ID: 954417928

View in Genome Browser
Species Human (GRCh38)
Location 3:50403167-50403189
Sequence GAGGGGCCCTGGCAGTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954417928_954417942 26 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417942 3:50403216-50403238 AGCAGGGCATAGACAGCGAACGG 0: 1
1: 0
2: 1
3: 14
4: 152
954417928_954417936 -3 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417936 3:50403187-50403209 CTCCCAGGGCTGTGAGGATGTGG 0: 1
1: 0
2: 7
3: 73
4: 618
954417928_954417943 27 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417943 3:50403217-50403239 GCAGGGCATAGACAGCGAACGGG 0: 1
1: 0
2: 0
3: 7
4: 103
954417928_954417932 -9 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417932 3:50403181-50403203 GGGCCCCTCCCAGGGCTGTGAGG 0: 2
1: 1
2: 6
3: 64
4: 506
954417928_954417940 9 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417940 3:50403199-50403221 TGAGGATGTGGATGGAGAGCAGG 0: 1
1: 0
2: 6
3: 81
4: 605
954417928_954417939 1 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417939 3:50403191-50403213 CAGGGCTGTGAGGATGTGGATGG 0: 1
1: 1
2: 3
3: 60
4: 570
954417928_954417941 10 Left 954417928 3:50403167-50403189 CCAAAACACTGCCAGGGCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 228
Right 954417941 3:50403200-50403222 GAGGATGTGGATGGAGAGCAGGG 0: 1
1: 0
2: 5
3: 77
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954417928 Original CRISPR GAGGGGCCCTGGCAGTGTTT TGG (reversed) Intronic
900002330 1:21584-21606 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
900022049 1:192108-192130 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
900125044 1:1065192-1065214 GCGGGGCCCTGGGGGTGTTGTGG + Intergenic
900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG + Intronic
900508158 1:3040307-3040329 AAGGGGACCTGGCAGAGCTTAGG - Intergenic
900957043 1:5892542-5892564 GAAAGGCCCTGGCAGTGCTGGGG + Intronic
901534603 1:9874059-9874081 GCGGAGCCCTGGCAGGGTCTTGG - Intronic
902648407 1:17820133-17820155 GAGGGGACATGGCAGAATTTGGG - Intronic
902755871 1:18548739-18548761 GAGGGGGACTGGGAATGTTTGGG + Intergenic
904337415 1:29807085-29807107 GAGGTGTCCTGGCAGGGTGTGGG + Intergenic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
910863171 1:91763412-91763434 GAGTTTCCCTGGTAGTGTTTTGG - Intronic
911694964 1:100880013-100880035 GAGGAGACTTGGCAGTGGTTGGG + Intronic
912734618 1:112139317-112139339 CAGGGGCCATGTCTGTGTTTAGG + Intergenic
918093113 1:181314354-181314376 GAGGGGCACTAGCCCTGTTTTGG + Intergenic
919716001 1:200777200-200777222 GTGGGGCCCAGTCTGTGTTTTGG + Intronic
920845313 1:209588643-209588665 GAGGTGACCTGGCAGTTTTAGGG + Intronic
924919407 1:248612010-248612032 GCAGGGTCCTGGCAGTGTTGTGG - Intergenic
1063138816 10:3238993-3239015 GAGGAGCCCCGGGTGTGTTTAGG - Intergenic
1067580695 10:47443757-47443779 GAGGGGTCCTGGCAGCCTTATGG + Intergenic
1067797364 10:49330468-49330490 GAGGGGCCATGCCAGGGTCTTGG + Intergenic
1070387499 10:75939173-75939195 GAGGGGCCCTGGACCTGTGTGGG + Intronic
1070604086 10:77886294-77886316 GAGGGTCAGTGGCAGTGTTCAGG - Intronic
1071488955 10:86123121-86123143 CCGGGGCACTGGCAGTGTTGGGG - Intronic
1073300810 10:102470136-102470158 GAGGACCCCTGCCTGTGTTTGGG + Intronic
1074383963 10:113002522-113002544 GAGAAGCCCTGGCTGTGTGTGGG + Intronic
1074764033 10:116687339-116687361 CATGGGCCCAGGCAGTGTCTGGG + Intronic
1075700254 10:124464672-124464694 GAGGGCTCTGGGCAGTGTTTTGG + Intronic
1076212412 10:128659121-128659143 GAGGGGGTCTGGCAGTGCCTGGG - Intergenic
1078476579 11:11635309-11635331 GAGGGACCCTGGCTGGGTGTGGG - Intergenic
1079503124 11:21124984-21125006 GTGGGGCCTTGGGAGTGATTAGG - Intronic
1080689523 11:34544852-34544874 GAGGTGCTCTGGCAGTGCTGTGG + Intergenic
1081466695 11:43325819-43325841 GAAGGGCTATGGCAGTTTTTTGG + Intronic
1083934980 11:65865401-65865423 GAGGGGGCCTGGCCTTGTGTGGG + Intronic
1083943833 11:65913004-65913026 GAGGGGCTCTGGCAGGGATGAGG - Intergenic
1084743022 11:71151216-71151238 GGGGGGCCCTGTGAGTGTTCAGG + Intronic
1088881666 11:113977781-113977803 GAGCGGGCCTGGTGGTGTTTCGG - Exonic
1089413149 11:118264205-118264227 GAGTGGCCTTGGCAGGGTGTTGG - Exonic
1089731236 11:120520388-120520410 GAGGGTCACTGGCAGTATTGGGG + Intronic
1090363495 11:126188731-126188753 TAGGGGCCCGGGCTGTGTGTTGG - Intergenic
1090854962 11:130603087-130603109 GAGGGACCCTGGCTGCCTTTGGG + Intergenic
1091143703 11:133258773-133258795 GAGGGCTCCTGGCAGTGCTGGGG - Intronic
1091375748 12:23646-23668 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1091552442 12:1546750-1546772 GCGGGGGCTTGTCAGTGTTTCGG + Intronic
1091816304 12:3441391-3441413 GGGGAGCCCTGGCAGCGTTGAGG - Intronic
1092811258 12:12273274-12273296 GAGGGACCATGGCAATGATTAGG + Intergenic
1094523942 12:31219559-31219581 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1094684557 12:32698286-32698308 GAGGAGCCCTGGCAGGGAATTGG + Intronic
1096104931 12:48991625-48991647 ATGGTGCCCTGGCAGTGCTTGGG - Intergenic
1096622821 12:52874921-52874943 CAGGGGCCCTGGCACTGTGGAGG - Intergenic
1099244695 12:80180744-80180766 GAGTGGCCCTGACAGTGTCAAGG + Intergenic
1101232140 12:102752365-102752387 GAGAGTCCTTGGAAGTGTTTTGG - Intergenic
1101965349 12:109278708-109278730 GAGGGGCGGTGCCATTGTTTGGG - Exonic
1102487546 12:113268467-113268489 GAGGGGTCCTGGCAGAGTGGCGG + Intronic
1103960093 12:124603971-124603993 GAGGGGCCCTGACTGTTTTCAGG - Intergenic
1104743183 12:131193779-131193801 GAGGAGCCCTGTCTGTGTTTGGG + Intergenic
1104972673 12:132539124-132539146 GTGGGGGCCGGGCAGTGTGTGGG - Intronic
1106770166 13:32954080-32954102 GAGGGCCCCTGGCATTCTTCTGG + Intergenic
1107711485 13:43154535-43154557 GAGGGGCACTGGCAGTGATCTGG - Intergenic
1110896810 13:80763089-80763111 GTGGAGCCTTGGCAGTTTTTGGG + Intergenic
1112495296 13:99899235-99899257 GGGGGGCCCTGGAAGGGTCTTGG - Intergenic
1113837253 13:113336530-113336552 GGGGGGCTCTGGCCGTGGTTGGG + Intronic
1119423352 14:74521220-74521242 GAGGGACCCTGCCTGTGCTTGGG - Intronic
1120981782 14:90296487-90296509 GAGGGGCCCTTCAGGTGTTTTGG - Intronic
1122294051 14:100694975-100694997 GAGGGACCCTGGGAGGGCTTGGG - Intergenic
1122354333 14:101114117-101114139 GAGAGGTGCTGACAGTGTTTTGG + Intergenic
1122585941 14:102806727-102806749 GAGGGGGCCTGGCAGGGCTGGGG + Intronic
1123022969 14:105410878-105410900 GAGGGCCCCTGGCAGGGTACAGG - Intronic
1123995908 15:25717985-25718007 AAGGGGCCATGTCAGTGTCTTGG + Intronic
1125279851 15:38031880-38031902 GAGGGGGCCTGGCATAGTTCTGG - Intergenic
1126691353 15:51291160-51291182 TGGGGGCACTGGCAGTTTTTGGG + Intronic
1128459995 15:67859800-67859822 GAGGGGCCTTGGCAGGGGTAGGG + Intergenic
1129116308 15:73367326-73367348 GAGGGGGCCTGGGGGTGTCTCGG + Intronic
1130064676 15:80593892-80593914 CAGGGGCCCTGGCAGACATTAGG + Exonic
1131054874 15:89369174-89369196 GAGGGACCCTAGCACTGTGTGGG - Intergenic
1131084670 15:89566378-89566400 GAAAGGCCCTGGCTGTGTTGAGG - Intergenic
1131114288 15:89784544-89784566 GAGGGGCCCTGGCAGAGCGCAGG - Intergenic
1132451182 15:101969355-101969377 GAGGCTCCCTGGCAGGGTGTGGG + Intergenic
1132937191 16:2487094-2487116 GGGCGGCCCTGGCAGTGCTGAGG - Intronic
1133453888 16:5925830-5925852 GAGGGGCCCAGGTAGTTATTTGG - Intergenic
1134077608 16:11303037-11303059 GAGGAGACCTGCTAGTGTTTGGG - Intronic
1134366858 16:13586791-13586813 GAGGTGCCCTGGAAGTATTTGGG - Intergenic
1134677445 16:16100398-16100420 GGGGGTCCCTGGGAGTGTTCTGG + Intronic
1136031305 16:27505057-27505079 GGGTGGCACTGGCAGTGTCTGGG + Intronic
1137627261 16:49917108-49917130 GAGGGGCCCAGTGAGTGTGTGGG + Intergenic
1138764965 16:59591239-59591261 GAGGGGCCATGACACTGTCTTGG - Intergenic
1140619838 16:76716686-76716708 GAGATGGCCTGGCAGTGTGTGGG - Intergenic
1141242181 16:82274343-82274365 GAGGGCCCCTGGAACTGTGTGGG + Intergenic
1142106938 16:88309372-88309394 GAGGTCCCCTGTCAGTGTTCAGG + Intergenic
1142107004 16:88309612-88309634 GAGGTCCCCTGTCAGTGTTCAGG + Intergenic
1142107017 16:88309660-88309682 GAGGTGCCCTGTCAGTGTTCAGG + Intergenic
1142107028 16:88309708-88309730 GAGGTGCCCTCTCAGTGTTCAGG + Intergenic
1142263088 16:89051553-89051575 GAGGGGCCCTGGCTGTGCCGGGG - Intergenic
1143783334 17:9240559-9240581 GAAGGGGCCTGGCAGCATTTGGG + Exonic
1143960206 17:10710891-10710913 GAGATGCCCTGGCAGTCATTTGG + Exonic
1145976374 17:28986428-28986450 GCGGGGCCCAGCCTGTGTTTAGG + Intronic
1146571963 17:33960773-33960795 GTGGAGCCCTGGCAGTGATGGGG - Intronic
1146655343 17:34631659-34631681 GATGGGAGCTGGCAGCGTTTGGG + Intronic
1147185462 17:38711031-38711053 GAGGGGGCCTTGCAGGGTATGGG + Intronic
1147208017 17:38852802-38852824 GAGGGGCTTTGGAAGTGTTTGGG - Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1147931550 17:43984301-43984323 GTGGGGCCCTGGCTGTGTAGAGG - Intronic
1149660327 17:58331413-58331435 GGGGGGCCCTGGCAGGGTTGGGG - Intergenic
1151850709 17:76688067-76688089 GAGGGGGCCTGACAGTGTCGGGG - Intronic
1152308661 17:79535972-79535994 GAGAGGGCCTGTCAGTGCTTAGG - Intergenic
1152882072 17:82823290-82823312 AAGGGGCCCTGGGAGAGGTTGGG + Intronic
1153924794 18:9826478-9826500 GAGAGGCCCTGGAAATGCTTTGG - Intronic
1157400367 18:47382173-47382195 GAGGGGCTCTGGCAGGGGTGGGG + Intergenic
1157497296 18:48165441-48165463 GAGGGGACCTGGCCTTGTTAGGG + Exonic
1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG + Intronic
1159700807 18:71624143-71624165 GGTGGGCCCAGGCATTGTTTAGG - Intergenic
1160394303 18:78560242-78560264 GAAGGGCCCTGACGGTGGTTAGG - Intergenic
1160634082 19:63192-63214 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1160786116 19:900841-900863 GAGGGGCCCTGGCCGTGGGGAGG - Exonic
1160889936 19:1372171-1372193 GGGGGACACTGGCAGTGTCTGGG + Intronic
1161007824 19:1945182-1945204 GAGGGGCCCTGGCAACCTTGCGG - Intronic
1161299844 19:3537354-3537376 GGGCGACCCTGGCAGTGGTTGGG + Intronic
1161352857 19:3803493-3803515 GGGCTTCCCTGGCAGTGTTTGGG - Intergenic
1161579623 19:5073644-5073666 GAGGGGATGTGGCAGTGCTTGGG - Intronic
1161965456 19:7545394-7545416 CAGGGGTCCCTGCAGTGTTTTGG + Intronic
1162552283 19:11364493-11364515 GAGGGGCCCTGGCTGGGGGTGGG - Exonic
1164570470 19:29371114-29371136 GAGGGACGCTGGCACTGTTTGGG - Intergenic
1165310462 19:35026485-35026507 GTGGGGCCCTGGGAGTGGGTGGG + Intergenic
1165746657 19:38233637-38233659 GAGGGGTCCGGGCAGGGATTGGG + Intergenic
925028052 2:625117-625139 GAGGGGCTCTGGCTGTCTCTAGG - Intergenic
926285359 2:11483123-11483145 GATCGGCCCTGGCAGCGTGTAGG + Intergenic
929919412 2:46161798-46161820 GAAGGGCTTTGGCAGTGTTCTGG - Intronic
931824466 2:65985574-65985596 GAGTGGGCCTGGCTGTGTTCCGG + Intergenic
932003678 2:67907044-67907066 GAGGGGCCCGGGCAGGGCTCTGG + Intergenic
932215961 2:69966077-69966099 GGGGGGTCCTGGAGGTGTTTGGG + Intergenic
932832949 2:75008320-75008342 GAGGGGTCCTGGCTGGGTTCAGG + Intergenic
933859178 2:86447332-86447354 AAGGGGCCCTGTCTGTCTTTTGG + Intronic
934662947 2:96152868-96152890 GAGGAGCCCTGGCAGGGCCTGGG - Intergenic
934714728 2:96536949-96536971 GAGGGGCCCGGGGTGGGTTTCGG + Intronic
936567397 2:113591836-113591858 GAGGCTCCCTGGCAGGGTGTGGG + Intergenic
940971626 2:159902903-159902925 GAGGGGCTCCTTCAGTGTTTGGG + Intronic
941788355 2:169523199-169523221 AAGTGGCCCTGACATTGTTTAGG + Intronic
942172016 2:173298230-173298252 CAGGGGCACTGGCATTGTCTTGG + Intergenic
947752814 2:232541571-232541593 GAGGGGCCTGGGCAGTGGTGGGG + Intronic
947968056 2:234298811-234298833 GAGTGGCCCAGGGAGTGTCTTGG - Intergenic
948625591 2:239266157-239266179 GAGGGGCTATGGCAGTGTGGTGG - Intronic
1170525129 20:17228719-17228741 GAGGAGCCCTGGCGGTGGCTGGG - Intronic
1171168450 20:22994027-22994049 CAGGGGCACAGTCAGTGTTTAGG + Intergenic
1172178686 20:32987601-32987623 GAGTGGTCCGGGCAGGGTTTGGG - Intronic
1174190518 20:48737304-48737326 GAGGGTCCCAGGCAGATTTTGGG + Intronic
1174564698 20:51456564-51456586 GTGGGGCCCTGGCTGTGGCTGGG - Intronic
1174574565 20:51527284-51527306 AAGGGGGCCTGGCAGTGGGTAGG - Intronic
1175539810 20:59741318-59741340 GAGGGGTCCTGGCAGAGGTCTGG + Intronic
1178380105 21:32100594-32100616 GAGGAGGCCAGGCATTGTTTAGG + Intergenic
1178487772 21:33029783-33029805 GAGGAGCACTGGCAGCGCTTTGG + Intergenic
1178490828 21:33050348-33050370 GATGGACTCTGGCAGAGTTTGGG + Intergenic
1179454422 21:41489036-41489058 GAAGGACCCTCTCAGTGTTTGGG + Intronic
1179467790 21:41589310-41589332 GAGGGTCCTTGGTTGTGTTTTGG + Intergenic
1182419026 22:30239757-30239779 CAGGGGCACTTGAAGTGTTTAGG - Intergenic
1182432159 22:30305729-30305751 GAGGGGCCCTGGCAGAGCTGAGG + Intronic
1182440787 22:30362670-30362692 GGGAGGCTCTGGCAGTGTCTGGG + Intronic
1183337896 22:37261098-37261120 GTGGGGCCATGGCAGTGTCCAGG + Intergenic
1183705508 22:39472914-39472936 GAGGGGCCCAGGCAGGGGTCGGG + Intronic
1183803505 22:40188350-40188372 GAAGTGCCCTGTCAGAGTTTGGG + Intronic
1185267791 22:49913579-49913601 GAGGGGCCCCTGCTGTCTTTGGG - Intronic
950358093 3:12428568-12428590 GAAAGGCCCTGGCACTGTCTGGG + Intronic
950715961 3:14848051-14848073 GGGAGGACCTGGCAGTGTTGGGG - Intronic
954375295 3:50191386-50191408 GAGAGGCCCTGGCACTGCCTGGG - Intergenic
954394738 3:50287543-50287565 TGGGAGCCCTGGCAGAGTTTGGG - Exonic
954417928 3:50403167-50403189 GAGGGGCCCTGGCAGTGTTTTGG - Intronic
956451375 3:69378393-69378415 CAGGGCACCTGGCAATGTTTAGG + Intronic
956676163 3:71733951-71733973 GAAGGACACTTGCAGTGTTTAGG + Intronic
956750265 3:72339599-72339621 GTGTGGCCCTGGCTGTGTCTCGG + Intergenic
957530012 3:81428802-81428824 AAGAGGCCCTGGCTGTGCTTGGG - Intergenic
960864373 3:122184580-122184602 GAGGGGCCGTGGCGGGGTCTGGG + Intronic
961061387 3:123831957-123831979 GAGAGGCCCTGGCAGGGGTGAGG + Intronic
961810718 3:129520066-129520088 GAGGGGGCTTGGCAGTGGTCAGG - Intronic
965583271 3:170292111-170292133 GTGGGACCTTGGCAGTATTTGGG + Intronic
967084708 3:186083882-186083904 GAGGGGCCCTGTGAGTGGTGAGG + Intronic
967979944 3:195059725-195059747 GAGGGGTCCCGGCACAGTTTGGG - Intergenic
968469541 4:773056-773078 GAGGGGCCCTGGCAGACTGGGGG - Intergenic
968728550 4:2259353-2259375 GGCTGGCCCTGGCAGTGATTCGG - Intronic
968946898 4:3669587-3669609 GCGTGGCCCAGCCAGTGTTTGGG - Intergenic
971477919 4:27089658-27089680 GTGGTGCCCTGCCAGTGCTTGGG + Intergenic
976382160 4:84411939-84411961 TAGGGGCCCTGGCAAGGCTTTGG - Intergenic
977165701 4:93694223-93694245 GAGGAGCCATAGCAGTGTTTGGG - Intronic
980970141 4:139559880-139559902 GAGGGGCCCAAGCAGTCTTCTGG + Intronic
981459958 4:145001621-145001643 GAAGTGACCTGGCAGTCTTTGGG - Intronic
985760993 5:1748643-1748665 GAAGGGCCCTGCCAGCCTTTGGG - Intergenic
986104789 5:4649459-4649481 GAGCAGCCCTGGCATTCTTTAGG - Intergenic
986701411 5:10412937-10412959 GAGGGGCCATGGGAGTGGTGAGG + Intronic
990698868 5:58453539-58453561 CAGTGGCACTGGAAGTGTTTAGG + Intergenic
992006509 5:72483623-72483645 GTGTGGCTCTGGCAGAGTTTGGG + Intronic
992367979 5:76112627-76112649 GGGAGGCCCTGGTAGTGTTCAGG + Intronic
994530072 5:100957442-100957464 TAGTGGCCATGGGAGTGTTTAGG + Intergenic
996425847 5:123312974-123312996 GAAGTGCTCTGGCCGTGTTTTGG + Intergenic
997445793 5:133939224-133939246 CAGAGGCCCTGAGAGTGTTTGGG + Intergenic
997890729 5:137673861-137673883 GAGGGGCCCAGGCAGGGCTGGGG + Intronic
1001318593 5:170662300-170662322 AAGGTGCCCTGGCACTGTTGAGG + Intronic
1002089836 5:176797944-176797966 TAGGGGCTGGGGCAGTGTTTGGG + Intergenic
1002533354 5:179862644-179862666 ATGGGGCCCTGGCTGTGTTCTGG - Exonic
1002586482 5:180252049-180252071 GAGGAGCCCTGAGAGTGTTTGGG - Intronic
1003144319 6:3497046-3497068 GAGATGCCCTGGAAGTGTTAAGG + Intergenic
1006635649 6:35459521-35459543 GAGTGGCCCTGGCAGGAGTTGGG + Intronic
1007119161 6:39366076-39366098 CAGGTGCCCTGGAAGTGTGTGGG + Intronic
1007446077 6:41907180-41907202 CAGGGGCTCCCGCAGTGTTTGGG - Exonic
1007745556 6:44041013-44041035 GATGGCCCCTGGCAGTGCTCGGG - Intergenic
1019053394 6:169201774-169201796 GAGGGGCCCTGGGAAAATTTAGG + Intergenic
1019319497 7:409184-409206 GGGTGGCCCTGGCAGGGTTGTGG + Intergenic
1019326018 7:438658-438680 GAGGGGCCCAGGCAGCCCTTGGG + Intergenic
1019708809 7:2509108-2509130 GAGGGGCCGGGGCAGTGTCAGGG + Intergenic
1021434289 7:20596617-20596639 GAGAGGGCATAGCAGTGTTTTGG + Intergenic
1026441689 7:70450525-70450547 CAGGGTCCATGGCAGTGTTGGGG + Intronic
1029259709 7:99293528-99293550 GAGGGGCCCTGAGGGTGTCTGGG - Intergenic
1035011861 7:155725623-155725645 GAGGGGCCATGGCAGGGGTGAGG + Intronic
1035114919 7:156516571-156516593 GAGGGGGCCAGGAAGGGTTTTGG - Intergenic
1035561001 8:603235-603257 GAGGGGCATTGGCAGAGTCTAGG - Intergenic
1037986548 8:23294092-23294114 GGAGGGCCCTGGCAGCATTTAGG + Intronic
1042213041 8:66400653-66400675 GAGGAGCCATGGCAGGGCTTAGG + Intergenic
1042657484 8:71115739-71115761 GAGTGGCTCTGGCAGTGTCTGGG + Intergenic
1043337709 8:79197351-79197373 GAGCGGTCCTGGAAGTGTGTTGG + Intergenic
1047771961 8:128037023-128037045 GAGGGGCCCAGGCAGCTATTTGG - Intergenic
1049332269 8:142060905-142060927 CAGGGGCCTTTGCAGTGTTCTGG + Intergenic
1049826317 8:144671061-144671083 GAAGGGCCCTGGTTGGGTTTCGG - Intergenic
1049885136 9:21697-21719 GAGGCTCCCTGGCAGGGTGTGGG - Intergenic
1049998538 9:1052368-1052390 GAGAGGCCTTGAAAGTGTTTAGG + Intronic
1050019432 9:1268244-1268266 GTGGGTCCCTGGGAGTGATTGGG - Intergenic
1056001585 9:82223026-82223048 GAGGGCACTTGGCAGTGTTTGGG - Intergenic
1056047282 9:82732414-82732436 GTGGGGAGCTGACAGTGTTTTGG + Intergenic
1056416828 9:86385382-86385404 GAGGGTAACTGGCAGTGATTTGG + Intergenic
1058023582 9:100117015-100117037 CAGGGGCACTGGCATTGTCTCGG - Intronic
1058901888 9:109449233-109449255 CAGTGGCCCTGCCAGTGTGTGGG - Intronic
1059256947 9:112939501-112939523 CAGGAGACCTGGAAGTGTTTAGG + Intergenic
1059441341 9:114308747-114308769 GAGAGGCCCTGGCTCTGTGTGGG + Intronic
1060552067 9:124490388-124490410 GAGTGGCCCAGGCAGGGTTGGGG + Intronic
1060723985 9:125995425-125995447 CAGGGGCCCTGGCATTTTCTGGG + Intergenic
1062034570 9:134377206-134377228 GGGGGCCTCTGGCAGTGTTGGGG + Intronic
1062056722 9:134472733-134472755 GAGGGGCCCTGGGAGTGGGGTGG - Intergenic
1062147245 9:134996502-134996524 GAGGGGCCCAGGCAGTCAGTGGG + Intergenic
1062733118 9:138120382-138120404 GAGGGGCCCGGGGAGTCCTTCGG + Intronic
1190890337 X:54561876-54561898 GAGGGCCTCTGGCACTGCTTGGG - Intergenic
1198280533 X:135137888-135137910 GTAGGGCCCTGAAAGTGTTTCGG + Intergenic
1198290426 X:135234626-135234648 GTAGGGCCCTGAAAGTGTTTCGG - Intergenic
1198661864 X:138978148-138978170 GAAGTGGCCTGGCAGTGTTATGG - Intronic
1200098314 X:153674386-153674408 GAGGGGCCAGGGCAGTCGTTAGG - Intronic
1200130026 X:153836903-153836925 TTGGGGCGATGGCAGTGTTTGGG - Intergenic
1201146761 Y:11068973-11068995 GGGGGGCCCTGTGAGTGTTCAGG + Intergenic