ID: 954415268

View in Genome Browser
Species Human (GRCh38)
Location 3:50390394-50390416
Sequence CTGAGGGTATGAAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954415258_954415268 11 Left 954415258 3:50390360-50390382 CCCCACTCGTAATATCAGGATGA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 303
954415259_954415268 10 Left 954415259 3:50390361-50390383 CCCACTCGTAATATCAGGATGAG 0: 1
1: 0
2: 1
3: 6
4: 45
Right 954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 303
954415260_954415268 9 Left 954415260 3:50390362-50390384 CCACTCGTAATATCAGGATGAGG 0: 1
1: 0
2: 1
3: 6
4: 66
Right 954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954415268 Original CRISPR CTGAGGGTATGAAGAGAACA GGG Intronic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
902189329 1:14750637-14750659 CTCAGGCTATGTAGAGAAAATGG - Intronic
903130191 1:21274159-21274181 CTGAGGGAGTGAACGGAACAAGG + Intronic
903230726 1:21920869-21920891 CTGGAAGGATGAAGAGAACAGGG - Intronic
903543964 1:24112089-24112111 CCGAGGGCAAGAAGAGAACAAGG - Exonic
904013618 1:27404415-27404437 CTGAGGGTCTGAGAAGAATAGGG + Exonic
904855272 1:33493197-33493219 CTGGGGCTATGAGGAGACCAAGG + Exonic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905798579 1:40829405-40829427 CTGAGGGTATCAAAAGGACAGGG - Intronic
907010526 1:50959208-50959230 TGGAGGGTAAGAAGATAACAAGG - Intronic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907296168 1:53456532-53456554 CTGAAGCTATGAAGTGAATATGG + Intergenic
907988852 1:59559136-59559158 CTCAGCTTATGAAGATAACAGGG + Intronic
908626342 1:66047924-66047946 CTGTGGGTATGAAGAGCTAATGG + Intronic
908951111 1:69564415-69564437 CTGAGGTTCTGAATAGAAAATGG - Intergenic
909292325 1:73899470-73899492 CTGATGATAAGAAGAGAAAAGGG - Intergenic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
912419019 1:109530992-109531014 CTGAGGGTATAAATAGCAGAGGG - Intergenic
912606561 1:110996045-110996067 GTGAGGATATGAAGAAAACAGGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913456494 1:119037012-119037034 CTGAAAATATGAAGAGAATAAGG - Intronic
915637365 1:157195995-157196017 CTGGGGGTATGAAGGCAGCAGGG - Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
919159671 1:193811958-193811980 CTGAGGGGATAAAGAAATCAAGG - Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919757702 1:201076157-201076179 CGGGGGTTAGGAAGAGAACAGGG - Intronic
920608962 1:207418811-207418833 CTGAGAGTATGGGGAGATCAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1062973418 10:1665682-1665704 CTGAGGACATCAAGAGAAAAAGG + Intronic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064012834 10:11749028-11749050 GTGAGGGTAGGAAGAGACCTCGG - Intronic
1067152349 10:43747157-43747179 CACAGGGTTTGATGAGAACATGG + Intergenic
1067246607 10:44552509-44552531 CAGGGGCTGTGAAGAGAACAGGG - Intergenic
1067630316 10:47959134-47959156 CAGAGGGTAGGGGGAGAACATGG + Intergenic
1069722704 10:70559960-70559982 CTGGGGGTCTGCAGAGAACTTGG - Intronic
1069995228 10:72337735-72337757 CTGAGGCTGTGGAAAGAACAGGG - Intronic
1070813447 10:79309792-79309814 GTGAGGGGATGAAAAGACCAAGG + Intronic
1072001568 10:91200396-91200418 GTGAGGGTATAGAAAGAACAGGG + Intronic
1072538807 10:96383014-96383036 CAGAGGGTATGAAGACAGAATGG + Intronic
1073208382 10:101780477-101780499 CTGAGGATAGACAGAGAACAGGG - Intergenic
1073742600 10:106425755-106425777 CTGAGGCTAGAAAGAGAATATGG - Intergenic
1073863779 10:107777309-107777331 CTGAGGTGAAGAAGAGCACATGG - Intergenic
1075514522 10:123098393-123098415 CTGAGGAAATGAACACAACAGGG + Intergenic
1077848117 11:6047367-6047389 CTGATGTAATGAAGAGATCAAGG - Intergenic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1082771651 11:57212392-57212414 CTGAAGGTTTGTAGAGAAAATGG - Intergenic
1084137714 11:67199199-67199221 CTGAGGAGAGAAAGAGAACAAGG - Intronic
1085314391 11:75535569-75535591 CTGGGGGAAAGAAGAGAACCCGG - Intergenic
1085825459 11:79842299-79842321 CTCAGGGTAGGAAAAGCACATGG + Intergenic
1085900650 11:80696000-80696022 CTGAGAGTAGGAGGAGCACAGGG - Intergenic
1086508372 11:87529008-87529030 CTGAGGGTGGGAAGAGGCCAGGG + Intergenic
1087415170 11:97846095-97846117 GAGAGGTGATGAAGAGAACATGG + Intergenic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1090117580 11:123990130-123990152 CTTAGGGTAGAAAGACAACATGG - Intergenic
1090333006 11:125945896-125945918 CTGAGGGTAACAGGAGAGCAGGG + Intergenic
1090870392 11:130739703-130739725 CTGAAGACATGAGGAGAACAAGG + Intergenic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1092084326 12:5743165-5743187 CTGAGCGTATGAGGAGAAGGAGG - Intronic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1093743162 12:22711233-22711255 CAGAGCCTATGAGGAGAACAGGG - Intergenic
1096006363 12:48175878-48175900 CTGAGGGTATTAAGAGACTGTGG + Intronic
1098385928 12:69918391-69918413 ATGAAAGTAGGAAGAGAACATGG + Intronic
1098988750 12:77041673-77041695 TTGGAGGCATGAAGAGAACATGG - Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1102019076 12:109669203-109669225 CTGCTGGTGTGAACAGAACAAGG + Intergenic
1102614199 12:114138768-114138790 CTGAGGGTGTGCAGAGAGCTAGG + Intergenic
1103130549 12:118464773-118464795 ATGAGGGCCTGAATAGAACAAGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1105522512 13:21143605-21143627 CTGAGGGTATAAAGTCAAGACGG + Intronic
1107057099 13:36118214-36118236 ATGAGGGGCTGAAGTGAACATGG + Intronic
1107332948 13:39321095-39321117 CTGAGGGCCTGAAAAGAACAAGG + Intergenic
1108174158 13:47774917-47774939 TTAAGGGTATGAAGAGGACTAGG + Intergenic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1111499387 13:89095665-89095687 CTGAGTGGATAAAGAAAACATGG + Intergenic
1113773265 13:112926080-112926102 ATGAGGGGATAAACAGAACATGG + Intronic
1114005021 14:18302873-18302895 CACAGGGTTTGAAGAGTACAGGG - Intergenic
1114808441 14:25865120-25865142 GTGAGGCTATGAGGAGACCAAGG - Intergenic
1115444356 14:33472212-33472234 CTGAGGTTATGTAGATAACTGGG + Intronic
1115517048 14:34195854-34195876 CTAAGGAAATGAAGACAACAAGG - Intronic
1116305550 14:43250060-43250082 CTGAGAGTATGAAGAGGCCAAGG - Intergenic
1117582336 14:57164621-57164643 CTGAGGGCATGAAGAGAGGGTGG + Intergenic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118077241 14:62313071-62313093 GTGGGGGTATGAAGAGAGCTTGG - Intergenic
1118384233 14:65242069-65242091 CTGGGGATATGCAGAGAGCAAGG - Intergenic
1118639103 14:67775876-67775898 CTGAGGGTATGGAAAGTCCAGGG + Exonic
1119540785 14:75436885-75436907 CTCTGAGAATGAAGAGAACATGG + Intronic
1120342943 14:83245147-83245169 CTGTGGGTAAGAAGATAGCAAGG + Intergenic
1120563029 14:86019701-86019723 CTGAGGGTCTGGCTAGAACAGGG - Intergenic
1120685596 14:87532804-87532826 CTCAGGGTAGGGAAAGAACAAGG + Intergenic
1122541087 14:102497946-102497968 CTGAGGGTACGAAGTTCACATGG + Intronic
1122716588 14:103700042-103700064 CTGAGCGTCTGAAGAGGTCATGG - Intronic
1123389476 15:19855107-19855129 CACAGGGTTTGAAGAGTACAGGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1126111891 15:45180033-45180055 CTGAGGGCATGAATAGAACAAGG - Intronic
1126339717 15:47625972-47625994 CTCAGGGCTTGAAGAGACCAGGG + Intronic
1127369826 15:58329403-58329425 CTGAGGGTAGGAAGAGTAGGAGG + Intronic
1127684766 15:61332538-61332560 CAGAGGCTATTAAGAAAACATGG - Intergenic
1131343656 15:91626709-91626731 CTAAGGGGATGAAGAGAGGAGGG + Intergenic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1135482549 16:22832991-22833013 CTGAGGGTATCAACAGTCCAGGG - Intronic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136483837 16:30558469-30558491 ATGAGGGTACGGAGAGAACGCGG - Intronic
1136636509 16:31527758-31527780 CTGAAGGTAGAAAGATAACAAGG - Intergenic
1137370023 16:47896500-47896522 CAGAGGGTATGAAGAGAGACTGG - Intergenic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1139910444 16:70394345-70394367 CTGAGGGGATGAGGAGGACAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141838088 16:86555733-86555755 CTCAGGGTATGCAGAGGTCAGGG - Intergenic
1143063159 17:4220732-4220754 ATAAGGGTAGGCAGAGAACAAGG + Intronic
1145006569 17:19341921-19341943 CTGGTGGTTTGAAGAGCACAGGG + Intronic
1149100860 17:52904630-52904652 ATGAGGGTCTGCAGAGATCAGGG + Intergenic
1149612646 17:57968762-57968784 CTGAGAGGATGAGGAGATCAAGG - Intergenic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1153937644 18:9944201-9944223 CTGAGGGGCTGTAAAGAACAGGG + Intronic
1154059127 18:11042369-11042391 CTGTGTGTATGAAGTGCACATGG - Intronic
1157155223 18:45258926-45258948 CTGAGGTGATGTAGAGATCAAGG - Intronic
1157581537 18:48776759-48776781 CTGCGGGTGGGAAGAGAAGATGG + Intronic
1157780204 18:50431689-50431711 CTGGGGGTATAAAGAAAACAAGG - Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159984038 18:74820730-74820752 CTGAGGCAGTGAAAAGAACAAGG - Intronic
1160290098 18:77584539-77584561 ATGAGGTTATGAATGGAACAAGG + Intergenic
1166565272 19:43761300-43761322 CTGAGAGGTTGAAGAGAGCAGGG + Intergenic
1167691750 19:50989242-50989264 GGGAGGGTATGAAGAGGATAAGG - Intergenic
1168176990 19:54633446-54633468 CAGAGGGAAGGAGGAGAACAGGG + Intronic
1168239110 19:55080486-55080508 ATGAGGACATGAACAGAACATGG + Intronic
1168405190 19:56106999-56107021 CTGAGAGTCTGAGGAGAACTCGG + Intronic
925646069 2:6037936-6037958 CTGAGCGTAAGAGGGGAACAGGG - Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
926654806 2:15390108-15390130 CTGAGGCTAGGAAAAGAAAAGGG + Intronic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927621017 2:24658887-24658909 CTGGGGGAAGGAAGACAACATGG - Intronic
931001189 2:57784460-57784482 ATGATGGTATAAAGAGAGCATGG - Intergenic
931070630 2:58644766-58644788 CTGAAGGGTTGAAGAGAAAATGG + Intergenic
931312921 2:61099690-61099712 GTGAGTGTATGAAGAGCAGAGGG + Intronic
931634392 2:64328528-64328550 CCCAGGGAGTGAAGAGAACAGGG - Intergenic
931823506 2:65975952-65975974 CCTAGGGTATGTACAGAACATGG - Intergenic
931991663 2:67796659-67796681 GAGAGGGTATGAAGAAAAAATGG - Intergenic
932148197 2:69343391-69343413 GTGAGGAGATGAAGAGAGCAGGG - Intronic
933918364 2:87019242-87019264 CTGAGGGTACACAGAGCACAGGG + Intronic
934004632 2:87750671-87750693 CTGAGGGTACACAGAGCACAGGG - Intronic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935416272 2:102822432-102822454 CTGAGGGGATGAGTAGGACAAGG + Intronic
935767590 2:106384704-106384726 CTGAGGGTACACAGAGCACAAGG - Intergenic
938089619 2:128422764-128422786 CTTAAGGCATGATGAGAACATGG + Intergenic
939294583 2:140243734-140243756 GTGCTGGTATCAAGAGAACAAGG - Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
939753054 2:146072813-146072835 TTGAGGGTCTGAATAGAAGAAGG + Intergenic
940736867 2:157463620-157463642 CTGAGGGTCTGAAGAGTGCCAGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941782754 2:169462453-169462475 GTGAGGGTATAAGGAGAAAATGG - Intergenic
941870039 2:170374371-170374393 GTGAGGGGATGATGAGAAAAGGG + Intronic
942090841 2:172489189-172489211 CTGGGCGTATGTTGAGAACATGG + Intronic
942690300 2:178577861-178577883 CTGAGGTTATTAACATAACAAGG - Exonic
944870531 2:203907136-203907158 TTGAGGGCCTGAGGAGAACAAGG + Intergenic
947068993 2:226264851-226264873 ATGAGTGTGAGAAGAGAACAAGG - Intergenic
947988768 2:234470695-234470717 CTGCTGATATAAAGAGAACAAGG - Intergenic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170471321 20:16670834-16670856 CTGAGAGTAAAAAGAGAACATGG - Intergenic
1172019657 20:31905050-31905072 CTGAGGGTTTATAGAGCACATGG + Intronic
1172895946 20:38300077-38300099 CTGAGGGGAGGGAGAGTACAGGG + Intronic
1173936593 20:46871327-46871349 CTTGGGCTATGAAGAGAACAGGG - Intergenic
1174124943 20:48297411-48297433 CTCAGGGTAGGGACAGAACAGGG + Intergenic
1176636603 21:9249657-9249679 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
1177428425 21:20957064-20957086 CTCAGGGTATTCACAGAACATGG - Intergenic
1177816651 21:25985417-25985439 CTGAGGGTCTGAAAACAAAAGGG + Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1180058593 21:45373522-45373544 CTGAGGGTGTTAAGAGGATAAGG - Intergenic
1180429533 22:15233663-15233685 CACAGGGTTTGAAGAGTACAGGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181825534 22:25512498-25512520 CAGAGAGTATAAAGAGAGCAGGG - Intergenic
1181913909 22:26263780-26263802 CTGAGAGAAGGAAGAGATCAAGG - Intronic
1181928706 22:26381467-26381489 CTGAGGAGGTGCAGAGAACAGGG + Intronic
1183582976 22:38736496-38736518 CTGGGGCTCTGAAGAGAACCAGG + Intronic
1183722678 22:39571612-39571634 CTGAGGCTCAGAAGAGCACAGGG - Intronic
1184638463 22:45855369-45855391 CTGAGGGCCTGAAAAGAACAAGG - Intergenic
1184824522 22:46939353-46939375 CTAAGGATATGAAGGGAATATGG + Intronic
949322950 3:2832064-2832086 CTCAGGGTAGCAAGAGAAGAAGG - Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950595628 3:13978695-13978717 CTCTCGGTATGAAGAGAAAAAGG - Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
950954291 3:17034952-17034974 CCGAGGGCAGGAAAAGAACAAGG - Intronic
951404001 3:22271557-22271579 TTAAGGGTATGAAGAGAATGTGG - Intronic
951655882 3:25007880-25007902 CTGTGGGTATAAAGCGAGCATGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954793232 3:53148051-53148073 CAGAGGGTGTGAAGAGAGCTTGG - Intergenic
954868514 3:53749593-53749615 CTGAGGGTGTGCTTAGAACAGGG - Intronic
956009203 3:64812655-64812677 CAGAGTGTATGAAGAAAATATGG - Intergenic
956079126 3:65538677-65538699 CTGAGGGTTAGATGAGAGCATGG - Intronic
956201368 3:66709742-66709764 CTGAGGGGATAAACAGAAAAAGG - Intergenic
956437922 3:69252467-69252489 CTGAGGGTTTTAAAAGAATATGG - Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
960068491 3:113402106-113402128 CTGCTGGTATGTAGAAAACAGGG - Intronic
960663421 3:120086390-120086412 CTGAAGTGATGAAGAGAACTGGG - Intronic
963268717 3:143265026-143265048 CTGAAGGAATGAAGAGAGCAGGG - Intergenic
966883163 3:184361204-184361226 CTGAGGGCCTGCAGAGGACAAGG - Intronic
966893808 3:184427425-184427447 CTGAGCTTATGAAGATAAAAAGG + Intronic
967812552 3:193773014-193773036 CTCAGAGTAGGAAGAGAACGTGG - Intergenic
1202750292 3_GL000221v1_random:155362-155384 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969703948 4:8782083-8782105 CTGAGAGTCAGAAGAGGACAGGG + Intergenic
970022594 4:11585899-11585921 CTGAGAGCATTAAGAAAACAAGG - Intergenic
970167218 4:13251499-13251521 CTGAGAGTTTGGAGAGACCAAGG + Intergenic
972400323 4:38695917-38695939 CTGAGGTTTGGAAGAGAAAAGGG + Intronic
972632320 4:40853155-40853177 CAGAGGGCATGAAGAGAAGCAGG - Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974958614 4:68673230-68673252 CTGAGGGTTTGAAGAGGGAAGGG - Intergenic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
978041183 4:104064705-104064727 CTGAGGATATGCAGTGAACTCGG - Intergenic
979009967 4:115355228-115355250 CTAAGGCTGTGCAGAGAACAGGG - Intergenic
979411775 4:120388062-120388084 CTGTGGTTATGCAGAGACCAAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980746250 4:137020456-137020478 CTGAGAGTCTACAGAGAACAAGG + Intergenic
980920040 4:139075039-139075061 CTGAGGCTCTGAAGAGAGCGAGG - Intronic
982795703 4:159641151-159641173 CAGATGGCAAGAAGAGAACATGG - Intergenic
983203167 4:164884288-164884310 TTGAAGAGATGAAGAGAACATGG - Intronic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984636087 4:182111292-182111314 CAGAGTGTATGAAGAGAAGCTGG - Intergenic
985099889 4:186448509-186448531 CTCAGGGTGAGCAGAGAACAGGG - Intronic
985106242 4:186502899-186502921 CTGGGACTATGACGAGAACAAGG - Intronic
1202751491 4_GL000008v2_random:8096-8118 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
985865244 5:2509343-2509365 CTGAGGGCATGAACAGAGAAAGG - Intergenic
986085893 5:4445950-4445972 CTGAAGGCTTGAATAGAACATGG - Intergenic
986253496 5:6082435-6082457 GAGAAGGTCTGAAGAGAACAGGG - Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987426810 5:17782400-17782422 CTGAGAGCAGGAAGAGAACCTGG + Intergenic
989550189 5:42726154-42726176 CTGGGTGAATAAAGAGAACAAGG - Intergenic
991177325 5:63704826-63704848 CTGAGGGAATTAAAACAACAAGG + Intergenic
991524716 5:67543684-67543706 CTGGGTGTATGCAAAGAACAAGG + Intergenic
992849984 5:80797277-80797299 CTGTAAGCATGAAGAGAACAGGG + Intronic
992970811 5:82055629-82055651 CTCAGGATATTCAGAGAACACGG - Intronic
994588133 5:101737775-101737797 TTCAGGGTATAAAGAGAAAATGG + Intergenic
994787192 5:104180112-104180134 CTGAGACTTTGAAGAAAACATGG + Intergenic
994916131 5:105982499-105982521 CTGAGAGTAGGAAGAGGCCAGGG - Intergenic
995558093 5:113351302-113351324 ATGAATGGATGAAGAGAACATGG + Intronic
996000958 5:118362973-118362995 CTGAGGAGATGAATAGAACCAGG - Intergenic
996058940 5:119011437-119011459 CTGAGTGGGTGAAGAGAACCTGG + Intergenic
996523535 5:124452778-124452800 CAGAGGGTAGGAAGAGAATGAGG + Intergenic
997164800 5:131648806-131648828 CTGCGGGTAAGAAGAGAATAAGG - Intronic
997835077 5:137185640-137185662 CAGAAGGAATGCAGAGAACATGG + Intronic
998351249 5:141503103-141503125 CAGAGGGTATGAAGAGAGGCAGG - Intronic
999213904 5:149915535-149915557 CTGAGGGTCAGCAGAGGACAGGG - Intronic
999275162 5:150325363-150325385 GTGAGGGGAGGAGGAGAACAGGG + Intronic
1000786621 5:165552519-165552541 TTCAGGGTGTGAAGGGAACAAGG - Intergenic
1000804117 5:165767057-165767079 CTGAGGATGGGAAGAGAACTGGG + Intergenic
1001018157 5:168160310-168160332 CTCACGGTATGAAGTGAACAGGG + Intronic
1002190628 5:177475610-177475632 ATGAGGGGATGAAGATAACCTGG - Intergenic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1003374060 6:5558241-5558263 CAGAGGGTAAGAGGAGCACATGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004739885 6:18448442-18448464 CTGAGAGTGAGAAGAGAAAAGGG + Intronic
1006258791 6:32852058-32852080 ATGAGGATATGAACAGTACATGG + Intronic
1006690174 6:35876898-35876920 CTGAGAGTCTGGAGAGACCAAGG + Intronic
1007907859 6:45481724-45481746 CTGAGGGAAAGAAGAAAACGTGG - Intronic
1008388689 6:50923487-50923509 CTGAGAGTCTGAAGAGATCAAGG - Intergenic
1009731397 6:67612567-67612589 GTGAGGGAATGAAAAGAACAAGG - Intergenic
1013184970 6:107749633-107749655 GTGATGGTCTGTAGAGAACAGGG - Intronic
1013281782 6:108644600-108644622 ATGAGGGCAGGTAGAGAACAGGG - Intronic
1014563277 6:122917049-122917071 CTCAGGGTATTAACAGGACATGG - Intergenic
1015652073 6:135474526-135474548 CTGAGAGTATGAGTAGAACAAGG + Intronic
1015698743 6:136011236-136011258 ATCAGGGTATCAAGAGAGCAGGG + Intronic
1016219058 6:141644307-141644329 CTTAGTGTATAAAGAAAACAAGG + Intergenic
1017071887 6:150582580-150582602 TGGTGGGTAAGAAGAGAACAGGG - Intergenic
1017854812 6:158341062-158341084 AGGAGGGAATAAAGAGAACATGG - Intronic
1018128426 6:160704832-160704854 CTGAGGGTACACAGAGCACAAGG - Intronic
1018523306 6:164677911-164677933 CACAGGGCATGAAGAGAATATGG + Intergenic
1018710562 6:166495594-166495616 ATGAGGGAGTGAAGACAACAGGG - Intronic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1019936517 7:4261735-4261757 CAGAGGGTATCAAGGGAACTGGG - Intronic
1021136889 7:16975913-16975935 CTAAGGGTAAGAAGAGAAAGAGG + Intergenic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024997314 7:55282016-55282038 TTGAGGGAATGAAGAGCACCAGG + Intergenic
1025705860 7:63862791-63862813 CTGAATGGATGAAGAGAATATGG - Intergenic
1027047420 7:75000346-75000368 GTGAGGGAATGAAGGGATCAGGG - Intronic
1027440660 7:78216029-78216051 CTGAAAGTATGAAGAGATCAAGG + Intronic
1027543268 7:79494922-79494944 CTGAGGGTGAGATGAGAACGTGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1029385568 7:100241283-100241305 GTGAGGGAATGAAGGGATCAGGG + Intronic
1029805215 7:102988926-102988948 ATAAGGGTATGAAGAGATCCAGG + Intronic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030605844 7:111638519-111638541 GTGAAGGTTTGAAGAGAAAAAGG - Intergenic
1031989285 7:128186455-128186477 TTGAGGGAAGGAAGAGAAGAAGG - Intergenic
1032263042 7:130351803-130351825 CTGAGGGGATCCAGAGGACAGGG - Intronic
1032559779 7:132876993-132877015 CTTAAGGTAAGATGAGAACATGG - Intronic
1034323577 7:150208226-150208248 CTGAGAGTCTGGGGAGAACAAGG + Intergenic
1034533334 7:151711248-151711270 CTGAGAGTATGAAGAGTGCTAGG + Intronic
1034769617 7:153760961-153760983 CTGAGAGTCTGGGGAGAACAAGG - Intergenic
1035288724 7:157823568-157823590 CTTGGGGGATGAAGACAACAGGG - Intronic
1038688184 8:29737731-29737753 CTGAGGGTATGAAAGGTACTTGG - Intergenic
1040905055 8:52460192-52460214 CTGAGAGTATGAGTAGAAGAAGG + Intronic
1041179492 8:55232917-55232939 CAGAGGCTATTAAGAGAGCAAGG - Intronic
1041487152 8:58392037-58392059 CTCAGGGGAAGAAGAGGACAAGG - Intergenic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1046032095 8:108794863-108794885 AAGATGGTATGAAGAGTACAAGG - Intergenic
1047564199 8:126023790-126023812 CTGAGTGAATGAACAGAAAATGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048812059 8:138297660-138297682 CTGGGAGTATGAAGAGAAGGAGG + Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1052472813 9:28921579-28921601 CTGAGACTATGCAGAAAACAGGG + Intergenic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1055649894 9:78396898-78396920 ATTAGGATATGAAGACAACACGG - Intergenic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1059429218 9:114240197-114240219 CTGAGGGGAAGCAGAGAGCAGGG - Intronic
1061079327 9:128360771-128360793 GTGAGGGTAGGGAGAGGACAAGG + Exonic
1061342306 9:129992312-129992334 CTGAAAGTAGGAATAGAACATGG - Intronic
1203718932 Un_KI270742v1:185455-185477 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1203653166 Un_KI270751v1:149130-149152 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1186093580 X:6075965-6075987 CTGAGGCAAGGAAGAGAATATGG + Intronic
1188772145 X:34165613-34165635 CTGAGGGTATTAAGAATAAATGG + Intergenic
1191996321 X:67099292-67099314 CTTAGTGTAAGAAGAGAACTAGG - Intergenic
1192285569 X:69731823-69731845 CTAAGGTTAAGAACAGAACAAGG - Intronic
1194984071 X:100471151-100471173 CTGAGGGTAGGAGGAGAGTAAGG + Intergenic
1195625384 X:107000766-107000788 ATGAAGGAATGAAGAAAACAAGG + Intergenic
1196932546 X:120695981-120696003 CAGAGGGTCTGAAGCGATCAGGG + Intergenic
1196969180 X:121090187-121090209 CTGAGAGTATAGGGAGAACAAGG - Intergenic
1201173088 Y:11290297-11290319 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1201396555 Y:13554897-13554919 CTGAGACTCTGAAGAGAAAATGG + Intergenic