATGGG - Intergenic
946531798 2:220578321-220578343 TTGAGAAAGGGAAAGGAGATGGG + Intergenic
946541029 2:220684799-220684821 CAGAGAGATGGGATGGAACTAGG + Intergenic
946554944 2:220845932-220845954 AAGGGAAAGGGAAAGGAAAAGGG + Intergenic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
947006043 2:225512589-225512611 GAGAGGAAGGGAAAGGAAAGGGG - Intronic
947494610 2:230625759-230625781 GAGAGAGAGAGGAAGGAAAAGGG + Intergenic
947919970 2:233861726-233861748 TAGAGAAAGGACAAGGAACTTGG - Intergenic
948061504 2:235045921-235045943 CAGGGAGATGGGAAGGAAAAAGG + Intronic
948217235 2:236240760-236240782 CCAAGAATGGGGAAGGAAAAAGG - Intronic
948751811 2:240137447-240137469 GAGGGAAAGGAGAAGGAAAGGGG + Intergenic
949000866 2:241612089-241612111 GAGAGAAACGGCAAGGAAAGAGG + Intronic
1168912862 20:1463812-1463834 CAGCGACAGGGGATGCAAATGGG + Intronic
1169237321 20:3941362-3941384 CACAAAGAGGGGAAGGAAAAGGG + Intronic
1169373868 20:5050385-5050407 TAGAGAAGGGGGAAGGATAACGG - Intergenic
1169554623 20:6736195-6736217 CAGAGGAAAGGGAAGGAACTAGG - Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169655248 20:7915371-7915393 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1169720245 20:8668110-8668132 CAGATAAGTGGGAGGGAAATAGG + Intronic
1170131624 20:13026786-13026808 CAGAAAAAGGGCATGGGAATTGG - Intronic
1170341539 20:15333446-15333468 GAGAGAAAGGGGAAGAGAATTGG + Intronic
1170475877 20:16713998-16714020 CTGAGAAAAGGGAAGAACATCGG - Intergenic
1170588812 20:17755541-17755563 GAGAGATAGGGGAAGAAGATGGG + Intergenic
1170832980 20:19859449-19859471 CAAAGAAATGGGAGGAAAATGGG - Intergenic
1170848808 20:19985011-19985033 CAGTGAGAGGGGAAGGGACTTGG + Intronic
1171312445 20:24155589-24155611 CATAGAAATGGGAGGAAAATAGG + Intergenic
1171322942 20:24262369-24262391 GAGAGAAAGGGACAGGAAAAAGG - Intergenic
1171324010 20:24274866-24274888 CAGAGAATAGGGAGGGAATTGGG + Intergenic
1171937360 20:31287614-31287636 CAGAGGAAGGGGGATGAAAATGG + Intergenic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172339365 20:34144040-34144062 CAGAGAAAGGGAAAGATACTGGG - Intergenic
1172754575 20:37274097-37274119 GAGGGAAAGGAGAAGGAAAGAGG + Intergenic
1173123649 20:40316924-40316946 CAGAGAGAGGGAGAGGCAATGGG - Intergenic
1173161935 20:40659230-40659252 CACGGAAAGAGGAAAGAAATGGG + Intergenic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1173285217 20:41664705-41664727 TAGAGAAAGAGGAAGGAGAAAGG + Intergenic
1173759931 20:45550428-45550450 CAGAGAAAGGGGGAAGAGAGAGG + Intergenic
1173857164 20:46257892-46257914 CAGAGAGAAGGGGAGGAAAAGGG + Intronic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174572074 20:51509022-51509044 CAGGGGAAGGGGAAGGATAGGGG - Intronic
1174582104 20:51579385-51579407 CAGGGAAAGGGGAAGGACATTGG + Intergenic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1174719166 20:52792677-52792699 GAGACAAAGGGGAAGGGAAAGGG + Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175029219 20:55935529-55935551 AATGGAAAGGGGAAGAAAATTGG + Intergenic
1175472296 20:59239142-59239164 TGGAGAAAGGGGAAGAAAAATGG - Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176658889 21:9614799-9614821 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1177446322 21:21201140-21201162 CAAAGAAATGGGATGAAAATGGG - Intronic
1177821359 21:26034234-26034256 GAGAGAGAGGGGAAGGAAGGAGG - Intronic
1178070364 21:28958913-28958935 GAGAGAAAGAGGAAGGAAGAAGG + Intronic
1178367169 21:31997580-31997602 CAGAGAATGGGGATGTATATGGG + Intronic
1178522750 21:33300063-33300085 CAAAGAAAGGGGTAGCAACTTGG - Intergenic
1178624691 21:34204867-34204889 CAGAGACTGGGAAAGGAAACTGG - Intergenic
1178836869 21:36105527-36105549 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1178908469 21:36655132-36655154 CAGGGAGAGGGGATGGAATTGGG - Intergenic
1179169531 21:38962317-38962339 CAGAGAGAGGGGATGGATCTGGG - Intergenic
1179215862 21:39366810-39366832 AAGAGAAGGGGGAAGGGAAGGGG - Intergenic
1179287202 21:39987755-39987777 CTCAGCAAGGAGAAGGAAATAGG + Intergenic
1179288671 21:39999458-39999480 CAGAGAAAGATGAAGGAAATTGG + Intergenic
1179773074 21:43638856-43638878 CTGAAAAAGAGGAATGAAATGGG + Intronic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181532418 22:23524285-23524307 CCCAGAAAGGGGAAAGAGATGGG + Intergenic
1181979218 22:26754060-26754082 CAGAGGAAGTGGGATGAAATCGG - Intergenic
1182276844 22:29195297-29195319 CTCAGAAAGGGGAAGCAATTTGG + Intergenic
1182419612 22:30242518-30242540 CAGGGAAAGGGGAATTAACTTGG + Exonic
1182936306 22:34225332-34225354 CAGTGAGAGGAGAAGAAAATAGG + Intergenic
1182994928 22:34803274-34803296 CAGAGCAATGGGAAGATAATCGG - Intergenic
1183273715 22:36878130-36878152 CAGGGACAGAGCAAGGAAATGGG - Intergenic
1183694750 22:39415422-39415444 GGGAGAAAGGGAAAGGAATTGGG - Intronic
1183792962 22:40088805-40088827 GAGAGAAGGAGGAAGGAAATAGG + Intronic
1183795724 22:40115727-40115749 AAGGAAAAGGGGAAGGGAATAGG + Intronic
1183963940 22:41429987-41430009 CAAAAAAAGAGGAAGAAAATAGG - Intergenic
1184056737 22:42057128-42057150 AAGAGAAAGGGGCAGAATATTGG - Intronic
1185088033 22:48751193-48751215 TGGCGAAAGGGGCAGGAAATGGG - Intronic
949091868 3:38497-38519 CAGAGGAAGGGGACTGGAATGGG + Intergenic
949413942 3:3797218-3797240 CAGGGATGGGGGAAGGAATTTGG - Intronic
949448471 3:4161527-4161549 CATGGAAAGGGGAGGGAAAGTGG - Intronic
949836015 3:8270896-8270918 CAGAGAAAAGGTAAGTAACTTGG + Intergenic
949876772 3:8631361-8631383 CAGAGCAAGAGGAAGAAGATGGG - Intronic
949891524 3:8737088-8737110 AAGAGAGATGGGAAGGAAAAGGG + Intronic
950168423 3:10818780-10818802 CACAGAAAGGCCCAGGAAATGGG + Intronic
950232999 3:11293061-11293083 CAGAGAAAGGGGCAGAATTTAGG + Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG + Intronic
950850176 3:16054747-16054769 CAGATAAAGGAGAAAGAAAATGG - Intergenic
950951254 3:17002334-17002356 GAGAGAAAGGGGATCCAAATTGG - Intronic
951050821 3:18090650-18090672 TACAAAAAGGGAAAGGAAATAGG + Intronic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
951701723 3:25503599-25503621 TATAGAAATGGGAAGAAAATGGG + Intronic
952038250 3:29230667-29230689 GAGAGGAAAGGGAAGGAAAAAGG - Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
952281883 3:31931355-31931377 CACAGAATTGGAAAGGAAATAGG - Intronic
952282337 3:31935841-31935863 TGTAGAAAGGGAAAGGAAATAGG + Intronic
952312157 3:32199957-32199979 AAGAGGAAGGGGAAGGAGAGAGG + Intergenic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
953775838 3:45816436-45816458 CATAGACAGGGAAAGGAAGTGGG + Intergenic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
954982506 3:54759332-54759354 GAGAGAAAGGGGAGGGAAAGTGG + Intronic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955483398 3:59412162-59412184 CAGAGAAAGGTTAAGTAATTTGG - Intergenic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
956135936 3:66098994-66099016 CAGAGAGAAGGGAAGGGAAGGGG - Intergenic
956493943 3:69804292-69804314 GAGAGGAAGGGGAGGGAAATGGG - Intronic
956518027 3:70072083-70072105 GAGAGAAAGGAGAAAGAAAGAGG - Intergenic
956574347 3:70735074-70735096 CAGGGAATGGGGAGGAAAATTGG - Intergenic
956715924 3:72079963-72079985 GAGAGAAAGGGGAAGAAAAAGGG - Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956733122 3:72214857-72214879 AAGAGAAAGTGGATGGAAAATGG - Intergenic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956909528 3:73803367-73803389 AATAGAAAGGGGAAGGGACTGGG - Intergenic
957032178 3:75254723-75254745 CAGAGGAAGGGGACTGGAATGGG + Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957289843 3:78265949-78265971 CAAAGAAAAGGGATGGAAAAAGG - Intergenic
957640746 3:82850210-82850232 AAGGGAAAGGGGAAGGAGAAGGG - Intergenic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
958069447 3:88591348-88591370 CAGAGAAATAGGAAGAAAACAGG + Intergenic
959084230 3:101834355-101834377 AAGCGAAAGGGAAAGGAAAAGGG - Intronic
959315801 3:104805091-104805113 CAGAGAAAGTGGCAGGTGATGGG + Intergenic
959445006 3:106428070-106428092 CAGAGAAAGACAAATGAAATGGG + Intergenic
959527327 3:107391733-107391755 CTGAGAAAGTGGGAGGAGATGGG - Intergenic
959903870 3:111689311-111689333 AAGTGACAGGAGAAGGAAATGGG + Intronic
960180744 3:114573535-114573557 GAGAGAAAGGGAAAAGAAAGAGG + Intronic
960231676 3:115235284-115235306 GAGAGAAAGGGGACAGAAAAAGG + Intergenic
960241385 3:115346080-115346102 GAGAGAAAGGGAAAGGGAAAGGG - Intergenic
960322572 3:116254435-116254457 AAGAGAAAGGGAAAGGAAGAAGG + Intronic
960360272 3:116702653-116702675 AAGGGAAAGGGGAAGGCAAAGGG + Intronic
960404761 3:117246134-117246156 CAGAAAAAGGAGAAATAAATGGG - Intergenic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960736007 3:120781477-120781499 TAGAGAAAGGAGAAAGAATTAGG - Exonic
960831313 3:121851731-121851753 CACAGAATGGGGAACAAAATTGG + Intronic
961045349 3:123704139-123704161 CAGAGAAAGGTGGAGGACTTGGG + Intronic
961076965 3:123991781-123991803 CAGGGCAAGGGGAAGGCAAGGGG - Intronic
961208263 3:125104819-125104841 TAGAAAAAGGGGAGGGAAAAAGG - Intronic
961394457 3:126577550-126577572 TAGATAAAGGGGAAGGGAAAGGG + Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961511344 3:127405720-127405742 GAGAGAAAGGGGCAGTAACTGGG + Intergenic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
962265682 3:133942773-133942795 AAGAGGAAGGGGAGGGAAAAAGG + Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962478441 3:135778120-135778142 CACAGGAAGGGGTAGGAGATGGG + Intergenic
962508814 3:136077577-136077599 CAGTGAAAGGGAAATGAAGTGGG + Intronic
962664955 3:137644608-137644630 TAGAGAATGGGGAGGGAGATGGG - Intergenic
962891018 3:139673130-139673152 CAGAGAAGGAGGAAACAAATAGG + Intronic
963143271 3:141965571-141965593 AAGGGGAAGGGGAAGGAAAGGGG + Intronic
963224907 3:142852575-142852597 CTGAGGAAGGAGGAGGAAATGGG - Intronic
963248279 3:143082872-143082894 CAATGATAAGGGAAGGAAATGGG - Intergenic
963749889 3:149165763-149165785 CAGATAATGGGGAAGGGAGTGGG - Intronic
963814614 3:149815524-149815546 CATAAAAAGGGGAAGAAAGTTGG + Intronic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963931346 3:151007156-151007178 CAGAGAAACGGGAAGAAATCAGG - Intergenic
964001201 3:151774364-151774386 TAGAGAATGTGGAAGCAAATTGG + Intergenic
964423405 3:156528638-156528660 AAAAGAAAGGGGAAGGCAAAAGG + Intronic
964526933 3:157625035-157625057 AAGAGAAAGGCAAAGGAGATTGG + Intronic
964632373 3:158825711-158825733 CTGAGAAAGGGAGAGGAAAGAGG + Intronic
965136502 3:164778311-164778333 CAGAAAAAAGGGAAAGAAAGAGG + Intergenic
965509015 3:169547765-169547787 AAGAGAAAGGGGAGGGCAACTGG + Intronic
966088403 3:176099982-176100004 CAGAGAAAGAAAAAAGAAATTGG + Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966326118 3:178756752-178756774 CAGAGAAAGAAAGAGGAAATTGG - Intronic
966398555 3:179525088-179525110 GAGAGAAAGAAGAAGGATATCGG + Intergenic
966495911 3:180580448-180580470 CAGAGAAAGGGAATGGATACAGG + Intergenic
966683658 3:182670537-182670559 GAAAGAAAGAGGAAGGAAAAAGG + Intergenic
967034803 3:185640316-185640338 CAGAGGAAAGGGAAAGAGATAGG - Intergenic
967812361 3:193771561-193771583 CACAGAAATGGGAGGGAAACAGG - Intergenic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
968001517 3:195209813-195209835 CAGAGTAAGGGGACAGAAAACGG + Intronic
968038195 3:195566573-195566595 GAGAGAAAGAGAAAGGAAGTAGG - Intergenic
968056247 3:195694139-195694161 CAGAGAAAAGGGAATGAGAACGG + Intergenic
968185071 3:196627375-196627397 GAGAGACAGGGGAAGAAAAGAGG - Intergenic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969176043 4:5399842-5399864 CAGAGAAAGGGGACAGGAAGAGG - Intronic
969259843 4:6026409-6026431 AAGAGAAATGGGAAGTAAACAGG + Intronic
969278332 4:6152086-6152108 AAGAGACAGGGGAAGGAAGAAGG + Intronic
969551242 4:7869001-7869023 AAGAGAAAGGGAAAGGGAAAGGG + Intronic
969551249 4:7869095-7869117 AAGAGAAAGGGAAAGGGAAACGG + Intronic
969551255 4:7869141-7869163 AAGAGAAAGGGAAAGGGAAAGGG + Intronic
969616049 4:8253132-8253154 CAGGGAAAGGGGAAAGAAGGAGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970010944 4:11458682-11458704 AAGAGTAAAGGGAAGGACATGGG - Intergenic
970315886 4:14827959-14827981 GAGAGAAAGGGTAAGCAAAGGGG - Intergenic
970321606 4:14880487-14880509 TTCGGAAAGGGGAAGGAAATGGG + Intergenic
970546081 4:17131767-17131789 CAGAGAATGGGGAAGGTGCTAGG - Intergenic
970645305 4:18113850-18113872 AAGGGAAAGGGGAAGGGAAAGGG + Intergenic
970892958 4:21068188-21068210 CAGAAAAAGGGAAAGAAATTGGG - Intronic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
971030116 4:22627095-22627117 CAGAAAAAGGGAAAATAAATGGG - Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971135049 4:23859431-23859453 CAAAGAAGAGGGAAGGAAATTGG + Intronic
971150314 4:24024438-24024460 CAGTGAAGGTGGAAGGAGATGGG - Intergenic
971215682 4:24660399-24660421 GAGAGAAAGAGAAAGGAAAAAGG - Intergenic
971981093 4:33751631-33751653 CAAAGAAAATGGAAAGAAATTGG + Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972784754 4:42315800-42315822 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
973001747 4:44960903-44960925 TGGGGAAAGGGGAAGGAAAAGGG - Intergenic
973675488 4:53257519-53257541 CAGAGAAAGGGTAAGACCATAGG + Intronic
974073382 4:57146283-57146305 GAGAGAAAGGGTAAGGAAGGAGG - Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974355969 4:60813364-60813386 TAGAGAGAGGGGAAAGACATAGG - Intergenic
974449031 4:62026643-62026665 CAGGGGCAGGGGAAAGAAATGGG + Intronic
975231483 4:71939392-71939414 TAGAGAAAGAGGAAGGAGAGAGG - Intergenic
975282952 4:72584055-72584077 CAGATAAAATGTAAGGAAATAGG + Intergenic
975616313 4:76251361-76251383 AAGAGAAAGAGGATGGAAAGTGG - Intronic
975865872 4:78723222-78723244 CAGATAAGGGGGAAAAAAATAGG - Intergenic
975893519 4:79058115-79058137 GAGAGATAGGCAAAGGAAATTGG - Intergenic
976128411 4:81857818-81857840 AGGAGAAATGGGAAGGAATTGGG - Intronic
976259033 4:83128423-83128445 AAGGGAAAGGGGAAGGAAGGAGG - Intronic
976421494 4:84849762-84849784 CTAAGAAAGGGAAAGGGAATGGG + Intronic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
977153495 4:93544077-93544099 CAGAGGAAAGTGCAGGAAATTGG + Intronic
977711558 4:100132537-100132559 CAGTGAAACTGAAAGGAAATAGG - Intergenic
977919244 4:102625403-102625425 GAGAGAAAGAGAAAGGAAAAAGG - Intergenic
978472538 4:109085693-109085715 CAAAGGGAGGAGAAGGAAATAGG - Intronic
978563754 4:110060556-110060578 CAGAGAACTGGTAAGGAAATAGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
979109503 4:116734158-116734180 GAGAGAAAGAAGAAGGAAATGGG + Intergenic
979303009 4:119108870-119108892 CAGAGACAGAGGGAGGGAATGGG - Intergenic
979456832 4:120935407-120935429 CAGGAAAAGGGAAAGGAAATAGG - Intergenic
979513753 4:121583345-121583367 CAGAATCAGGGAAAGGAAATCGG - Intergenic
979749638 4:124262932-124262954 GAGAGAAAGAGGGAGGAAAGGGG - Intergenic
980245523 4:130235102-130235124 CAGAAAAAGAGGAAAGAAAGGGG - Intergenic
980394200 4:132188321-132188343 GAGAGAAAGGGTAAGGAGAGAGG + Intergenic
980447518 4:132930397-132930419 CAGAGAAAGGGAGAGGAAGATGG - Intergenic
980619475 4:135279961-135279983 TAGAAAAAGGGGAAAAAAATAGG + Intergenic
980662933 4:135889295-135889317 CAGAGAAAGGGAAAAAGAATTGG + Intergenic
980994850 4:139770391-139770413 CAAAGGTAGGGGAAGGAAAACGG + Intronic
981234181 4:142395239-142395261 CAGAGAAAAGGAAATGAAAGAGG + Intronic
981354063 4:143766700-143766722 AAGAGGAAGGGGAAAGAAAAGGG - Intergenic
981419924 4:144537699-144537721 CTCAGAAAAGGAAAGGAAATGGG + Intergenic
982642101 4:157974880-157974902 CAGAGACAGGAAGAGGAAATGGG - Intergenic
982659074 4:158185275-158185297 GAAAGAAAGGAGAAGAAAATGGG + Intergenic
982688510 4:158521814-158521836 AAGAGACAGAGAAAGGAAATGGG + Exonic
982786458 4:159542940-159542962 AAAAGAAAGGTGAGGGAAATAGG + Intergenic
983900388 4:173127330-173127352 CAGGGAAAGGGAAAGGGAAAGGG - Intergenic
984009880 4:174357946-174357968 GAGAGAAAAAGGAAGGAATTTGG - Intergenic
985190662 4:187369322-187369344 CAGGGAGAGGGTAAGGAAAAGGG + Intergenic
985416436 4:189740629-189740651 CAGAGAAAGGTTAAGGACACAGG + Intergenic
985622887 5:964800-964822 CAGAGAAGGGGAGAGGAAAAAGG - Intergenic
986067097 5:4245339-4245361 GAGAGAAAGACAAAGGAAATGGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986588440 5:9343774-9343796 CAAAGGAAAGGGAAGGAAACTGG - Intronic
986823534 5:11496105-11496127 GAGACAAAAGGGAAGGTAATGGG - Intronic
987508492 5:18803626-18803648 AAGACAAAGAGGAAGGAAAGAGG + Intergenic
987582406 5:19811041-19811063 AAGGGAAAGGGAAAGGAAAAGGG + Intronic
988264845 5:28935349-28935371 CACAGAGAGGAGAAGGCAATCGG - Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988643424 5:33067033-33067055 CAGAGGAAGGTGATGGAATTGGG + Intergenic
989326908 5:40207702-40207724 CAGAGGAGGCGGCAGGAAATGGG + Intergenic
989357338 5:40559250-40559272 AAGAGAAATGTGAAGTAAATTGG - Intergenic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990079131 5:51890975-51890997 CAGAGACTGGGGAAGGTAGTGGG + Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990492021 5:56311908-56311930 CAATGAAAGGCTAAGGAAATTGG + Intergenic
990558204 5:56957076-56957098 CTCAGAAAAGGGAAGGAAAATGG + Intronic
990778564 5:59331985-59332007 CAGAGAAAGGTAAATGAAATAGG - Intronic
990811603 5:59731278-59731300 AAGAGAAATGGAAAGGAAGTAGG - Intronic
992095437 5:73358304-73358326 CAGAGAAAGGGGATGTGAATTGG - Intergenic
992101056 5:73408200-73408222 CAGAGAAGGGGCAAAGAACTTGG - Intergenic
992437815 5:76772320-76772342 CAGAGAAAGGGACTGAAAATAGG + Intergenic
992850122 5:80798374-80798396 CTGAGATAAGGGAAGGAATTGGG - Intronic
993430194 5:87823362-87823384 GAGAGAAAGAGGAAGGAGAAAGG + Intergenic
993842008 5:92891520-92891542 CAGAGAAAAAGGAAGAGAATTGG - Intergenic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994777165 5:104049564-104049586 TAGGGAAAGGGGAAGTAAACAGG - Intergenic
995778906 5:115755289-115755311 CAGAGAAAGGGGAAAACAGTTGG - Intergenic
995871747 5:116750397-116750419 CAGAGGAGTGGGAATGAAATGGG + Intergenic
996100246 5:119437736-119437758 CAGGGAAGGGGGAAGGACAGGGG + Intergenic
996196116 5:120609774-120609796 CAGAGAAATGGGAAAGAAAATGG - Intronic
996307023 5:122059146-122059168 CAGAGAAAATGGTAGGAGATGGG + Intronic
996379736 5:122850813-122850835 CAGAGAAAGAGTGAGGAAAGAGG + Intronic
996387578 5:122925203-122925225 AAGGGGGAGGGGAAGGAAATAGG - Intronic
996419119 5:123242363-123242385 CAAAGAAAGGGGTGGAAAATCGG - Intergenic
996914701 5:128698482-128698504 CAGAGAAACTTGAAGGAAAGAGG - Intronic
996920662 5:128764050-128764072 CAAGGAAAGAGGAAGGAAGTTGG + Intronic
997236135 5:132272889-132272911 GAGAGGAAGGGGAAGAAAAGGGG - Exonic
997263817 5:132483448-132483470 CAGTGAAATGTGAAGGAAAGTGG - Exonic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998378290 5:141705981-141706003 CAGAGAGAGGTAAAAGAAATGGG + Intergenic
998405956 5:141874839-141874861 CGGGGAGAGGGGAAGAAAATGGG + Intronic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
998533952 5:142911700-142911722 CAGAGAAATGGGAGGGAATAGGG - Intronic
998537810 5:142951005-142951027 AAGAGAAAGGGAAAGGGAAAGGG - Intronic
998545494 5:143023886-143023908 AGGAGAAAGGGGAAAGAAAAAGG - Intronic
998692016 5:144597717-144597739 CAGAGAAAGTGACAGGAAAATGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999371232 5:151056565-151056587 ATGAGGAAGAGGAAGGAAATGGG - Intronic
999609624 5:153354785-153354807 GAAACAAAGGGGAAGGAATTAGG - Intergenic
999667678 5:153931006-153931028 TAAAGAAAGGAAAAGGAAATAGG - Intergenic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
999981156 5:156959081-156959103 CAGAGAAAAGGGATTGGAATTGG + Intronic
1000139439 5:158387734-158387756 TAGTGAAGGGGAAAGGAAATGGG - Intergenic
1000141885 5:158412860-158412882 CAGAGAAAGTAGAAGTAATTGGG - Intergenic
1000172665 5:158718398-158718420 CAAAAAAAGGGGAAGGCAAAAGG - Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000320878 5:160133489-160133511 CAAAGAAAGGGCAACTAAATTGG - Intergenic
1000472724 5:161665789-161665811 GAGAGAGAGAGAAAGGAAATTGG - Intronic
1000679772 5:164168827-164168849 CACAGCAAGTGGAAGGAAATGGG - Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1000956945 5:167554660-167554682 CACAGAAAGGTGAAGTAAGTTGG + Intronic
1001083808 5:168685939-168685961 GAGAGAATGGGGAGGGAGATAGG + Intronic
1001168625 5:169394827-169394849 TAGAGAAAGGAGTAGGAAATGGG + Intergenic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001434811 5:171692005-171692027 GAGAGAAAGGGGATGCAGATAGG - Intergenic
1002029930 5:176420414-176420436 GAGAGAAAAAGGAAGGAAAGGGG - Intergenic
1002918581 6:1548725-1548747 AAGAGAAAGAGGAAAGAATTGGG + Intergenic
1003009501 6:2413485-2413507 CATAGTAAAGGGAAGGGAATTGG - Intergenic
1003373741 6:5554328-5554350 AAGAGAAAGGGCAAAGAATTTGG + Intronic
1003449845 6:6220333-6220355 CAGGAAAAGGGGAAGTAATTTGG + Intronic
1003514831 6:6809288-6809310 CAGTGAAGGGGGAAGAAAGTAGG + Intergenic
1003683751 6:8280898-8280920 AAGAGAAACGGGAAGGACAAGGG - Intergenic
1003945537 6:11072103-11072125 CAGAGAAAGGGAAGGGAGGTGGG + Intergenic
1004685456 6:17939145-17939167 CAAGGAAAGGGGGAGGAAAGAGG - Intronic
1004990995 6:21138623-21138645 AGAAGAAAGGGAAAGGAAATAGG - Intronic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005387113 6:25296228-25296250 TAGTGAAAGGGTCAGGAAATTGG - Intronic
1005878427 6:30033918-30033940 CAGAGAAATGGGGCGGTAATTGG - Intergenic
1006113064 6:31760424-31760446 CAGAGGCAGGTGAAGGAATTTGG - Intronic
1006189478 6:32198810-32198832 CAAAGATAGGGGAAGGAGAGAGG - Intronic
1006246426 6:32740981-32741003 CAGAGAAAGGGGAGGGAATGGGG + Intergenic
1006525200 6:34598514-34598536 CAGAGTATGGGGAAGAGAATGGG + Intronic
1006562983 6:34929789-34929811 GAGAGAAGGAGGAAGGAAAAGGG - Intronic
1006567806 6:34974309-34974331 AAGAGAAAGGGGAAGGGGAAGGG - Intronic
1006618072 6:35343045-35343067 CAGAGGCAGGGGAGGGGAATGGG - Intronic
1006618405 6:35345234-35345256 CACTGAATGGGGAAGGAATTTGG - Intronic
1006761092 6:36461870-36461892 TAGAGAAGGAGGAAGGAAAAGGG + Intronic
1006809801 6:36812544-36812566 CAGAGAGAGGTTAAGGAAAGTGG + Intronic
1007111999 6:39318178-39318200 CCCAGAAGGGAGAAGGAAATCGG - Intronic
1007253425 6:40511930-40511952 GAGAGAAAGAGGGAGGAACTAGG + Intronic
1007377450 6:41466573-41466595 GAGGGAAAGGAGAAGGAGATAGG + Intergenic
1007868507 6:45004614-45004636 CATGTAAAAGGGAAGGAAATGGG - Intronic
1008188743 6:48427839-48427861 CAGCTACAGGGGAAGGATATTGG - Intergenic
1009286000 6:61818299-61818321 CAGAGACAGGGGAAGAGAAAAGG + Intronic
1009559758 6:65223776-65223798 AAGAGACTGGGGAAGGAAATTGG + Intronic
1009931584 6:70182600-70182622 CAGAGAGACAGGAAGAAAATCGG + Intronic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1010075227 6:71790003-71790025 AACAGAAAGGGGAAGGAGAGGGG + Intergenic
1010193324 6:73215072-73215094 AGGAGAGAGGGGAAGGAAAGAGG - Intronic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012426506 6:99120982-99121004 CAGAGGAAGGGGGTGGAAAGGGG + Intergenic
1012432953 6:99185492-99185514 CAGAGAAAGGGAAATTAAAAAGG - Intergenic
1012520960 6:100120538-100120560 CAGATAAAAGGGATGGAGATGGG + Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1012620174 6:101334596-101334618 CAGAGTCTGGGGAAGGTAATGGG - Intergenic
1012724780 6:102796775-102796797 CAGTGAAAAGGGTAGGAAGTGGG + Intergenic
1013063547 6:106660825-106660847 GAGAGAAAGGGAAAGCACATGGG + Intronic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013590850 6:111618669-111618691 ACGAGAAAGGGGAAGGAGAGAGG - Intergenic
1013980863 6:116127245-116127267 GAGAGAAAGGGAAAAGAAAAAGG - Intronic
1014084457 6:117327239-117327261 CAGGGAAAGGGTAAGAACATCGG + Intronic
1014402597 6:121009241-121009263 CAGAGCAGGGGAAAGGAAAAAGG + Intergenic
1014545862 6:122734512-122734534 CAGAGAGATGGGCAGGAAAAGGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015292029 6:131548070-131548092 CAGAAAAAGGGGAAAGGAAGAGG + Intergenic
1015366653 6:132403137-132403159 GAGAGAAAGAGGAACAAAATAGG + Intergenic
1015588501 6:134800624-134800646 AAGGGAAAGGGGAAGGTGATCGG - Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016369466 6:143357202-143357224 CACAGAGAGGGCAAGGATATGGG - Intergenic
1016441369 6:144087537-144087559 TAGAAAAAAGGGAAGGAAATTGG + Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016882752 6:148927184-148927206 GAGAGAAAGGGGAGGGAAAGGGG + Intronic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017421509 6:154277726-154277748 CAGGGAAAGGTGAAGTAAAGTGG - Intronic
1018137360 6:160790284-160790306 AAGGGGAAGGGGAAGGAAAGGGG + Intergenic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018379072 6:163241160-163241182 CTGAGAGAGGGGAAGAAAAAAGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018663631 6:166113407-166113429 GAGAGAAAGGGAAAGGCCATTGG - Intergenic
1018870252 6:167777161-167777183 CAGGGAAAGGGAAAGGGAAACGG + Intergenic
1018921709 6:168180051-168180073 CAGAGAAAGGCGGAGGAAAGTGG + Intergenic
1018988729 6:168657495-168657517 CAGAGAAAGGGAAAAGCAAGGGG - Intronic
1019340196 7:505266-505288 CGGAAAAAGGGGAGGGACATGGG - Intronic
1019372333 7:669295-669317 CATAGAAAGAGAAAGTAAATTGG + Intronic
1019652941 7:2170389-2170411 CAGGGAAAGGGGAGGGCAAGTGG + Intronic
1020522427 7:9208841-9208863 CAGAGAAAGGCGGAGCAAGTTGG - Intergenic
1020765622 7:12316550-12316572 CAGAAACTGGGGAAGGTAATGGG + Intergenic
1020791899 7:12637485-12637507 GGGAGAAAGGGGAAAGAAAAGGG + Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1020883668 7:13795468-13795490 CAGATGATGGGGAAGGAAAGGGG - Intergenic
1021060003 7:16099497-16099519 AAGGGAAAAGGGAAGGAAAGAGG + Intronic
1021131483 7:16917640-16917662 CAAAGAAGGGAGAAAGAAATAGG - Intergenic
1021421393 7:20449080-20449102 GAGAGAAAAGGGGAAGAAATGGG + Intergenic
1021431720 7:20567274-20567296 GAGAGAAGGGGGAAGAAAAGAGG + Intergenic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1021697062 7:23286192-23286214 GAGAGAGAGGGGAAGGAGAGGGG - Intergenic
1021784655 7:24139858-24139880 CAGAGACATGGCAAGGAAAAAGG - Intergenic
1021902866 7:25304857-25304879 CAGAGAAAGCGTAAGGGAGTAGG + Intergenic
1021974067 7:25994849-25994871 AGAAGAAAGGGGAAGGGAATTGG + Intergenic
1022046208 7:26624526-26624548 CAGAGAATGGGGAAGCAGAGTGG + Intergenic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022763740 7:33386266-33386288 CACTGAAAGGGTAAGGAATTTGG + Intronic
1022773616 7:33501406-33501428 CACAGAAACTGGAAAGAAATGGG - Intronic
1023104434 7:36749738-36749760 CAGATCAAGGGGCAGGGAATGGG + Intergenic
1023115305 7:36856312-36856334 CAGCTAAAGGGCTAGGAAATAGG + Intronic
1023247693 7:38223143-38223165 AAAAGAAAAGGGAAAGAAATAGG + Intronic
1023554108 7:41402147-41402169 CAGAGAAAGTGCAAAGAAAATGG - Intergenic
1024350980 7:48363714-48363736 CAGACAAAGGAGAATAAAATTGG - Intronic
1024737680 7:52323354-52323376 AAGGGAAAGGGGAAGGGAAGGGG - Intergenic
1024737695 7:52323394-52323416 AAGGGAAAGGGGAAGGGAAGGGG - Intergenic
1024737809 7:52323711-52323733 AAGAGAAATGGAAAGGAAAAAGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1025607682 7:63051190-63051212 CAGAGTGAGAGGAAGGAAAGAGG - Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026598447 7:71753473-71753495 CAGAGAGAGAGAAAGGAAAGGGG - Intergenic
1026687915 7:72528244-72528266 GAGAGAAAGAGAAAGGAAAGTGG - Intergenic
1027367491 7:77473570-77473592 CAGAGAAGAGGGAAGGAATTAGG + Intergenic
1027620103 7:80473889-80473911 AATAGAAAGGCAAAGGAAATAGG + Intronic
1027926748 7:84474962-84474984 CTAAGAAAAGAGAAGGAAATAGG + Intronic
1027948094 7:84777057-84777079 GAGAGAAAGGGGGAGGTACTAGG - Intergenic
1028245368 7:88470358-88470380 CAGAGAGTGGGGAAAGAAACAGG - Intergenic
1028534999 7:91881982-91882004 AAGAAAAAGGAGAAAGAAATGGG - Intergenic
1028553598 7:92099115-92099137 CAGATAAGGGTGAAGGAAAGTGG - Intronic
1028584609 7:92440301-92440323 AAGGGAAAGGGGAAGGAAGGAGG + Intergenic
1028611522 7:92717362-92717384 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1029632955 7:101764599-101764621 CAGAGACAAGGAAAGGAAGTCGG - Intergenic
1030485874 7:110166768-110166790 CAGAGAGAAGGTAAAGAAATGGG - Intergenic
1030620838 7:111789550-111789572 AAGACAAGGGGGAAGGAAAGTGG + Intronic
1031060059 7:117040981-117041003 CAGAGAAAAGGAAAGCAAAGGGG - Intronic
1031313762 7:120231727-120231749 CAGGGTAAGGGTATGGAAATAGG - Intergenic
1031564331 7:123276753-123276775 CAGAGATACGGAAAGGAAAAAGG - Intergenic
1031746792 7:125508904-125508926 AAGAAAAAGGGGAATTAAATAGG + Intergenic
1032677254 7:134142308-134142330 CAGAGGTAGGGGAATGAATTAGG - Intronic
1032795448 7:135272380-135272402 CAGGGAGAGGGGGAGGAGATGGG + Intergenic
1033477758 7:141707028-141707050 CTGGGAATGGGGAAGGAATTAGG + Intergenic
1033665147 7:143433980-143434002 CAGGGAAAGGTGGAGGAAAAAGG - Intergenic
1033970429 7:147032724-147032746 GAGAGAAAAAGGAAGGAAGTTGG + Intronic
1034147940 7:148888712-148888734 CACAGGAAGGGGAAGAAAAGTGG + Intergenic
1034261430 7:149758987-149759009 CAAAGAAAGGGGTAGGCAATAGG - Intergenic
1034628285 7:152511098-152511120 CAGAGAGAGGTTAAGGAACTCGG + Intergenic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1034975478 7:155446856-155446878 AAGGGGAAGGGGAAGGAAAAGGG + Intergenic
1035441729 7:158907557-158907579 AAGGGAAAGGGAAAGGAAAAGGG - Intronic
1035856960 8:2985972-2985994 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1035928371 8:3754364-3754386 CAGAAAAAAGGAAAAGAAATAGG + Intronic
1035957683 8:4100370-4100392 CAGGGAAGGTGGAAGGAGATGGG - Intronic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036575227 8:10021791-10021813 AAGAGTAAAAGGAAGGAAATGGG + Intergenic
1036785334 8:11681655-11681677 GAGAGAAAGGGGATGAAAAAAGG - Intronic
1037344413 8:17883787-17883809 AAGGGGAAGGGGAAGGAAAAGGG - Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037807889 8:22068623-22068645 GAGAGAGAGAGGAAGGAAAGAGG + Intronic
1038037618 8:23699905-23699927 CAGTGAAGGGGGAAAGAAAGGGG - Intergenic
1038136549 8:24792252-24792274 GAGAGAGAGGGGAAGGGAGTGGG - Intergenic
1038218863 8:25588604-25588626 CAAAGAGATGGCAAGGAAATGGG - Intergenic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1038804757 8:30780084-30780106 CAGAAAAAGAGGAAATAAATGGG + Intronic
1038814597 8:30888472-30888494 GAGAGAAAGGAGAGGGAAAAAGG - Intronic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039400984 8:37269044-37269066 CAGAGCAAGGGAAAGGGAAATGG - Intergenic
1039838720 8:41278523-41278545 CAAAGACAGGGAAAGGAAATAGG - Intronic
1040067267 8:43156870-43156892 CAAAGAAAAGGGATGGAAAAAGG - Intronic
1041601172 8:59718785-59718807 CAGAGAAGGAGGAAGGGAAGGGG + Intergenic
1041602476 8:59736277-59736299 CAGAGAAAGGAGGATTAAATAGG + Intergenic
1041737445 8:61126349-61126371 CAAAGAAAGCGGAAGGCAACTGG + Intronic
1041887285 8:62825107-62825129 CAGAGATAGTGTAAGGCAATGGG - Intronic
1042012998 8:64270483-64270505 CATAGAGAGGGGAAACAAATAGG + Intergenic
1042077746 8:65015038-65015060 CAGAGGATGGGTAAGGAAAAGGG + Intergenic
1042758658 8:72246803-72246825 AAGAGAAAGGGGCAGGGAGTTGG - Intergenic
1043029127 8:75109423-75109445 GAGAGGGTGGGGAAGGAAATTGG - Intergenic
1044516442 8:93144296-93144318 CAGAGAAAAGGGAATGATTTTGG + Intronic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045087618 8:98703597-98703619 AAGAGAGAGTGTAAGGAAATGGG - Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045537710 8:103047874-103047896 CAGAGAGAGAGAAAGGAAAAAGG - Intronic
1045750876 8:105482921-105482943 AAGAGAAGGGGAAAGGAAAGGGG - Intronic
1046027372 8:108741239-108741261 GAGAGAAAAGGGATGGGAATGGG + Intronic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1047532119 8:125686252-125686274 CACCGAAAGGGGATGGAAAAGGG - Intergenic
1047595336 8:126372300-126372322 CAGAGAAAGGGAGAGAAGATGGG - Intergenic
1048276122 8:133067305-133067327 TAGAGAAAGGAGAAGCAGATGGG - Intronic
1048413755 8:134203567-134203589 AAAAAAAAGTGGAAGGAAATGGG - Intergenic
1049050321 8:140189583-140189605 GAGAAAAACTGGAAGGAAATAGG + Intronic
1049296245 8:141841237-141841259 AAGAGAAAGGGGAAGCAAGGCGG - Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049667544 8:143853127-143853149 GAGAGAAAGGAGAGGGAAGTGGG - Intergenic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050273484 9:3971509-3971531 GAGAGAAAGGGAAATGAAAAGGG + Intronic
1050640863 9:7666176-7666198 CAGTGAAAGGAGCAGGGAATTGG + Intergenic
1050716120 9:8528261-8528283 CAGAGAAAGAAGAAAGAAAGAGG + Intronic
1050853758 9:10323302-10323324 CTGAAAAAGAGGAAGGGAATGGG - Intronic
1051235481 9:14994011-14994033 CAGAGAAATGGGAAAGTAAGAGG + Intergenic
1051930949 9:22384851-22384873 AAGAGAAAGGAGAGGGACATAGG - Intergenic
1052032064 9:23640032-23640054 CAGAGAAGGGAGAAGCATATAGG - Intergenic
1052128115 9:24804619-24804641 CAGAGAAATCTGAATGAAATAGG - Intergenic
1052333845 9:27299689-27299711 CATAGGAGGAGGAAGGAAATTGG + Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1052512211 9:29436082-29436104 CAGAGAAAGGGGAACACAAAAGG + Intergenic
1052765996 9:32641473-32641495 CAAAGAAAAGGGAAGGGAAGGGG + Intergenic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1053307211 9:36993545-36993567 CAGAGAAAGGGACAGGAAGAAGG + Intronic
1053668128 9:40331522-40331544 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1053891091 9:42693701-42693723 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1053932743 9:43124899-43124921 CAGAGCAAGGGGAGGGGAATTGG + Intergenic
1054220607 9:62408062-62408084 CAGAGACAGGGGAGGGGAATCGG - Intergenic
1054230107 9:62501110-62501132 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054379272 9:64471578-64471600 CAGAGAAAGCAAAGGGAAATTGG + Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1054516483 9:66044771-66044793 CAGAGAAAGCAAAGGGAAATTGG - Intergenic
1054723482 9:68626766-68626788 GAGAGACAGCTGAAGGAAATGGG - Intergenic
1054885049 9:70187606-70187628 AAGAGATAGGGAAAGGGAATGGG - Intronic
1054929978 9:70625981-70626003 AAGAGAAGGGGGAGAGAAATTGG + Intronic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055431401 9:76247732-76247754 TAGAGAAAGGTAAAGGAGATGGG + Intronic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1055883064 9:81025059-81025081 CAATGGAAGGGGAAGGAAATAGG - Intergenic
1056067731 9:82954204-82954226 CAAAGAAAGAGGAAAGAAAGAGG + Intergenic
1056072802 9:83006583-83006605 AAAAGAAAGGGGAAGGAGAGGGG + Intronic
1056145731 9:83727370-83727392 GAGAGAAAGGGAATGGAATTGGG + Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056631021 9:88293129-88293151 AAGAGAAAGGGGATGGGACTTGG - Intergenic
1056694864 9:88839116-88839138 GAGGGAAAGGGTAAAGAAATGGG + Intergenic
1056773974 9:89498167-89498189 GAGAGGAAGGGGAAGGGAAAGGG - Intergenic
1056850472 9:90079720-90079742 AAGAGAAAGATGAAGGAAATTGG + Intergenic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057442942 9:95095255-95095277 CAGAGGAAGGGACAGGAAACTGG - Intergenic
1057720104 9:97525475-97525497 CAAAGAATGGGGAATGAAACAGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058817556 9:108699024-108699046 AAGGGAAAGGGGAAGGCAAAGGG + Intergenic
1058842378 9:108922523-108922545 GAGAGGAAGGGGAGGGACATCGG + Intronic
1058877320 9:109255739-109255761 CACAGCAAGGGGGAAGAAATGGG + Intronic
1058915249 9:109558813-109558835 CACAGTAAGAGGCAGGAAATTGG - Intergenic
1059048065 9:110892709-110892731 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1060643322 9:125257437-125257459 CAGAGAAAGAGGAAGACAAAAGG - Intergenic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061232187 9:129321389-129321411 CAGGGAAAGGCGAAGGAATGTGG - Intergenic
1061260073 9:129475337-129475359 CAGAGAATGGGGAGGGAGAGGGG + Intergenic
1061668800 9:132176346-132176368 CAGGGGCAGGGGAAGGAGATGGG - Intronic
1062663898 9:137656416-137656438 AAGAGACACTGGAAGGAAATGGG + Intronic
1203636635 Un_KI270750v1:118406-118428 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG + Intergenic
1185986152 X:4836578-4836600 CATAGAAATGGAAAGTAAATTGG - Intergenic
1186197396 X:7122738-7122760 CAGAGAAAGGTGCATGTAATCGG - Intronic
1186546919 X:10459559-10459581 CAGAGAAAAGGAAAAGAAAGGGG + Intronic
1186661438 X:11671476-11671498 GAGAGAAAGGAGAAGGCAAATGG + Intergenic
1186664572 X:11704357-11704379 CAGTGTTTGGGGAAGGAAATCGG + Intergenic
1186882018 X:13875857-13875879 CAGAGGTGGGGGAAGGAGATGGG + Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188281903 X:28280844-28280866 CAGAAAAAGGAGAAATAAATAGG - Intergenic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1189128972 X:38478967-38478989 CTGAGAAAGGTGAAGGGACTGGG + Intronic
1189246689 X:39568738-39568760 GCTAGAAAGGGCAAGGAAATAGG - Intergenic
1189543868 X:42021531-42021553 CCAAGAAAGGGGAAGGGAACTGG - Intergenic
1189840303 X:45068840-45068862 GAGAGAAAGGGAAAGGGAAAGGG - Intronic
1190226901 X:48553278-48553300 GAGACAAAGGGGAAGGTAAATGG - Intronic
1190799517 X:53774659-53774681 CTGAGAAAGTAGAAGGGAATGGG + Intergenic
1190905357 X:54721955-54721977 CAGCTAAAAGGGAAGGAAACTGG - Intergenic
1191104593 X:56764650-56764672 CAGAAAGAGGGAAAGAAAATGGG - Intergenic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1192139249 X:68633559-68633581 AGGAGAAAGGGGAAGGACAAAGG + Intergenic
1192214256 X:69147332-69147354 CAGATCACGGGGAAGAAAATAGG + Intergenic
1192273688 X:69608850-69608872 AAGGGGAAGGGAAAGGAAATTGG + Intergenic
1192281513 X:69692106-69692128 CAGAGAAAGGGAAAAGATCTAGG - Intronic
1192336389 X:70223867-70223889 TAGAGAAAGGAGTAGGAAGTGGG - Intergenic
1192541312 X:71975575-71975597 CAGGGGAAGGGGCAGGGAATGGG - Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1193288425 X:79741414-79741436 TAGAGAAAGGCAAAGGAAACAGG - Intergenic
1193594402 X:83428548-83428570 CACAGAATGGGGAAAAAAATTGG + Intergenic
1193667507 X:84340080-84340102 CAGGGAAAGGGAAAGGAAATGGG + Intronic
1193756137 X:85410690-85410712 CAGAGAATGGGGAGGGCAAAAGG - Intergenic
1193792469 X:85832285-85832307 CAGAGAGTTGGGATGGAAATAGG + Intergenic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194268077 X:91779294-91779316 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1194620873 X:96169813-96169835 CAGAGAGAGCAGAAAGAAATGGG + Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1194799854 X:98259250-98259272 CAGAGACTGGGGAGGGAAAGAGG + Intergenic
1194847744 X:98832621-98832643 CACAGCAAGTGGAAAGAAATTGG + Intergenic
1194984774 X:100478489-100478511 CAGAGAAAGGGAAAGTGAAATGG - Intergenic
1195234926 X:102887840-102887862 AAGGGAAAGGGGAAGGGAAAGGG - Intergenic
1195234931 X:102887852-102887874 AAGAGGAAGGGGAAGGGAAAGGG - Intergenic
1195317705 X:103694931-103694953 CTTAGAAAGGGGAAAGTAATGGG - Intergenic
1195425394 X:104723644-104723666 CAGAGAAATGACAAGGAATTTGG + Intronic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195661466 X:107383364-107383386 TAGATAAAGGGGAAAGAAATGGG + Intergenic
1195957565 X:110348839-110348861 CTAAGAAAGGGGAAGTAAAATGG + Intronic
1196033284 X:111114796-111114818 GAGAGAAAGGGGAGGAAACTCGG - Intronic
1196049771 X:111292651-111292673 CAAAGAAAGTAGATGGAAATGGG - Intergenic
1196188439 X:112770038-112770060 CAGAGGATGGGGAAGGTAAGAGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196712677 X:118779510-118779532 TAGAACGAGGGGAAGGAAATGGG + Intronic
1196818232 X:119682204-119682226 CAGGGGAGGGGGATGGAAATAGG + Intronic
1197060603 X:122175410-122175432 AAGAGAAAGTGGAAGTAAAGTGG - Intergenic
1197282409 X:124552727-124552749 CAGAGGAGTGGGAAGGAGATTGG - Intronic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198225670 X:134642911-134642933 CAGAGAAAGGGAGAGGAAGAAGG + Intronic
1198750553 X:139933006-139933028 CAGAGAAAGTGGAAGTAAGAAGG - Intronic
1198848397 X:140938519-140938541 TTGAGAAAGGGGAAAAAAATTGG + Intergenic
1199511376 X:148626739-148626761 GAGAGAAAGGAGAGGGAGATTGG - Intronic
1199616141 X:149657707-149657729 CAGAGAGAGGAGCAGGGAATTGG - Intergenic
1199626499 X:149745541-149745563 CAGAGAGAGGAGCAGGGAATTGG + Intergenic
1199637519 X:149827168-149827190 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1199803941 X:151279351-151279373 CAGAGAAAGGCAAAGGAATGGGG - Intergenic
1200170973 X:154074507-154074529 CAGAGAAACGGGAAGAACCTGGG - Intronic
1200585280 Y:5000215-5000237 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1200834979 Y:7724425-7724447 CAGAAAAAGGGGAAGGCCAAAGG + Intergenic
1201328975 Y:12798046-12798068 AAGGGAAAGGGGAAGGGAAGGGG - Intronic
1201334397 Y:12864579-12864601 CACAGAAAAGGAAAGGAAAAGGG - Intergenic
1202603434 Y:26618116-26618138 AAGGGAAAGAGGAAGCAAATGGG - Intergenic