ID: 954408276

View in Genome Browser
Species Human (GRCh38)
Location 3:50357626-50357648
Sequence GTGTCAGCAGGCTCCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954408276 Original CRISPR GTGTCAGCAGGCTCCCTCAG TGG Intronic
901175265 1:7294181-7294203 GTGGCAGGAGGCTCCCTCGGTGG + Intronic
901338557 1:8473294-8473316 GTGTGAGCAGCCTGCCTCTGAGG - Intronic
901655729 1:10768128-10768150 ATCTCAGGAGGCTCCCCCAGGGG + Intronic
902648839 1:17823318-17823340 CGGTCCGCAGGCTCCCTCAAGGG - Exonic
905796150 1:40817824-40817846 CTGTCAGCTGTCTCCCTCTGAGG - Intronic
907385024 1:54120703-54120725 GTGCCATCTGCCTCCCTCAGGGG - Intergenic
914201236 1:145487362-145487384 GTGGGCACAGGCTCCCTCAGTGG - Intergenic
914266036 1:146039115-146039137 GGGTGAGGAGGTTCCCTCAGTGG + Intergenic
914480353 1:148060494-148060516 GTGGGCACAGGCTCCCTCAGTGG - Intergenic
915388170 1:155515973-155515995 GTGCCATCAGGCTACCTCAAAGG - Intronic
916680090 1:167095895-167095917 GTGTCAAAAGGCTTCCCCAGTGG + Intronic
922034557 1:221835776-221835798 GTGTCATCAGTTTCCTTCAGGGG - Intergenic
1062815708 10:498464-498486 CTGTCAGCAGGACCCCTGAGGGG - Intronic
1063104120 10:2977805-2977827 GTCTCAGCAGGCTCCCTAGAAGG + Intergenic
1063516921 10:6705898-6705920 GTTGCTGCAGGCTCCCCCAGAGG + Intergenic
1067835114 10:49633560-49633582 GGGTGTGCAGGCTCCCTCTGAGG - Intronic
1070763662 10:79044129-79044151 GTTACAGCAGGCACCCTGAGGGG + Intergenic
1078147673 11:8732899-8732921 GTGACAGCAGCCTGGCTCAGGGG - Intronic
1078373987 11:10777435-10777457 GTGTCAGCCGGTGCCTTCAGAGG - Intronic
1078888923 11:15535824-15535846 TTGTCAGAAGGCTCCTGCAGTGG - Intergenic
1081166028 11:39810136-39810158 GAGCCAGCAGTCTCACTCAGAGG + Intergenic
1084721350 11:70907421-70907443 GTGCTAGAAGGCTCCCTCTGGGG - Intronic
1084805202 11:71573924-71573946 GTGGCAGCAGGTTCCTTCAGGGG - Intergenic
1089059294 11:115613179-115613201 GTGTCAACAGGTTCACTCTGAGG - Intergenic
1089060898 11:115625358-115625380 GGTTGAGCAGGTTCCCTCAGTGG + Intergenic
1089750661 11:120648982-120649004 CTGGCACCAGGCTCCCTCGGGGG - Intronic
1091665978 12:2418827-2418849 GGGTCAGCATGCTCCCACTGGGG - Intronic
1094097916 12:26728433-26728455 CTTTCAGCAGCCTCCCACAGGGG + Intronic
1095295185 12:40519418-40519440 GTGTCAGCAAGCTCTTTCAGAGG - Intronic
1096111280 12:49030731-49030753 GTGATAGCAGGCTCCGTTAGGGG + Exonic
1096607598 12:52777749-52777771 GTGTCCACAGGCTCCCACAGTGG + Intergenic
1096916794 12:55041600-55041622 GAGTCAGCAGCCTTCCTCAGAGG - Intergenic
1101399169 12:104373243-104373265 GTGGGAGCTGGCTCCCACAGGGG - Intergenic
1101824563 12:108210101-108210123 TTGACAGCAGCCTCCCCCAGGGG + Exonic
1103345538 12:120247332-120247354 CTGCCAGCTGGCTCCCTCAAAGG - Intronic
1104041349 12:125133392-125133414 GTGTCAGCAGGCCACGTGAGTGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108260360 13:48649627-48649649 GTGTCAACAAGCTCACACAGGGG - Intergenic
1113778699 13:112963499-112963521 CTGTCAGCAAGGGCCCTCAGGGG + Intronic
1115012880 14:28572280-28572302 CTGTCTGCAAGCTCCCCCAGGGG - Intergenic
1119871949 14:78025609-78025631 CTGCCAGCAGGTACCCTCAGGGG + Intergenic
1120773808 14:88411027-88411049 AAGGCAGCAGCCTCCCTCAGGGG - Intronic
1122012241 14:98759735-98759757 GTGGCAGATGGCTCCATCAGAGG - Intergenic
1123054505 14:105562619-105562641 CTGTCAGAGGGGTCCCTCAGAGG - Intergenic
1123079091 14:105683038-105683060 CTGTCAGAGGGGTCCCTCAGAGG - Intergenic
1202858235 14_GL000225v1_random:64411-64433 GTGTCACCCTGCTCCCTCATGGG - Intergenic
1124140559 15:27073351-27073373 GTGTCAGCAGCATGCCTCAGGGG + Intronic
1124247646 15:28084771-28084793 GTTACAGGAGGCCCCCTCAGAGG + Intronic
1124360888 15:29035914-29035936 GTGACAGCTGGCACCCTGAGGGG - Intronic
1124459468 15:29875890-29875912 TTGTCACCAGGCTCCCTGTGAGG + Intronic
1125151784 15:36540810-36540832 GTCTCAGCAAGCTGCCTCTGGGG - Intergenic
1126737971 15:51751297-51751319 GTGTCAGGATGCTCGCTCACAGG + Intronic
1129771513 15:78206153-78206175 TTGTCAGCAGGCGCCCAGAGCGG - Intronic
1134179286 16:12034550-12034572 ATGTCCACAGGGTCCCTCAGGGG + Intronic
1135938099 16:26798104-26798126 GTGGCAGCAGGCTCCCGTAGGGG - Intergenic
1137527972 16:49253525-49253547 GTTCCAGTTGGCTCCCTCAGAGG + Intergenic
1140480701 16:75261437-75261459 GTGGAACCAGCCTCCCTCAGAGG + Intronic
1141259516 16:82440037-82440059 GTTTCATCAGGGTTCCTCAGAGG - Intergenic
1141445822 16:84057503-84057525 GTGTCAGCGTCCTCCCTGAGAGG - Intronic
1141873431 16:86805402-86805424 GTGTCCGCAGGCTCCTTACGGGG + Intergenic
1142758368 17:2028915-2028937 GTGTCCTCGGGCTCCCCCAGAGG - Intergenic
1145974263 17:28975307-28975329 GGGTCAGCAAGCTCCCTTATAGG - Intronic
1147877529 17:43632262-43632284 CTGACAGCAGGCTCCGTCTGGGG - Intergenic
1148201826 17:45754210-45754232 GCGGCAGCTGGCTCCCACAGTGG - Intergenic
1149237682 17:54612236-54612258 GTAGCAACAGGCTCTCTCAGTGG - Intergenic
1151558668 17:74859802-74859824 GTGGCATCAGGCTCCCCCCGCGG + Exonic
1152382045 17:79947156-79947178 GTGTCAGCAGGGCACCCCAGGGG + Intronic
1152537575 17:80959590-80959612 GGGTCATCTGGCTCCCTCGGGGG - Intronic
1153986040 18:10351677-10351699 GTGTCACCAGGCTCACTCATGGG - Intergenic
1156459985 18:37316207-37316229 ATGGCAGCTGGCCCCCTCAGAGG - Intronic
1157580898 18:48773621-48773643 GGGTGAGCAGGCTTCCCCAGGGG + Intronic
1158620676 18:59029987-59030009 CTGTCAGCAGCCTCCAGCAGAGG + Intergenic
1161370680 19:3909272-3909294 GTGTCAGCGGGCATCCTCATAGG - Intronic
1161718726 19:5891924-5891946 GTCCCAGCAGGCTCCCTGAGGGG - Exonic
1164830855 19:31319555-31319577 GAGACATCAGTCTCCCTCAGTGG - Intronic
1165360864 19:35336167-35336189 GTGACAGCAGCCTGCCTCATTGG - Exonic
1166945318 19:46392492-46392514 GTGGCAGCAGGGTCCCTCAAGGG + Intronic
1167708093 19:51093755-51093777 GTGTCAGAAAGATCCCTCTGGGG - Intergenic
1167748406 19:51366349-51366371 GGGTCAGCCCGCACCCTCAGCGG + Intronic
925170485 2:1747311-1747333 GTGTGCGCAGGATCCCGCAGGGG - Intergenic
925170498 2:1747371-1747393 GTGTGCGCAGGATCCCGCAGGGG - Intergenic
925176140 2:1785208-1785230 GTGTCAGGAGGCCCCTTCTGTGG + Intergenic
925309219 2:2870367-2870389 GTGACAGCAGGTCCACTCAGGGG + Intergenic
926412452 2:12618248-12618270 GTGTCAGCTGGGTCACTCATGGG - Intergenic
927241235 2:20921023-20921045 GTGCCAGAAGGCTCCCTCGATGG - Intergenic
927930423 2:27040176-27040198 GTCTCACCAGTCTCTCTCAGAGG + Exonic
930710058 2:54542600-54542622 GTCTCAGAAGGATCCCTCTGGGG + Intronic
931757118 2:65384216-65384238 GTGTTATCAGCCTCCCTCGGTGG + Intronic
932042902 2:68319181-68319203 GTGGCAGCAGGGTCCCCCATGGG - Intronic
933720173 2:85392624-85392646 CTGTCAGCAGGATGCCTCAAGGG + Intergenic
934704171 2:96464808-96464830 GTGACAGCTGGCTTCCTCAAGGG + Intergenic
935119773 2:100174383-100174405 GTTTCACCAGGCGCCCTAAGAGG - Intergenic
935492307 2:103735560-103735582 GTCTCTGCAGGCACCATCAGGGG - Intergenic
936293454 2:111246926-111246948 CTGGGAGGAGGCTCCCTCAGTGG - Intergenic
937084112 2:119159130-119159152 GTGTCAGCAGGGCTCCTCTGGGG + Intergenic
938072907 2:128317844-128317866 GTGACAGCCGGCTCACCCAGAGG + Intronic
938406742 2:131037061-131037083 GGGGCAGCAGGCTTCCACAGGGG - Intronic
944134752 2:196386426-196386448 ATGTTAGCAAGCTCCCTCATGGG - Intronic
946468043 2:219929835-219929857 CAGTTAGGAGGCTCCCTCAGAGG + Intergenic
947727859 2:232410886-232410908 GTGTCAGCAGGCTGTCTGGGAGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170410351 20:16082424-16082446 GTGTCAGAGGGCTGCCTCACTGG - Intergenic
1173161024 20:40652822-40652844 GTGTCTGCATGCTCCCTCCCTGG + Intergenic
1175271137 20:57734956-57734978 GTGTCAGGTGGCTCCTTAAGAGG - Intergenic
1178494372 21:33074472-33074494 GTGTCATCAGTTTCCCTTAGAGG - Intergenic
1179134564 21:38668264-38668286 CTGTCAGCACACTCCCTGAGTGG - Intergenic
1180109464 21:45641444-45641466 GAGGCCGCAGGCTCCCGCAGAGG + Intergenic
1180725336 22:17942655-17942677 GTGAGGCCAGGCTCCCTCAGAGG - Intronic
1181175098 22:21030830-21030852 GTGGCAGCTGGCTCCATCTGCGG - Exonic
1181986694 22:26804863-26804885 TTGGCAGCAGGGTCCCCCAGTGG - Intergenic
1182122319 22:27796216-27796238 GTGTCGGCAGCATCACTCAGAGG - Intronic
1183237624 22:36631415-36631437 GTGTCAGCAGTGTCCTTCAGGGG + Intronic
1185371151 22:50461507-50461529 GAGTCTGCAGGCTCACCCAGGGG + Exonic
950310842 3:11956434-11956456 GTGTCATCCGTCTCCCTCACTGG - Intergenic
952920547 3:38281110-38281132 GTGTCTGCAGGTCACCTCAGTGG - Intergenic
954408276 3:50357626-50357648 GTGTCAGCAGGCTCCCTCAGTGG + Intronic
962252062 3:133841510-133841532 GTGTCGGCAGGTGCTCTCAGTGG + Intronic
962375219 3:134853356-134853378 GTGTGAGCAGCCTCTCACAGTGG + Intronic
965597568 3:170423356-170423378 GATTCATCAGGCTCCCTCATAGG - Intronic
967633153 3:191770637-191770659 GGGTCTGCAGGCTCACTCTGTGG - Intergenic
969169527 4:5348753-5348775 GTGTCTGCATGCACCATCAGGGG + Intronic
969418403 4:7075731-7075753 GTGTCTGGAGGCCTCCTCAGTGG + Intergenic
969530072 4:7725671-7725693 GGCTCAGAAGCCTCCCTCAGAGG + Intronic
973216654 4:47676567-47676589 GAGTCTGCAAGCTCCATCAGCGG + Intronic
977564770 4:98569535-98569557 GTGTCAGCAAGCTAGCTCACAGG + Intronic
980185330 4:129454038-129454060 TGGTTAGCAGGCTGCCTCAGTGG + Intergenic
981586414 4:146308112-146308134 GTTACAGCAGCCTTCCTCAGAGG + Intronic
982167548 4:152628488-152628510 GCCTCAGCAGACTCCCTCAGGGG + Exonic
982942097 4:161571656-161571678 ATGTCAGCAGGATCCCCCGGAGG + Intronic
995764320 5:115599645-115599667 CTGTTAGCATGCTGCCTCAGGGG - Intronic
996838683 5:127822680-127822702 GTGGAAGGACGCTCCCTCAGAGG + Intergenic
997312212 5:132896498-132896520 CTGTCATCAGGCTCACTGAGGGG + Exonic
998065812 5:139157500-139157522 GTGTGAGCAGGCTGGCCCAGAGG + Intronic
999231642 5:150065403-150065425 GAGTCAGCAGGCTCCCCTGGAGG - Intronic
1001603366 5:172943456-172943478 GTCTCATCAGGCTCCAGCAGCGG - Intronic
1002101490 5:176860203-176860225 GTGTCACCAAGCCCCCCCAGTGG - Intronic
1002374119 5:178775925-178775947 GTATCAGCAGGCTACATGAGTGG + Intergenic
1006400213 6:33813291-33813313 GTGTGTGGAGGCTCCCACAGAGG + Intergenic
1006502965 6:34469721-34469743 CTGTCAGCAGGCGACCTCAGTGG - Intronic
1007780979 6:44254620-44254642 CTTTCAGCCAGCTCCCTCAGAGG + Exonic
1008644424 6:53499321-53499343 GTGTCATGAGACTGCCTCAGAGG + Intronic
1016947733 6:149549865-149549887 GTGTGGGAAGGCTCCATCAGAGG - Intergenic
1017718487 6:157228622-157228644 CTGTCATCAGGCTCCCTGAGTGG + Intergenic
1021630003 7:22635462-22635484 GTCTCAGCAGGTACCCTAAGGGG + Intergenic
1023357867 7:39385753-39385775 CTGTCAGCAGCCCCTCTCAGAGG + Intronic
1023534059 7:41189571-41189593 GTAGCAGCCAGCTCCCTCAGTGG + Intergenic
1024861931 7:53854056-53854078 GTGGCAGGAGGCTCAGTCAGTGG + Intergenic
1027216314 7:76186058-76186080 GGGTGAACAGCCTCCCTCAGAGG - Intergenic
1030474920 7:110019380-110019402 GTGTCATCAGGGCTCCTCAGAGG - Intergenic
1033641644 7:143267708-143267730 GTATCTGCAGGCTGCCTCAGTGG - Exonic
1035165141 7:156985124-156985146 GGGTCAGCAGGGTCCCTGACAGG - Intergenic
1038514140 8:28169939-28169961 GTGACAGCTTGCTCTCTCAGTGG + Intronic
1039860747 8:41455058-41455080 GTCCCTGCAGGCTCCCTCTGAGG + Intergenic
1040440866 8:47440484-47440506 GAGACTGCAGGCTACCTCAGGGG + Exonic
1047450549 8:124961669-124961691 GTGTCAGCAGGTGGCTTCAGAGG - Intergenic
1049263321 8:141651704-141651726 GTGTGACCTGGCTCCCCCAGGGG - Intergenic
1051150213 9:14071757-14071779 GTGTCCTGAGGCTCCCTCTGAGG - Intergenic
1051376169 9:16404967-16404989 GTGGCAGCAGGAACCGTCAGGGG - Intergenic
1057767489 9:97934831-97934853 GTGGCTGGAGGCTGCCTCAGGGG + Intronic
1060791612 9:126489178-126489200 GTGTCTGCAGGGACCCTCATGGG + Intronic
1189348682 X:40261404-40261426 GTGTCAGCTGGATCTCTCATGGG + Intergenic
1190241891 X:48663269-48663291 GTGGCAGCTGGCTTCATCAGAGG - Intergenic
1190300266 X:49053375-49053397 GCGCCAGTAGGCTCCCTGAGGGG + Intergenic
1191104935 X:56766934-56766956 GAGGCAGGAGTCTCCCTCAGCGG - Intergenic
1191110877 X:56802499-56802521 GTGGCAGGAATCTCCCTCAGAGG - Intergenic
1198274112 X:135085447-135085469 GAGTCAGCCGGCACCCACAGAGG - Intergenic
1198314480 X:135452201-135452223 TTCTCAGCAGGTTCCCTCTGTGG + Intergenic