ID: 954417335

View in Genome Browser
Species Human (GRCh38)
Location 3:50399739-50399761
Sequence GTGGTAAAGCCCAGCAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954417319_954417335 26 Left 954417319 3:50399690-50399712 CCCCAGACCCCTAGGTAGGAAGA 0: 1
1: 0
2: 0
3: 13
4: 206
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417320_954417335 25 Left 954417320 3:50399691-50399713 CCCAGACCCCTAGGTAGGAAGAG 0: 1
1: 0
2: 2
3: 15
4: 175
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417321_954417335 24 Left 954417321 3:50399692-50399714 CCAGACCCCTAGGTAGGAAGAGG 0: 1
1: 0
2: 2
3: 9
4: 149
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417328_954417335 17 Left 954417328 3:50399699-50399721 CCTAGGTAGGAAGAGGGGGCATC 0: 1
1: 0
2: 1
3: 13
4: 161
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417333_954417335 -10 Left 954417333 3:50399726-50399748 CCAGGTTCGCCTGGTGGTAAAGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417327_954417335 18 Left 954417327 3:50399698-50399720 CCCTAGGTAGGAAGAGGGGGCAT 0: 1
1: 0
2: 3
3: 10
4: 135
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417332_954417335 -9 Left 954417332 3:50399725-50399747 CCCAGGTTCGCCTGGTGGTAAAG 0: 1
1: 0
2: 1
3: 8
4: 74
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91
954417326_954417335 19 Left 954417326 3:50399697-50399719 CCCCTAGGTAGGAAGAGGGGGCA 0: 1
1: 0
2: 0
3: 18
4: 175
Right 954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954417335 Original CRISPR GTGGTAAAGCCCAGCAGTAT TGG Intronic
900184406 1:1326155-1326177 GTGGTAAAACCCATCTGTGTGGG + Intronic
900821723 1:4894843-4894865 GAGGGAAAGCCCAGCAGTGGGGG + Intergenic
901637447 1:10676906-10676928 GTGGCAGAGCCAGGCAGTATGGG - Intronic
903300065 1:22372422-22372444 GGGGTGGAGCCCAGCAGTGTGGG + Intergenic
909037407 1:70609659-70609681 GTGGTGAAGTGCAGCAGTGTAGG - Intergenic
910400789 1:86835952-86835974 GTGGGTAATCCCAGCAGTTTGGG - Intergenic
913165015 1:116177183-116177205 GTGGCCAAGCCCAGCAATCTGGG + Intergenic
917291479 1:173476700-173476722 GTGGCAAGACCCAGAAGTATGGG - Intergenic
917503477 1:175606831-175606853 GTGTGAAAGCCCAGCAACATGGG + Intronic
917655605 1:177122539-177122561 GTGGTGAGGCGCAGCAGGATAGG - Intronic
1068488144 10:57685723-57685745 GGGGTAAAGCCCTGCAGTATTGG - Intergenic
1080522557 11:33080135-33080157 GTGGCTAATCCCAGCAGTTTGGG + Intronic
1081898679 11:46609181-46609203 GTGCTAAATCCCAGCACTTTTGG - Intronic
1084656603 11:70523330-70523352 GTGGTAAAACACAGCAGGGTAGG + Intronic
1086236325 11:84635318-84635340 GTGGTAATGGGCATCAGTATTGG - Intronic
1088188189 11:107197108-107197130 GTGGTACTGCCCAGCACAATGGG - Intergenic
1090305416 11:125687244-125687266 GAGGTAAATCCCAGAAGAATGGG + Intergenic
1093468419 12:19475048-19475070 GTGGTTAATCCCAGCACTTTGGG - Intronic
1095857469 12:46875874-46875896 TTGCCAAAGCCCAGCAGAATAGG - Intergenic
1102578357 12:113871666-113871688 CTGGAAAAGCACAGCAGTCTGGG + Intronic
1103705402 12:122868460-122868482 GAGGTAAAGCCCACCAGCCTTGG - Exonic
1106676987 13:31971000-31971022 GTGGTGAAGCCCATGAGTCTGGG - Intergenic
1108604929 13:52027997-52028019 CTGGTAAATCCCAGCACTTTGGG + Intronic
1110809923 13:79800991-79801013 TTTGTAAAGCCAACCAGTATAGG - Intergenic
1114703722 14:24705236-24705258 GTGGTAAGGCCCTGCTGTAGAGG - Intergenic
1119314059 14:73676631-73676653 ATCGAAATGCCCAGCAGTATAGG - Intronic
1119530780 14:75359694-75359716 GGGGTAAAGCTCAGCACTCTGGG + Intergenic
1125248791 15:37675570-37675592 GGGGTAGAGCCCAGCAGTTTGGG + Intergenic
1126527536 15:49673498-49673520 GTAGTAAGGCACAACAGTATGGG + Intergenic
1127461817 15:59206133-59206155 CTTATAAAGCCCATCAGTATTGG - Intronic
1128110482 15:65072875-65072897 GTGGTATGGCCCAGCACTTTGGG + Intronic
1129661697 15:77556354-77556376 GTGCCAAAGCACAGCAGAATTGG - Intergenic
1131508879 15:93038098-93038120 GTTGAAAAGCCCTGCAGGATGGG + Intronic
1137633368 16:49964401-49964423 GTGGTAACGACCACAAGTATGGG - Intergenic
1143239992 17:5435690-5435712 GTTGCATAGCCCAGCAGTTTTGG - Intronic
1151428166 17:74044729-74044751 GAGGTAAAGCCCAGAAATATAGG + Intergenic
1152253796 17:79225839-79225861 GGGGTAAAGCCCAGGAGTGCAGG - Intronic
1153525119 18:5987390-5987412 GGGGCGAAGCCCAGCAGTGTGGG + Intronic
1155097231 18:22569395-22569417 GCTGGAAAGCCCAGCAATATAGG - Intergenic
1162146306 19:8614070-8614092 GCTGTAAATCCCAGCAGTTTGGG - Intergenic
1165971791 19:39637940-39637962 GGTGTAAAGCCCACCAGGATGGG + Intergenic
929407977 2:41665209-41665231 GTGGGAAAGTCTAGCAGTTTAGG - Intergenic
929553313 2:42907849-42907871 GAGATCAAGCCCAGCAGTTTTGG + Intergenic
933709365 2:85314399-85314421 GTGGGGAAGCCCAGCTGTTTAGG + Intergenic
935129646 2:100252037-100252059 GTGGTTAGGCCCAGCTTTATCGG - Intergenic
937023736 2:118680709-118680731 GTGGAAAGGCCCAGCAGGAGTGG - Intergenic
937819291 2:126289845-126289867 TTGGTAAAGTCCAGAAGTTTAGG - Intergenic
939883150 2:147652450-147652472 ATGGTAAATCCCAGTAGTCTAGG - Intergenic
944290352 2:197997588-197997610 GTAGACAAGCCCAGCAGTGTGGG + Intronic
945996870 2:216444906-216444928 GTGGGAAAACCCTGCAGAATAGG - Intronic
948253687 2:236551075-236551097 GTGGAAGAGCCCAGCAGGGTAGG - Intergenic
1175086783 20:56466223-56466245 CTGATAAAACCCAGCAGTACCGG - Intergenic
1178761272 21:35405079-35405101 GTGGTAAAGCCAAACAGAAGTGG - Intronic
1184081924 22:42227863-42227885 GTGGTAAATATCAGCAGTAGTGG - Intronic
1184170314 22:42755304-42755326 GTGGCAAATCCCAGCACTTTGGG + Intergenic
954417335 3:50399739-50399761 GTGGTAAAGCCCAGCAGTATTGG + Intronic
957296169 3:78335612-78335634 TTGGTAAAACCCAGCAGGTTAGG + Intergenic
957551913 3:81717290-81717312 GTGGCAAAGACCAGAGGTATGGG + Intronic
957743631 3:84307479-84307501 GTGTTAATGCACAGCAGAATAGG - Intergenic
958332594 3:92509207-92509229 GTGGAAAATTCTAGCAGTATGGG + Intergenic
958352491 3:92835354-92835376 GTGGAAAATTCTAGCAGTATGGG + Intergenic
961641722 3:128368893-128368915 GTGCTACAGCCCAGCAATACGGG - Intronic
968291795 3:197544785-197544807 GTGGTGAATCCCAGCACTTTGGG + Intronic
969024986 4:4165945-4165967 GTGTTCAAGCCCTGCAATATTGG - Intergenic
976281052 4:83327269-83327291 GTGGTAAACCCAAACAGTATTGG - Intronic
979899312 4:126198113-126198135 GTGGTAAAACACAGGATTATAGG - Intergenic
981232934 4:142379756-142379778 TTGGCAAAGCCAAGCAGTAATGG + Intronic
982144598 4:152371092-152371114 GTGGAAAGGCCCAGCATTTTTGG - Intronic
982164366 4:152601754-152601776 CTGGTAAATCCCAGCACTTTGGG + Intergenic
992000941 5:72435928-72435950 GTGGTAGAGCACAGCAGGAGAGG - Intergenic
994396268 5:99227994-99228016 GTGTAAAACCCCTGCAGTATTGG + Intergenic
995277766 5:110296521-110296543 GTGGTAAAGACCAGGAGCTTTGG + Intronic
998002492 5:138636061-138636083 GTGGTTGGGACCAGCAGTATTGG - Intronic
1007899216 6:45394536-45394558 GTGGTAAAGCACAGGAGCAGAGG + Intronic
1009226091 6:61021248-61021270 GTGTTCAAACCCTGCAGTATTGG + Intergenic
1014960182 6:127673483-127673505 GTGTTAGAGCCCAGCAATATTGG - Intergenic
1021648529 7:22810086-22810108 GTGATGAAGCCCAGCAATGTGGG - Intergenic
1021678019 7:23100426-23100448 GAGGTAAAGCCCCACAGAATAGG + Intergenic
1021852371 7:24821284-24821306 GCGGTAAGTCCCAGCAGTTTTGG + Intronic
1024213476 7:47227322-47227344 GTGGGAAGGCCCAGCAGGACAGG - Intergenic
1031729814 7:125285556-125285578 GTGGTAAAGAGCAGGACTATTGG - Intergenic
1032514592 7:132497283-132497305 GTTGTAAAGCTCTGCAGTACAGG + Intronic
1038023956 8:23572778-23572800 GTGGTGGAGCCCAGTAGAATTGG + Exonic
1038206501 8:25471619-25471641 GTGGCAAATCCCAGCACTTTGGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043570013 8:81592465-81592487 GTGGTAAAACCCAGGAGAGTTGG - Intergenic
1043574632 8:81643604-81643626 GTGGTAAAACTCAGGAGAATTGG - Intergenic
1044105351 8:88198265-88198287 GAGGTAAAGGACAGCAGGATGGG - Intronic
1044691633 8:94885976-94885998 GTGGTTAATCCCAGCACTTTGGG - Intronic
1046771675 8:118122820-118122842 GTGGTTAAACACAACAGTATTGG + Intergenic
1048898178 8:139013566-139013588 GTGGAAAAGCCCAGCAGAAGAGG + Intergenic
1053462520 9:38281565-38281587 GTGGTGGAGCCCAGCACTCTGGG + Intergenic
1057253575 9:93524535-93524557 CTGGGGAAGCCCAGCACTATAGG - Intronic
1057530278 9:95839034-95839056 GTGATAGAACCCAGGAGTATGGG - Intergenic
1059323327 9:113486171-113486193 GTAATAAAGGCCATCAGTATGGG + Intronic
1061351250 9:130066648-130066670 GTGGTCAAGCCCAGCACACTGGG + Intronic
1187464017 X:19513109-19513131 GTGGTACAGCCCAACATTCTAGG + Intronic
1194992576 X:100560748-100560770 GTGGTAAAGTCAAGCAATTTGGG - Intergenic