ID: 954418320

View in Genome Browser
Species Human (GRCh38)
Location 3:50405176-50405198
Sequence AAGAGGGAGGTGGGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1006
Summary {0: 1, 1: 1, 2: 5, 3: 88, 4: 911}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954418311_954418320 6 Left 954418311 3:50405147-50405169 CCAACCTCAGGAGAAGGAGTGGG 0: 1
1: 0
2: 4
3: 24
4: 243
Right 954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG 0: 1
1: 1
2: 5
3: 88
4: 911
954418313_954418320 2 Left 954418313 3:50405151-50405173 CCTCAGGAGAAGGAGTGGGACAG 0: 1
1: 0
2: 1
3: 53
4: 407
Right 954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG 0: 1
1: 1
2: 5
3: 88
4: 911
954418309_954418320 7 Left 954418309 3:50405146-50405168 CCCAACCTCAGGAGAAGGAGTGG 0: 1
1: 0
2: 2
3: 22
4: 181
Right 954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG 0: 1
1: 1
2: 5
3: 88
4: 911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954418320 Original CRISPR AAGAGGGAGGTGGGGACAAA AGG Intronic
900503190 1:3016586-3016608 AAGAGGGAGGGGTGGAGGAAGGG + Intergenic
900536120 1:3178686-3178708 AAGTGGGTGGTGGGGACAGATGG - Intronic
900600535 1:3500923-3500945 AGGAGGGATGTCTGGACAAAGGG + Intronic
900666545 1:3819310-3819332 GAGAGGGGGCTGGGGAGAAAAGG + Intronic
900766930 1:4512055-4512077 AACAGGGATGTGGGGAGGAATGG + Intergenic
900826006 1:4927638-4927660 AAGAGGAAGGTGGTCCCAAAGGG + Intergenic
900932804 1:5747537-5747559 AGGAGGGAGGAGGGCAGAAAGGG + Intergenic
901560446 1:10066095-10066117 GAGAGGGAGGGAGGTACAAAGGG - Intronic
901657220 1:10776414-10776436 AAGAGGCAGCTGTGGAGAAAGGG - Intronic
902032752 1:13434666-13434688 AAGAGGGTGGGGGTGGCAAAGGG - Intergenic
902097837 1:13961093-13961115 AAAAGGGAGGTGGGAAAAAGGGG - Intergenic
902540281 1:17149509-17149531 AAGAGGGAGGTGGGGCCTTTGGG - Intergenic
902933532 1:19747649-19747671 CAGAGGGAGGTGGGATCAGATGG - Intronic
902996450 1:20229180-20229202 AATAGGGAGGTGGGATGAAATGG + Intergenic
902996595 1:20230328-20230350 AATAGGGAGGTGGGATGAAATGG - Intergenic
903515188 1:23905644-23905666 AAGGGGCTGGAGGGGACAAAGGG + Intronic
903630953 1:24770272-24770294 AAGGGGGAGGAAGGGAGAAAGGG - Intronic
904756468 1:32771183-32771205 TGGAGGGAGGTGGGGAGAAGGGG - Exonic
905362043 1:37427595-37427617 AAGAGGGAGGGAGGGAAAGAAGG + Intergenic
905412468 1:37780183-37780205 AATAGGGAAGTGGGGACTAGTGG - Intergenic
905455146 1:38083518-38083540 GAGAGGAAGGTGGGCAGAAAGGG + Intergenic
905582062 1:39089836-39089858 AAAAGGGAGATGGTGATAAAGGG + Intronic
906105745 1:43291087-43291109 AAGGGGGAAGTGGGTACAGAGGG + Intergenic
906246334 1:44277181-44277203 GAGAGGAAGATGGGCACAAATGG - Intronic
906376538 1:45301166-45301188 CAGAAGGTGGTGGGGACAAAGGG + Intronic
906695952 1:47823597-47823619 CAGGGGGAGGTGCAGACAAATGG + Intronic
907422319 1:54355817-54355839 AAGCGGGAGGTGTGGATAGAGGG - Intronic
907489592 1:54800565-54800587 CAGAGGGAGGTAGGGAGACAGGG + Intronic
907569441 1:55469284-55469306 AAGAGAGAGGAGAGTACAAAAGG - Intergenic
907570031 1:55474800-55474822 AAGAGAGAGGTAGGGAGACAGGG - Intergenic
907745173 1:57206215-57206237 AGGAGGGAGGCAGGGAGAAAAGG + Intronic
907787273 1:57625142-57625164 AGGAGGGAAGTAGGGAGAAAAGG - Intronic
908015481 1:59828821-59828843 AAGAGGATGTTGGGGACAACTGG + Exonic
908613275 1:65887104-65887126 AGGAGGGAGGGAGGGAAAAATGG - Intronic
909432284 1:75603120-75603142 GAGAGGGAGGTTGGGGGAAAGGG - Intronic
909969617 1:81966019-81966041 ATAAAGGAGGTGGGGAAAAAAGG - Intronic
910186582 1:84547635-84547657 AATAGGGAGGCAGGCACAAAGGG + Intergenic
910278446 1:85472508-85472530 AAGAGCGGTGTGGGGACCAAGGG - Intronic
910399734 1:86826548-86826570 GAGAGGGAGGTGGGAACAGCTGG + Intergenic
912000440 1:104827208-104827230 AAGAGAGAGGGGTGGAAAAAAGG - Intergenic
912328336 1:108791434-108791456 AAGAGAGAGGATGGGACAAAAGG - Intronic
912452397 1:109775333-109775355 AAGACTGAGATGGGGACACAGGG - Intronic
912772088 1:112473243-112473265 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
913351876 1:117870445-117870467 ACCAGAGAGGTGGGGACAAAAGG + Exonic
913534662 1:119759694-119759716 CAGAGGGAGGAGAGGAGAAATGG - Intronic
914439059 1:147687096-147687118 AAGATGGAGGTGGGGCCTAATGG + Intergenic
914618141 1:149380007-149380029 ATGTGGGAGGTGGGGCCCAATGG - Intergenic
914879394 1:151535933-151535955 AAGAGGGAGGGAGGAAGAAAAGG - Intronic
915245941 1:154556527-154556549 AAGGGAGAGGTGGGGAGAATTGG - Intronic
915291515 1:154887432-154887454 AACAGGGAGGTGGAGAGAGAAGG - Intergenic
915431402 1:155869671-155869693 AAGAGGGAGGACAGGAGAAATGG - Intronic
915444499 1:155967037-155967059 AAGAGGGAGGTGGGAGGAGAGGG - Intronic
915471092 1:156126290-156126312 AAGTGGGAGGGGAAGACAAAGGG - Intronic
915508554 1:156372771-156372793 CAGAAGGAGGTGGGGAGACATGG + Intronic
915568439 1:156730002-156730024 GCAACGGAGGTGGGGACAAATGG - Intronic
915588797 1:156859353-156859375 AAGCCTGTGGTGGGGACAAAGGG - Intronic
915999097 1:160597346-160597368 TATAGGGAGGTGGGGCCTAATGG + Intergenic
916348977 1:163827228-163827250 AAGAGGGAGGGAGGGAAAGAAGG - Intergenic
916737980 1:167624976-167624998 GAGAGGGAGGAGGGGAGGAAAGG - Intergenic
917016477 1:170537107-170537129 AAGAGGGAGGGAGGGAAGAAGGG - Intronic
917475480 1:175365747-175365769 AAAAGAGAGGTGGGTAGAAAAGG - Intronic
917488911 1:175480771-175480793 AAGAGGGAGGTCAGAAAAAAAGG - Intronic
918801502 1:188978400-188978422 AAGAGGGAGGGAGGGACGGAGGG + Intergenic
918801526 1:188978465-188978487 AAGAGGGAGGGAGGGACGGAGGG + Intergenic
918876172 1:190046397-190046419 GAGAGGGAGGGAGGGACAGAGGG + Intergenic
918894120 1:190317462-190317484 AAGAGGGAAGAAGGGACATATGG - Intronic
918914108 1:190612860-190612882 AAGAGTGAGGTGGGGGCATTGGG + Intergenic
918920919 1:190708721-190708743 AAGAGGGAGGAGGGGAGGTAGGG - Intergenic
918920929 1:190708763-190708785 AGGAGGGAGGGAGGGAAAAAGGG - Intergenic
919074100 1:192793523-192793545 AAGTGGGAGATAGGGAGAAATGG - Intergenic
919254724 1:195106114-195106136 AAGAGGGTGGAGGGCTCAAAAGG - Intergenic
919522832 1:198610177-198610199 AATAAGGAGGTTTGGACAAAGGG + Intergenic
920175984 1:204102290-204102312 GAGAGGAAGGTGGGGACCATAGG - Intronic
920288973 1:204903209-204903231 AGGAGGGTGGTGGGTACAAGTGG + Intronic
920305655 1:205016572-205016594 AAGTGGGAGGAGGGGAGAAGGGG + Exonic
920500077 1:206480252-206480274 GAGAGGGAGGTGGGCAGAGAGGG + Intronic
920526084 1:206667626-206667648 TAGATTGAGGAGGGGACAAATGG - Intronic
921534750 1:216332572-216332594 AAGCAGGAAGTGGGGACTAAAGG + Intronic
921711500 1:218377910-218377932 ACGAAGGAGGTGGTGGCAAATGG - Intronic
921958372 1:221008091-221008113 AGCAGGGAGGAGGGGAAAAATGG - Intergenic
922058105 1:222061310-222061332 AGTAGGGTGGTGGGGACAAGGGG - Intergenic
922209500 1:223476726-223476748 GAGAAGGAGGAGGGGAGAAAGGG + Intergenic
922791697 1:228314522-228314544 TAGAGGGAGGTAGGGGCAAAGGG + Intronic
922961108 1:229646229-229646251 AAGAGGGATGTAGTGATAAAGGG + Intronic
923127581 1:231045986-231046008 AAGAGGGAGGGAGGGAGGAAGGG + Intergenic
923374595 1:233348133-233348155 AAGGGGGAGTTGGGGACAATAGG - Intronic
923564332 1:235065344-235065366 ATCAGGGAAGTAGGGACAAAGGG + Intergenic
923696134 1:236254316-236254338 AAGAGGTAGGTGGTGACAAATGG - Intronic
923821441 1:237447819-237447841 AAGAGGGAGGGAGGGAGGAAAGG - Intronic
924391090 1:243558742-243558764 AAGAGGCAGATGGTGACAGATGG - Intronic
924444488 1:244116626-244116648 CAGAGGGAGGTGAGGAACAAAGG - Intergenic
924815979 1:247442568-247442590 AAGAGAGAGGTGGACAGAAAGGG + Intronic
1062922893 10:1293202-1293224 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
1063049437 10:2430841-2430863 AAGAGGGAGGGAAGGAAAAACGG + Intergenic
1063650397 10:7930276-7930298 AAGAGGTGGGTGGGTAGAAAGGG + Intronic
1063756228 10:9012238-9012260 AAGAGGAAGGAAGGGAGAAAGGG + Intergenic
1063817160 10:9788486-9788508 AAGAGGGAACTGTGGAGAAAAGG + Intergenic
1063917865 10:10902912-10902934 AAGAGGGAGGGAGGGAAAAGCGG + Intergenic
1063958330 10:11285223-11285245 CTGAGGGATGTGAGGACAAAAGG - Intronic
1064266641 10:13830680-13830702 AAGCGGGAGGTGTAGAGAAATGG + Intronic
1064653889 10:17537350-17537372 CAGAGTGAGGTGGAGACCAAGGG - Intergenic
1064909770 10:20387160-20387182 AATAGTGTGGTGGAGACAAAGGG + Intergenic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1065607425 10:27432631-27432653 GAGAGGGAGGGAGGGAGAAAAGG - Intergenic
1065833905 10:29640061-29640083 AAGACAGAGGTGGGGCCCAAGGG - Intronic
1065886695 10:30084180-30084202 AAGAGGGAGGGAGGGAGAGAAGG + Intronic
1067043848 10:42973627-42973649 AAGAGGGAGGTGCGTACAAGCGG - Intergenic
1067257873 10:44661812-44661834 AAAAGGGACCTGGGGACAAAGGG - Intergenic
1067286618 10:44911900-44911922 GAGATGGAGGTGGAGACAGAAGG + Intronic
1067292482 10:44953866-44953888 GATAGGGAGGTGAGGACAAAGGG + Intergenic
1067407437 10:46036085-46036107 AAAAGGGAGTGGGAGACAAAAGG - Intronic
1067410598 10:46060863-46060885 AAGAGGGTGTGGGGGACAGAGGG - Intergenic
1067437311 10:46287229-46287251 AAGAGTGAGGTGGGGTCACAGGG + Exonic
1068685982 10:59870260-59870282 CAGAGGCGGGTGGGGAGAAAAGG - Intronic
1068729708 10:60343311-60343333 AAGAGGAAGGGAGGGAGAAAAGG + Intronic
1068948606 10:62755117-62755139 AGGAGGGAGGAGGGGAAGAAAGG + Intergenic
1069536580 10:69257973-69257995 CAGGTGGAGATGGGGACAAAAGG + Intronic
1069579390 10:69554961-69554983 ACCAGGGAGGTGGGGAGAAGTGG - Intergenic
1069753402 10:70759335-70759357 AAGAGGGAGGTGGGAAGAGTGGG - Intronic
1070563196 10:77583320-77583342 AAGATGGACGGGGGCACAAATGG + Intronic
1070597809 10:77844961-77844983 CAGGGGGAGGTGGGTTCAAAGGG + Intronic
1070653478 10:78254651-78254673 AAGAGGGAGGTGGGTTCCTAGGG + Intergenic
1070742493 10:78912134-78912156 AAGGGTGAGTTGGGGACCAAGGG + Intergenic
1071160478 10:82740146-82740168 AAGAGGGAGGAAGGGAAAGAGGG - Intronic
1071444892 10:85736270-85736292 AGGAGGGAGGAGGGGAGAGAGGG + Intronic
1071962224 10:90818144-90818166 TGGTGGGAGGTGGGGCCAAATGG + Intronic
1072183029 10:93006976-93006998 AAGAGGGTGGGGGAGAAAAAGGG - Intronic
1072454936 10:95567494-95567516 AAGAGGGAGGGAGGGAGAGAGGG + Intergenic
1072504114 10:96047023-96047045 ATTAGGGAGTTGGGGAAAAAAGG - Intronic
1072611403 10:97019653-97019675 AGCAGGGAGGTGGGGGAAAATGG - Intronic
1073127758 10:101162509-101162531 CAGAGTGAGGACGGGACAAAAGG - Intergenic
1073198909 10:101718765-101718787 AAGAGGGATGGGAGGACAGAAGG + Intergenic
1073625354 10:105091105-105091127 AGGAGGGAGGGAGGGAAAAAGGG - Intronic
1073849348 10:107596207-107596229 GAGAGAGAGGTGGGGGAAAAGGG - Intergenic
1073984377 10:109191817-109191839 AAGAGGGAGGTTAGGAAGAAAGG + Intergenic
1074101571 10:110358275-110358297 AAGAGTGAGGTTGGGAGAGAGGG - Intergenic
1074204655 10:111272264-111272286 AAGAGGGAAGTGGGGAGAGAGGG + Intergenic
1074276299 10:112005689-112005711 AAGGGGGAAGTGAGGAGAAAGGG + Intergenic
1074302313 10:112243511-112243533 AGGAGGGAGGTGGAGAAAGATGG - Intergenic
1074609136 10:115004448-115004470 AGGAGGGAGGGAGGGAGAAACGG - Intergenic
1074765231 10:116695313-116695335 GAGTGGGAGGTGGGGCCTAATGG + Intronic
1074813801 10:117130028-117130050 AGGAGGAAGGAGGGGAGAAAGGG + Intronic
1075451268 10:122553305-122553327 ATCAGGGGAGTGGGGACAAAGGG - Intergenic
1075581149 10:123619549-123619571 AAAAGGGAGGAGGGGAGAAGGGG + Intergenic
1075937002 10:126351212-126351234 AAGGGGGAAGTTGGGACAGAAGG - Intronic
1076154022 10:128188955-128188977 AGAAGGCAGGTGGGGACACATGG + Intergenic
1076230134 10:128813427-128813449 GAGAGGGAGGGAGGGACAGAAGG + Intergenic
1076566975 10:131405431-131405453 AAGAAGGAAGTGGGGAGAACAGG + Intergenic
1076931074 10:133532129-133532151 ATGAGGAAGGTGGGGTCGAAAGG - Exonic
1077272246 11:1686804-1686826 AAGAGGGAGGGAGGGAAAGAGGG - Intergenic
1077509391 11:2948421-2948443 AGCAGAGAGGTGGGGACAAGAGG - Intronic
1078076529 11:8166921-8166943 AGGAGGGAGGGAGGGACAGAGGG + Intronic
1078155605 11:8797498-8797520 AAGAGGGAAGTGGGAAGAAGGGG - Intronic
1078641982 11:13105262-13105284 AAGAGGAAGTGGGGGACAAATGG - Intergenic
1078675585 11:13409892-13409914 AAGAAGGAAGAGGGGACGAAAGG + Intronic
1078757505 11:14224768-14224790 GAGAAGTAGGTGGGGCCAAAGGG + Intronic
1079157889 11:17965430-17965452 TAGAGATAGCTGGGGACAAAGGG - Intronic
1079841681 11:25409166-25409188 AAGAGGAGGCTGGGGAAAAAGGG + Intergenic
1079960580 11:26918365-26918387 AGGAGGGAGGGAGGGAGAAAAGG + Intergenic
1080115942 11:28621745-28621767 AGAAGGGAGGTGGGGAGGAATGG - Intergenic
1080474049 11:32573255-32573277 GAGAGGGAAGTGGGCATAAAAGG + Intergenic
1080673838 11:34405979-34406001 AAGAGGGAGAAGTGGAGAAATGG - Intergenic
1081578584 11:44335205-44335227 GAGAGGGAGGAAGGGAGAAAAGG - Intergenic
1081747381 11:45482662-45482684 GAGAGAAAGGTGGGGAGAAAGGG + Intergenic
1081826296 11:46056389-46056411 AATATGGAGGTGATGACAAAAGG + Intronic
1083277870 11:61607444-61607466 AACTGGGTGGTGGGGACCAAAGG - Intergenic
1083681655 11:64354345-64354367 AGGAGGGAGGTGTGGGCCAAGGG - Intronic
1083929326 11:65831642-65831664 CAGAGGGAAGTGGGAACATATGG - Intronic
1084192427 11:67505105-67505127 CAGAGGGAAGTGGGGACAACGGG - Intronic
1084441798 11:69178891-69178913 AAGAGGAAGGAGGGAACAAAGGG + Intergenic
1084561457 11:69907838-69907860 AAGAAGGAGGTGGGGCCCAGCGG + Intergenic
1084729559 11:71064651-71064673 AGAAGGGTGGTGGGGACAAGAGG + Intronic
1084952097 11:72672097-72672119 AAGAGAGAGGTGGGGCCAGGAGG - Intronic
1085104303 11:73829084-73829106 GAGAGGAAGGTGGGGACAGACGG - Intronic
1085482714 11:76836152-76836174 AAGAGGGAGGTGGGATCACACGG + Intergenic
1085691841 11:78670581-78670603 AGGAGGGTGGTGAGGAGAAAGGG + Intronic
1085721380 11:78915074-78915096 AAGAGGGAGGTGGCGAGCTATGG - Intronic
1086202302 11:84218255-84218277 AGGAGGGAGGGAGGGAAAAAGGG + Intronic
1086808474 11:91273494-91273516 AAGAGGGAGGAAGAGAGAAAGGG - Intergenic
1087002086 11:93431396-93431418 AAGAGGGAGACTGGAACAAAAGG + Intronic
1087237360 11:95734841-95734863 AAGAGGGAGGAAGGGAAGAAGGG + Intergenic
1087471461 11:98580853-98580875 AAGAGGGAGGGAGGGATTAAAGG + Intergenic
1087518824 11:99203045-99203067 GAGAGGGAGGAAGGGAGAAAGGG + Intronic
1087548251 11:99612378-99612400 AAGAGGAAGATGGGGTCAGAGGG - Intronic
1088127675 11:106448403-106448425 AAGGGTGAGGTGGGGAGAAGGGG + Intergenic
1088198882 11:107308123-107308145 AAGTTGGAGGTGGGGCCTAATGG + Intergenic
1088907742 11:114167637-114167659 AGGAGGGGGCTGGGGAGAAAAGG - Intronic
1089650770 11:119911237-119911259 CAGAGGGAGGAGGGGGCAATGGG + Intergenic
1089702815 11:120255558-120255580 AGGAGGGAAGCGTGGACAAAAGG + Intronic
1089748326 11:120632578-120632600 AAGAAGGTGGCTGGGACAAACGG - Intronic
1089780694 11:120871401-120871423 AAGAAGGAGCTGAGGGCAAAGGG + Intronic
1089788411 11:120924566-120924588 AAGAGGTGGGTGGGGACAAGGGG - Intronic
1089905987 11:122039142-122039164 AATAGGAAGGTGGGCAGAAAAGG + Intergenic
1090189108 11:124756888-124756910 GAGAGGGGGCTAGGGACAAAAGG - Intronic
1090263848 11:125341927-125341949 AAGGGGGTGGTGAGGACCAAGGG + Intronic
1091237951 11:134034234-134034256 AAGAGGGAGCTGGGTAGACAGGG - Intergenic
1091696319 12:2630509-2630531 TAGTGGGAGGAGGGGACAAAGGG + Intronic
1091723578 12:2830599-2830621 GAGAGGGAGGGAGGGAGAAAGGG - Intronic
1092013791 12:5139595-5139617 AAGAGGGAGGGAGGGAGGAAGGG - Intergenic
1092252109 12:6905277-6905299 AAGGGGGAGGTGGGAAGAATGGG + Intronic
1092256586 12:6929170-6929192 AAGGGGGAGTTGGGAAGAAAGGG + Intronic
1092573151 12:9747395-9747417 AGGAGGGAGGCAGGGAAAAAAGG - Intergenic
1092971859 12:13703803-13703825 AAGAGGCAGTTGGGAATAAATGG - Intronic
1093062389 12:14620706-14620728 AAGTTGGGGGTGGGGAGAAAGGG + Intronic
1093141299 12:15513236-15513258 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
1093196500 12:16135727-16135749 TATAGGGAGGTGGGGCCTAATGG + Intergenic
1093705035 12:22265681-22265703 AAGAGAGAGGTGAGCAAAAATGG - Intronic
1094123607 12:26999498-26999520 AAGAGGGAGGAGAAGACAGAAGG + Intronic
1094345066 12:29458994-29459016 TATAGGGAGGTGGAGAAAAAGGG + Intronic
1094818441 12:34207700-34207722 TAGAGGGAAGGAGGGACAAAGGG - Intergenic
1096077237 12:48813575-48813597 AGAAGGGAGGTGGGGAGAGAGGG - Intergenic
1096609069 12:52789333-52789355 AAGAGGGCCTTGGGGACAGAGGG - Intergenic
1097055213 12:56244997-56245019 AAGAGGGAGGAGGGGTCATCAGG + Intronic
1097641837 12:62191852-62191874 AAGAGGGAGGGCGGGAGAGAGGG - Exonic
1097861442 12:64522453-64522475 AGGAGGGAGGATAGGACAAAGGG - Intergenic
1097958741 12:65512279-65512301 GAGAGGGAGGGGAGGACAGAAGG - Intergenic
1097971232 12:65635199-65635221 AAGAGAGAAGTTGGGACCAAGGG + Intergenic
1098737999 12:74131868-74131890 AAGGGAGAGGTGGGGAGAGAGGG - Intergenic
1099224190 12:79949476-79949498 AAGAGGGAAGAGGAGACAAGGGG - Intergenic
1100215185 12:92440507-92440529 AAGAGGGAGGTCGAGGAAAAGGG + Intergenic
1100346211 12:93734043-93734065 AGGAGGGAGGAAGGGAAAAAAGG - Intronic
1100370839 12:93967145-93967167 AAGAGGGAGGGAGGGAGGAAGGG - Intergenic
1100556140 12:95695906-95695928 AAGAGGGAGGGAGGGAGGAAGGG - Intronic
1101818553 12:108164884-108164906 TAGGAGAAGGTGGGGACAAAGGG + Intronic
1101909336 12:108850290-108850312 AGGAGGGAGCTGGGGGAAAAGGG + Intronic
1102052960 12:109876516-109876538 AAGAGGGAGGGAGGGAAGAAAGG + Intronic
1102151065 12:110689298-110689320 GTGAGGGAGGTAGGGACGAACGG - Intronic
1103059670 12:117848358-117848380 GAGTGGGAGGTGGAGACAAATGG + Intronic
1103240565 12:119409878-119409900 GAGAGGGAGGTGGGAAAAGAGGG - Intronic
1103458310 12:121084687-121084709 AACAGAGAGCTGAGGACAAAGGG - Intergenic
1104232894 12:126902572-126902594 AAGAGGGAGGAAGGGAGGAAAGG - Intergenic
1104323248 12:127772032-127772054 GAGAGAGAGGTGGGGAAAAAGGG + Intergenic
1104506704 12:129338985-129339007 AGGAGGGAGGGAGGGAAAAATGG + Intronic
1104744171 12:131200817-131200839 AAGAGGGAGGTGGGGAACAGAGG - Intergenic
1104776794 12:131394153-131394175 AAAAGGAAGGTGGGGAGAGAGGG - Intergenic
1104790208 12:131476406-131476428 AAGAGGGAGGTGGGGAACAGAGG + Intergenic
1106361092 13:29031068-29031090 TAAAGGGAGGTGGGAAGAAAGGG + Intronic
1106932398 13:34680941-34680963 GAGAGGGAGAAGGGGAGAAAGGG - Intergenic
1107020172 13:35743154-35743176 AAGAGGGAGATGGGGAATATAGG + Intergenic
1107581123 13:41787554-41787576 AAGAGGGAGGAAGGGGGAAATGG + Intronic
1107886654 13:44879260-44879282 AAGAGGCAGGTGAGGGCAAGAGG + Intergenic
1107985320 13:45770923-45770945 AAGAGGGAAGTGGGGAACATAGG + Intergenic
1109443147 13:62400440-62400462 GATAAGGAGGAGGGGACAAAGGG - Intergenic
1110412735 13:75221625-75221647 AATGGGGAGGTGGGGACCACTGG + Intergenic
1110528719 13:76571545-76571567 AAGTAGGAGGTGGGGGAAAAGGG - Intergenic
1110735009 13:78926259-78926281 AAGGGGGAGGTGAGGGCACATGG - Intergenic
1110951387 13:81496602-81496624 GAGAGGGAGATGAGGAGAAAGGG + Intergenic
1111233211 13:85372340-85372362 AAGTTGGAGGTGGGGCCTAATGG + Intergenic
1111438971 13:88253126-88253148 CCAAGGAAGGTGGGGACAAAAGG + Intergenic
1111599981 13:90460591-90460613 AAGAGGGAGGGAGGGATGAACGG - Intergenic
1111742221 13:92218557-92218579 AAGCAGGGGGAGGGGACAAAGGG - Intronic
1112610394 13:100949457-100949479 AAGAGGAAGGTGGGAACTAGTGG + Intergenic
1112922942 13:104637646-104637668 AAGAGGGAAGAGGGGTAAAAGGG + Intergenic
1113014154 13:105808463-105808485 AAGAAAGAGGTGGAGACAAAGGG + Intergenic
1113796523 13:113061719-113061741 AAGAGGGAGGGGAGGGCAAGGGG - Intronic
1113936433 13:113997462-113997484 AAGCAGGGGGTGGGGGCAAAGGG + Intronic
1114668890 14:24398633-24398655 AGGGGGGAGGTGGGGGTAAAGGG + Intergenic
1115030314 14:28786037-28786059 AAGCTAGAGGTGGAGACAAAAGG + Intronic
1115142929 14:30194798-30194820 CTGAGGGAGGTGGAGACATAAGG + Intergenic
1115378084 14:32700819-32700841 GAAAGTGAGGTGGGGAGAAAGGG + Intronic
1115469533 14:33754419-33754441 GAGAGGGAGCTGGGGAAGAAGGG - Intronic
1115509168 14:34123159-34123181 TAGAGAGAGGTGGGGACTAGGGG - Intronic
1115895095 14:38077514-38077536 AAGGGGGAGGTGAGGACCCAAGG - Intergenic
1117392460 14:55275175-55275197 AAGATGGAGGTGGGAATGAAAGG - Intronic
1117409492 14:55438430-55438452 AAAAGTGAGATGGGGACAATGGG + Intronic
1117622468 14:57601455-57601477 TAGAGGGAGGAGGGGGGAAAGGG - Intronic
1117891662 14:60428371-60428393 AGGTAGGAGGTGGGGATAAAGGG - Intronic
1118073451 14:62271402-62271424 AGAATGAAGGTGGGGACAAAGGG - Intergenic
1118816666 14:69318942-69318964 AGGAGGGAGAGAGGGACAAAAGG - Intronic
1119387643 14:74267734-74267756 AGGAGGGAGGTGGGGACAACAGG - Intergenic
1119487879 14:75003507-75003529 AAGAGAGAGGTGGGGAGGAGTGG - Intronic
1119607933 14:76036814-76036836 AGGAGGGAGGGAGGGACAGAGGG - Intronic
1119662181 14:76459915-76459937 GAGAGGGAGATGGGGAGAGAGGG + Intronic
1119925373 14:78488703-78488725 AAGAGGGAGATGGAGAAATAAGG + Intronic
1120080567 14:80211533-80211555 AAAAGGGGGGTGGTGATAAAGGG + Intronic
1120657193 14:87205861-87205883 GAGAGGAAGATGGAGACAAAAGG + Intergenic
1120868401 14:89315854-89315876 CAGAGGGAAGTGGGGCTAAAGGG + Intronic
1120873778 14:89360488-89360510 AAGAGGAAGGGAGGGAAAAACGG + Intronic
1121236749 14:92397269-92397291 CAGAAGGAGCTGGGGACAGAAGG - Intronic
1121506915 14:94484551-94484573 AAGAGGTAGGTGGGAACTCATGG - Intergenic
1121542932 14:94742014-94742036 AAGTGGGAGGTGGAACCAAAAGG - Intergenic
1121613857 14:95299703-95299725 AAGTGGGAGGTGGTGGCATAGGG - Intronic
1121764931 14:96478215-96478237 GAGAGGGAGGGGGGAAGAAAGGG + Intronic
1121773961 14:96578070-96578092 AAGGTGGTGGTGGGGACTAATGG - Intergenic
1122172457 14:99888528-99888550 CAGAAGGAGGTGAGGACAGAAGG - Intronic
1122328384 14:100896586-100896608 AAGCAGGAGCTGGGGACAGAGGG + Intergenic
1122461468 14:101899214-101899236 AAGAGGCAGGTGGGTGAAAACGG - Intronic
1122473049 14:101985092-101985114 AAGATGGAGGAAGGGATAAATGG - Intronic
1122689929 14:103527464-103527486 AAGAGGGAAGTCGGAACCAAGGG + Intergenic
1122881884 14:104693949-104693971 CAGAGGCAGGTGGGGACAGGTGG - Intronic
1202921510 14_KI270723v1_random:33374-33396 AGGAGGGAGGGAGGGACAGAGGG + Intergenic
1202921538 14_KI270723v1_random:33454-33476 GGGAGGGAGCTGGGGACAGAGGG + Intergenic
1202923378 14_KI270724v1_random:4126-4148 GGGAGGGAGCTGGGGACAGAGGG - Intergenic
1124655924 15:31507264-31507286 AAGGTGGAGGTGGTGACAGAAGG + Intronic
1124832840 15:33165820-33165842 AGGAGGAAGGTGGGGACCATGGG + Intronic
1125281302 15:38044796-38044818 AAGAGGCAGGGGGGAAAAAAAGG + Intergenic
1125947704 15:43723393-43723415 AGGAGGGAGGGAGGGAAAAAAGG + Intergenic
1126196268 15:45935591-45935613 ATAAGGGAGGGAGGGACAAATGG + Intergenic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126376711 15:48004291-48004313 AAGAGTAAGGTGGGGGAAAATGG + Intergenic
1127842980 15:62846523-62846545 GAGAGGGAGCTGGGGGCAGACGG + Intergenic
1128077451 15:64836583-64836605 AAGAGGGAGGGAGGGAGAGATGG - Intergenic
1128078609 15:64843102-64843124 AAGTGGGAGGTGGGCACTGAAGG - Intronic
1128280564 15:66390774-66390796 GAGGGGGTGGTGGGGACAACAGG - Intronic
1128294266 15:66504666-66504688 GAGAGGGAGATGAGGACCAAAGG - Intronic
1129315831 15:74743293-74743315 AAGAGGGAGGGAGGGAGGAAGGG + Intergenic
1129384081 15:75185955-75185977 AAGAGGGAGGGAGGGAAAGAAGG + Intergenic
1129443020 15:75595894-75595916 AAGAGAGAGGTGGGAATTAAAGG - Intergenic
1129798921 15:78398749-78398771 ATCAGGGAGGTGGGGAAAAAGGG - Intergenic
1130015525 15:80183211-80183233 AAGAGGGAAATGGGAACAGATGG + Intronic
1130138138 15:81198643-81198665 AAGGGGGAGGGGTTGACAAAAGG - Intronic
1130223377 15:82040025-82040047 AAGCTGGAGGATGGGACAAAAGG + Intergenic
1130225954 15:82058678-82058700 AAGAGGGAGGATGGGAGAAGAGG - Intergenic
1130520779 15:84659017-84659039 ATGATGGAGGGTGGGACAAAGGG + Intergenic
1130559180 15:84945254-84945276 AAAGGGAAGGTGGGGACAGATGG - Exonic
1130780828 15:87038544-87038566 GAGAGTTAGGTGGGGACACAGGG - Intergenic
1130789044 15:87132585-87132607 AAGAAAGAGATGGTGACAAACGG + Intergenic
1131641495 15:94298796-94298818 GAGAGGGAGATGGGGAGAGAGGG - Intronic
1132006746 15:98234141-98234163 CAGAGACAGGTGGAGACAAAGGG + Intergenic
1132737543 16:1394370-1394392 AGGAGGGATGTGGGGACCAAGGG - Intronic
1132878512 16:2150707-2150729 AAGAGGGAGGTGGGGAAGTGGGG - Intronic
1133534370 16:6686747-6686769 ATGGGGGAGGTTGGGAGAAAAGG - Intronic
1133817970 16:9212637-9212659 AAGAGGGGGGTGGAGAGAAAAGG + Intergenic
1134008921 16:10836792-10836814 ATGTTGGAGGTGGGGCCAAATGG + Intergenic
1135861421 16:26059275-26059297 AAGAGAGAGAGGGGGACAAGTGG - Intronic
1136279572 16:29200168-29200190 AAGAGGGAGGGAGGGAGGAATGG - Intergenic
1136909618 16:34135130-34135152 AAGTGAGAGGTTGGGACAGAGGG - Intergenic
1137618319 16:49859207-49859229 AGGACGGAGGTGGGGGCAACAGG + Intergenic
1138190304 16:55009059-55009081 AAGAGGGTGTAGGGCACAAAAGG - Intergenic
1138628945 16:58278226-58278248 AAGAGGAAGGAGGGAAGAAAAGG + Intronic
1139328441 16:66169416-66169438 AAGAGAGAGGTGGGGAAAGAAGG + Intergenic
1140221441 16:73047512-73047534 AGGAGGGAGGGGAGGACAGAGGG + Intronic
1140740336 16:77936051-77936073 AAAAAGGAGGTGGGAAGAAATGG + Intronic
1140796376 16:78442430-78442452 AAGTGGGAGGGGGTGATAAATGG - Intronic
1141158227 16:81611572-81611594 GAGAGGCAGGAGGGGACAGAAGG - Intronic
1141185497 16:81784180-81784202 TAGAGGGAGGTGGGGGCAAAGGG + Intronic
1141249335 16:82340636-82340658 AAGCGGGAGGAGGGAAGAAAAGG - Intergenic
1141427128 16:83951844-83951866 AAGAGGGAGGAAGGGAAAGAGGG - Intronic
1141987576 16:87589873-87589895 AGGAGGGTGGTGGGGACAAGCGG - Intergenic
1142049542 16:87949374-87949396 GAGGTGGAGGTGGAGACAAAAGG + Intronic
1142083964 16:88166269-88166291 AAGAGGGAGGGAGGGAGGAATGG - Intergenic
1142838496 17:2607809-2607831 AAGAGGAAGGTGGACACAATTGG - Intronic
1142878347 17:2866037-2866059 AAGAGGGAGGTGTGGAGAAGAGG + Intronic
1142978108 17:3657081-3657103 AGGAGGGAGGAGGGCACAGAAGG + Intronic
1142978116 17:3657105-3657127 AGGAGGGAGGAGGGCACAGAAGG + Intronic
1143021319 17:3918311-3918333 AAGAAGGAGGGAGGGAAAAAAGG + Intergenic
1143712452 17:8744065-8744087 AAGAAGAAGGTGGGGACTCAGGG - Exonic
1143823190 17:9581545-9581567 GAGAGGGAGGGAGGGACAGAGGG + Intronic
1144088390 17:11831484-11831506 ATGTTGGAGGTGGGGACAAGTGG - Intronic
1144298273 17:13899730-13899752 AGGAGAGAGGCGGGGAAAAAGGG - Intergenic
1144625157 17:16840693-16840715 AAGTGGGCACTGGGGACAAAAGG - Intergenic
1144767603 17:17741181-17741203 AGGAGGGTGGTGGGGAGAGACGG - Intronic
1144881272 17:18432028-18432050 AAGTGGGCACTGGGGACAAAAGG + Intergenic
1145075185 17:19847974-19847996 ATGAGGAAGGTGGGCACAGAGGG - Intronic
1145150960 17:20512358-20512380 AAGTGGGCACTGGGGACAAAAGG - Intergenic
1145238534 17:21225981-21226003 AAGAGGGAGGGGAGGAGGAAGGG - Intergenic
1145811584 17:27767491-27767513 AGGAGGGTGGTGGAGACAGAAGG - Intronic
1146125818 17:30230615-30230637 AAGAGGGAAGTGGGGAAAAGGGG + Intronic
1146405468 17:32533073-32533095 AAGAGGGTAGAGGAGACAAAAGG - Intronic
1146488418 17:33262353-33262375 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
1146805671 17:35863334-35863356 GAGAGGAAGGTGGGGTGAAAAGG - Intronic
1146820869 17:35982904-35982926 AAGAGGGAGGGAGGGATAGAGGG - Intergenic
1146841873 17:36161937-36161959 AGGAGGGTGGTGGAGACAGAAGG + Intergenic
1146854183 17:36249897-36249919 AGGAGGGTGGTGGAGACAGAAGG + Intronic
1146870087 17:36373789-36373811 AGGAGGGTGGTGGAGACAGAAGG + Intronic
1146877444 17:36424870-36424892 AGGAGGGTGGTGGAGACAGAAGG + Intronic
1146993783 17:37299529-37299551 AAGAGAAAGGTGGGGAAAGAAGG - Intronic
1147072968 17:37974413-37974435 AGGAGGGTGGTGGAGACAGAAGG + Intergenic
1147084490 17:38053951-38053973 AGGAGGGTGGTGGAGACAGAAGG + Intronic
1147100437 17:38177917-38177939 AGGAGGGTGGTGGAGACAGAAGG + Intergenic
1147139198 17:38452114-38452136 ACGAGGGAGGTCGGGATCAAGGG - Intronic
1147403983 17:40197614-40197636 AGGAGGGAGGGAGGGACAGAGGG + Intergenic
1147598651 17:41732806-41732828 AGGCGGCAGGTGGGGAGAAAAGG + Intronic
1147610880 17:41801280-41801302 AGCAGGGAGGTGGGGGCAAAGGG - Intergenic
1147711314 17:42467819-42467841 AAGAGGGATGGGGAGAAAAAAGG + Intronic
1147747687 17:42705354-42705376 AAATGGGAGGTGGTGACGAACGG + Intronic
1147773909 17:42887023-42887045 AAGAGGGAGATGGAGCCAAAGGG + Intergenic
1147907561 17:43832940-43832962 AAGAGGGAGGCGGGGGCCGAGGG + Intronic
1148011890 17:44489324-44489346 AAAGAGGGGGTGGGGACAAAAGG - Intronic
1148203341 17:45764319-45764341 AAGAGGGAGGGAGGGAGAAAAGG + Intergenic
1148326492 17:46786216-46786238 AGGAGGGAAGAGGGGACAAGAGG + Intronic
1148458133 17:47821823-47821845 GAGAGGGAGGTGGGGAGATCCGG - Intronic
1149363784 17:55920510-55920532 AAGAGGGGTCTGAGGACAAATGG - Intergenic
1149455631 17:56785872-56785894 GAGATGGAGGTGGGGATACAAGG - Intergenic
1150083378 17:62260963-62260985 AGGAGGGTGGTGGAGACAGAAGG + Intergenic
1150478011 17:65488681-65488703 GAGAGGGAGGGAGGGACAGAGGG + Intergenic
1150914021 17:69417799-69417821 AAGAGGGAGGTAGGGAGATCTGG + Intronic
1151214649 17:72569312-72569334 AAAAATGAGGTGGGGAAAAAAGG + Intergenic
1151279653 17:73063893-73063915 AAGATGGAGGAAGGGACACACGG - Intronic
1151409497 17:73912451-73912473 AAGAGGGAGGGAGGGAAGAAAGG - Intergenic
1151572227 17:74932569-74932591 AAGGTGGAGGTGGGGCCAGAGGG - Intronic
1151871639 17:76840779-76840801 AAGAGACAGGTGGGGAGAGAGGG - Intergenic
1151886756 17:76927136-76927158 AAGAGGGATGTGGGAAGAACTGG + Intronic
1151887822 17:76933442-76933464 AAGAGGGTGATGGGGACAGCAGG + Intronic
1151956586 17:77383180-77383202 AAGAGGGAGGGAGGGAGAGAAGG - Intronic
1152397062 17:80039914-80039936 GAGGGGGAGGTGGAGACAGAAGG + Exonic
1152638430 17:81439621-81439643 AGAAGGGAGGTGGGGACAGATGG + Intronic
1152790861 17:82278750-82278772 AAGTGGGAAGAGGGGAGAAAGGG + Intergenic
1153151445 18:2099416-2099438 AAGAGAGAGGGAGGGACAGAAGG + Intergenic
1153183451 18:2461002-2461024 GGGAGGGAGGTGGAGAAAAATGG - Intergenic
1153917283 18:9757415-9757437 AAGAGAGGAGTGGGGACAAGTGG + Intronic
1153939790 18:9968069-9968091 AAGAGGGGCGAGGGGACAGATGG - Intergenic
1154111713 18:11574732-11574754 AAGAGGGAGGGAGGGAAGAAAGG + Intergenic
1155535550 18:26812746-26812768 AAGAGGGAGGTGGGGAGTAGGGG + Intergenic
1155970113 18:32075158-32075180 AAAATGGAGGTGGTGAGAAATGG - Intergenic
1156028784 18:32688904-32688926 AAGGTGGAGGTGGTGAGAAATGG + Intronic
1156065871 18:33141849-33141871 AGAAGGGAGGTGGGGAAATAGGG - Intronic
1156194752 18:34761512-34761534 GAGAGGGAAGTAGGGACAGAGGG + Intronic
1156196382 18:34778365-34778387 AAGAGTGAAGTGGAGACAATCGG - Intronic
1156440194 18:37178196-37178218 GAGTGGGAGGTGGGGACATGGGG - Intronic
1156465723 18:37346965-37346987 AACAGGGAGGAGGGGAAGAAGGG + Intronic
1156469440 18:37368267-37368289 AAGAGGGAGATGGGGTCAGATGG - Intronic
1156541763 18:37919000-37919022 TAGAGGGAGTAGGGGAAAAATGG + Intergenic
1156825334 18:41424372-41424394 AAGAGGGAGTTGAGGCTAAAAGG - Intergenic
1157021211 18:43784416-43784438 CAGAGGGTGGTGGGGCCACAGGG + Intergenic
1157612065 18:48963437-48963459 AGGAAGGATGTGGGGGCAAATGG - Intergenic
1157856613 18:51110423-51110445 AAGAGGGCAGTGGGGTCAGAGGG + Intergenic
1157951508 18:52043478-52043500 GAGAGGGAGGGGGAGAGAAAAGG + Intergenic
1158514373 18:58119185-58119207 AAGGGAAAGATGGGGACAAAGGG - Intronic
1158536160 18:58309810-58309832 CAGAGGGAGGTGGGGACATCAGG + Intronic
1159075589 18:63678021-63678043 ATGAGGGAGGTAGGGGAAAAAGG + Intronic
1159991807 18:74917535-74917557 AAGACGTATATGGGGACAAAGGG - Intronic
1160194112 18:76738927-76738949 GGGAGGGAGGGAGGGACAAAAGG - Intergenic
1160221427 18:76980626-76980648 CTGAGGGAGGTCGGGAGAAATGG - Intronic
1160674141 19:379856-379878 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674906 19:384870-384892 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674916 19:384912-384934 GAGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674929 19:384954-384976 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674941 19:384996-385018 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674953 19:385038-385060 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1161470931 19:4456506-4456528 CAGAGGGTGGTGGGGACTGATGG - Intronic
1161483909 19:4524686-4524708 TGGAGGGAGGTGGGGGGAAAGGG - Intronic
1161548136 19:4894834-4894856 AAGTGGGAGGTGAGGTCAGAGGG - Intronic
1161607360 19:5222459-5222481 AAGAGGGGGGAGGGGAGCAAGGG + Intronic
1161653985 19:5502113-5502135 AAGAGGGAGAGGGAGAGAAAGGG + Intergenic
1161913913 19:7214855-7214877 AGGAAGGAGGTGGGGACGGAGGG - Intronic
1161984444 19:7645904-7645926 GAGAGGAAGATGGGGACAGAAGG - Intronic
1162105209 19:8366118-8366140 GAGAGGGAGGTGGTGAGAACTGG + Intronic
1162870691 19:13584301-13584323 AAGACAGATCTGGGGACAAAAGG - Intronic
1163548537 19:17952671-17952693 GAGAGGGAGGAGGGGGCAACGGG - Intronic
1163779648 19:19239699-19239721 AGGAGGGAGGAGGGGATGAATGG - Intronic
1164441166 19:28281947-28281969 AAAAGGGAGTTAGGGAGAAAGGG - Intergenic
1164505595 19:28858474-28858496 AAGAGGGAGGGAGGGAAAGAGGG + Intergenic
1164526338 19:29016180-29016202 AAGAGGGAGAGGGGGAGAGAGGG - Intergenic
1164591917 19:29512095-29512117 AGGAGGAAGGAGGGGAGAAAAGG + Intergenic
1164793154 19:31004860-31004882 AGGAGGGAGGGAGGGAGAAAGGG - Intergenic
1165714813 19:38037466-38037488 GAGAGGTAGGTGGGGGCAGATGG + Intronic
1165740623 19:38203285-38203307 CAGAGGGAGATGGGGGCAAATGG - Intronic
1165949328 19:39465109-39465131 AAGAGGGTGGGAAGGACAAAAGG - Intronic
1166004015 19:39894857-39894879 ATGAGGGAGGTAGGGAGGAAGGG - Intronic
1166064461 19:40348990-40349012 AAGAGGGTGATGGCGACAGAAGG - Intronic
1166650355 19:44569387-44569409 GAGAGGGAGGGGGAGACAGAAGG + Intergenic
1166734804 19:45077742-45077764 AAGAGGGAACTGGGGACAGATGG - Intergenic
1166954668 19:46455335-46455357 AGGAGGGAGGCGGGGAGGAAGGG - Intergenic
1166985726 19:46659294-46659316 GAGGGGGAGGAGGGGACAGAGGG + Intronic
1167172594 19:47843177-47843199 ACAAGGCAGGTGGGGACAGAAGG + Exonic
1167208474 19:48118232-48118254 AAGATGTGGGTGGGGACACACGG - Intronic
1167443832 19:49525783-49525805 CAGAGAGAGGTGCGGACAGAGGG + Intronic
1167640762 19:50680120-50680142 GAGAGGGAGGTGGGGAAACAGGG + Intronic
1167837487 19:52086087-52086109 CAGAGAGAGGAGAGGACAAAAGG + Intronic
1167934768 19:52897191-52897213 AGGAGGGAGGTGGGGAGCGACGG + Intronic
1168041918 19:53765663-53765685 AAGAGGGGGGTGGGTACTGAAGG - Intergenic
1168309100 19:55451843-55451865 AAGCGGGATGTGGAGACAGAGGG - Intergenic
1168434248 19:56304696-56304718 GAGAGGGGGATGGGGAGAAAGGG + Intronic
1168712699 19:58511162-58511184 AGTAGGCAGGTGGGGACCAAGGG + Intronic
925653852 2:6123604-6123626 AAGAGGGAACTAGGGAGAAAGGG - Intergenic
926105371 2:10146482-10146504 AGGTGGCAGGTGGGGACAGAGGG - Intronic
926368783 2:12159645-12159667 AAGAAGGAGGTAGGGAGGAAAGG - Intergenic
926786238 2:16521269-16521291 AGGAGTGAGCTGTGGACAAAAGG - Intergenic
927498384 2:23565506-23565528 AAGAGGGAGCTGGGGGGAAGAGG + Intronic
927811165 2:26180969-26180991 AAGGGGGAGGTGGGGAAGGAAGG - Intronic
927868662 2:26609375-26609397 GAGAGGGAGGTGGGGAGAGGAGG - Intronic
928169612 2:28994943-28994965 AAGGGAGATGTGGGGATAAAGGG + Intronic
929171157 2:38934544-38934566 AAGCGGGAGGAAGGGAGAAAAGG - Intronic
929223338 2:39487929-39487951 AAGGGGGAGGGAGGGAAAAAGGG - Intergenic
929291376 2:40195948-40195970 TAAAGGGAGGCGGGGAGAAAGGG + Intronic
929804663 2:45134270-45134292 ACGTGGGAGGTGGGGCCTAATGG - Intergenic
929863535 2:45699136-45699158 AGGAGGGAGTTGGGGGCACAAGG - Intronic
930423543 2:51183492-51183514 GAGAGGGAGGTGAGGAATAAAGG + Intergenic
930800436 2:55438000-55438022 TGGCGGGAGCTGGGGACAAATGG + Intergenic
931189754 2:59988734-59988756 AAGCAGGAGATGGGGCCAAAGGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931768744 2:65479599-65479621 AAACGGGAGGGGGGGAGAAAAGG - Intergenic
931801751 2:65765519-65765541 CAGAGAGAGCTGGGGACACATGG - Intergenic
932036248 2:68250194-68250216 AAAAGGGAGCTGGGAAGAAAAGG + Intronic
932439710 2:71726137-71726159 GAGAGAGAAGTGGGGAGAAAAGG + Intergenic
932571082 2:72938709-72938731 AGGAGGCAGGTGGGGAGGAAGGG - Intergenic
932781404 2:74560829-74560851 CAGAGAGAGGTGGGCACAAGTGG - Intronic
933576278 2:84072128-84072150 AAGAGGGAGGTAGGAAGGAAAGG + Intergenic
933882999 2:86689628-86689650 AAGTTGGAGGTGGGGCCTAATGG - Intronic
933948451 2:87308432-87308454 AAGAGGGAGGTGAAGAAGAAAGG - Intergenic
934162894 2:89269165-89269187 AATTGGGAGGTGGGGCCTAATGG + Intergenic
934204379 2:89913359-89913381 AATTGGGAGGTGGGGCCTAATGG - Intergenic
934476021 2:94594089-94594111 AAGAGAGAGGGAGGGAGAAAAGG - Intronic
934556544 2:95289672-95289694 AAGAGGGAAGTGGGGGCCAGGGG - Exonic
934674355 2:96239208-96239230 AAGAGGGAGATGGGGAGTATCGG + Intergenic
934905553 2:98198669-98198691 GAGGGGGAGTTGGTGACAAAGGG - Intronic
935294192 2:101634513-101634535 AAGAGGGAGGGAGGGAGAGAAGG + Intergenic
935814199 2:106831222-106831244 AAGAGGAATGTGGGGCCAGAGGG + Intronic
936382253 2:111996501-111996523 AAGAGGGAGTTGGTGAACAAAGG + Intronic
936694671 2:114931551-114931573 ATGTTGGAGGTGGGGCCAAATGG - Intronic
936912790 2:117610169-117610191 AAGAGGGAGGTTGGGGGGAAGGG + Intergenic
936921593 2:117694716-117694738 AAGATGGAGGTGAGGACAACAGG - Intergenic
937262913 2:120597859-120597881 AGGTCGGAGGTGGGGAGAAAAGG + Intergenic
937293772 2:120797728-120797750 GAGAGGGAGGAGGGGAGAGAGGG + Intronic
937619622 2:123970736-123970758 AAGAGGGAGGGAGGAAGAAAGGG + Intergenic
937653195 2:124344094-124344116 CATTGGGAGGTGGGGACTAATGG - Intronic
938294807 2:130171611-130171633 CAGAGGGTGGAGGGGAGAAAGGG - Intronic
938461824 2:131502233-131502255 CAGAGGGTGGAGGGGAGAAAGGG + Intergenic
938583790 2:132670242-132670264 GAGTGGGAGGTGGGGAGAAAAGG - Intronic
938640522 2:133273502-133273524 AAGGGGGAGGAGGAGAAAAAAGG + Intronic
939059964 2:137409737-137409759 AAGAGAGAGGTGGGGGCATGGGG + Intronic
939218027 2:139265276-139265298 AAGAGGCAGGAGTGGCCAAAGGG - Intergenic
939856538 2:147365495-147365517 AGAACGCAGGTGGGGACAAAGGG + Intergenic
939859939 2:147407114-147407136 AAGAAGGAAGTGGGGGCAAGAGG + Intergenic
939859945 2:147407131-147407153 AAGAGGGAAGTGGGGACAGGTGG + Intergenic
939955971 2:148527935-148527957 GAGAGCGAGGTGAGGACACACGG - Intergenic
940039989 2:149350191-149350213 AAGTGGGGAGAGGGGACAAAAGG - Intronic
940611776 2:156001933-156001955 AAAAGGGAGGGGGGGTGAAAGGG + Intergenic
941463656 2:165800219-165800241 AAGAGAGAGGTGAGGGCCAAGGG - Intergenic
941479235 2:165985305-165985327 GAGAGGGAGGAAGGGAGAAAGGG + Intergenic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
941868097 2:170355566-170355588 AAGTGGGAGTTGGCAACAAAAGG - Intronic
941890717 2:170578285-170578307 AGGAGGAAGGCGGGGCCAAAAGG + Intronic
941901829 2:170686316-170686338 AAGAGGGAGGGGAGGAAAGAAGG + Intergenic
941923338 2:170872990-170873012 AAGAGGGAGAGAGAGACAAAGGG + Intergenic
942617534 2:177809581-177809603 AAGAGGGAGGTAGGATGAAAGGG - Intronic
942640553 2:178056904-178056926 AGGAGGGAGAAGGGGAAAAATGG + Intronic
943048503 2:182887506-182887528 AGGAGGGAGGTTGGGAGACAGGG + Intergenic
943293612 2:186108751-186108773 GGGTGGGAGGTGGGGACAAAGGG - Intergenic
944186952 2:196959534-196959556 CACAGGGAGGTGGGAAAAAATGG + Intergenic
944651716 2:201837343-201837365 GAGAGGGAGAGGGGGAGAAAGGG + Intronic
945050520 2:205819891-205819913 AAGAGGGAGGACAGGACAGAGGG - Intergenic
945419607 2:209618183-209618205 AAGAGGAAGGAAGAGACAAAAGG + Intronic
946072271 2:217044609-217044631 AAGAGGAAGGGGGAGAAAAAGGG - Intergenic
946138445 2:217667444-217667466 AACAAGAAGGTGGGGACAAAGGG + Intronic
946337475 2:219048194-219048216 CAGATGGAGGTGGTGACAAAGGG - Intergenic
946403556 2:219481256-219481278 GAGGGGCAGGCGGGGACAAAGGG - Intronic
946797996 2:223376775-223376797 AAGGGGTAGTTGGGGACAAAAGG - Intergenic
947005126 2:225502645-225502667 AAGAGAGAAGTGGGGAAGAAGGG - Intronic
948137250 2:235645689-235645711 CAGAGGGAGGTGGGGAGACAAGG + Intronic
948500560 2:238390122-238390144 AGGAGGCAGGAGGGGACAAGAGG + Intronic
1168799358 20:634446-634468 GAGAGAGAGATGGGGACAAAAGG + Intergenic
1168975608 20:1963232-1963254 AAGAAGGAGGGAGGGAGAAATGG + Intergenic
1169423153 20:5475527-5475549 CTGAGGCAGGTGGGGACCAAGGG - Intergenic
1169505760 20:6209391-6209413 AAGAGGGAGGGAGGGAAAGAGGG - Intergenic
1170109539 20:12790091-12790113 AAGAAGGTGATGAGGACAAAGGG - Intergenic
1170540981 20:17387762-17387784 AACTGGGAGGCGGGGACAAGTGG + Intronic
1170764149 20:19275659-19275681 AGGAGGGAGGAGAGCACAAAAGG + Intronic
1170851757 20:20011295-20011317 AAGAGAGGGGAGGGGAGAAAGGG - Intergenic
1170973026 20:21134147-21134169 AGGCGTGAGGTGGGCACAAAGGG + Intronic
1171021644 20:21589518-21589540 AAGAGGGAGAGGGGTTCAAATGG - Intergenic
1171111199 20:22484036-22484058 AAGAGAGAGATGGGGAGACAGGG - Intergenic
1171291190 20:23984074-23984096 GAGACGGAGGTGGGCTCAAATGG - Intergenic
1171779953 20:29409697-29409719 AAGAGGGAGGGAGGGAGAAAGGG - Intergenic
1172121084 20:32599065-32599087 AATAGCAAGGTGGGGACAATAGG + Intronic
1172269981 20:33649486-33649508 GAGGGGGAGGAGGGGACACAAGG - Exonic
1172477205 20:35247911-35247933 GACAGGGAGGTGGGGAGAAATGG + Intronic
1172537952 20:35688755-35688777 AAGAGGGAGGGAGGGAAAAGAGG + Intronic
1172632262 20:36386370-36386392 GAGAGGGAGGAGGGAAAAAAGGG + Intronic
1172751846 20:37256817-37256839 AAGGGGGAGGTGGGGAGCAGTGG + Exonic
1172783523 20:37451232-37451254 AGGAAGGAGGTGGGGAGAAGGGG - Intergenic
1173374585 20:42472012-42472034 AAGAGGGATGGGGGTACAAAAGG + Intronic
1173443181 20:43095891-43095913 AGGAGAGAGGTGGGGAGAGAGGG - Intronic
1173443210 20:43096011-43096033 AGGAGAGAGGTGGGGAGAGAGGG - Intronic
1173596016 20:44258742-44258764 CAGAGAGAGGCGGGGACAAATGG - Intronic
1173673870 20:44817115-44817137 AAGAGGGAGGGAGGGAGAAAGGG - Intergenic
1173952202 20:47002150-47002172 GAGAGAGAGGTGGAGAGAAAAGG - Intronic
1174093199 20:48066632-48066654 CAGAGTGAGGTGGGGTCAGAAGG + Intergenic
1174518705 20:51113325-51113347 AAGAGAGAGAAGGGGAGAAAGGG - Intergenic
1174569225 20:51489260-51489282 AGGAGGGAGATAGGGCCAAAGGG - Intronic
1174655362 20:52167505-52167527 AAGAGGGAGGGAGGGAGGAAGGG - Intronic
1174832708 20:53827750-53827772 AGGAGGGAGGGAGGGACAGAGGG - Intergenic
1175527247 20:59643812-59643834 AAAAGGGGGGTGGGGATAGAAGG + Intronic
1175919564 20:62444344-62444366 ATGAGGGAGGTGAGGAGCAATGG + Intergenic
1175950145 20:62579084-62579106 CAGAGGGAGGCAGGGACAGAGGG - Intergenic
1176024182 20:62977482-62977504 AGGAGGAAGCTGGGGACAGATGG + Intergenic
1176275590 20:64265691-64265713 AAGAGGGAGGTGAGGGGGAAGGG - Intronic
1177649702 21:23944901-23944923 AAGAGGGAGGTGGGGAAAGAGGG - Intergenic
1178175244 21:30089707-30089729 AAGATGGAGGTGGGGAGGGAGGG - Intergenic
1178258795 21:31079834-31079856 AGGAGGTAGTTGGGGACATAGGG - Intergenic
1178505023 21:33155126-33155148 AAGAGGGAGGGAGGGAAAGAAGG + Intergenic
1179263348 21:39778388-39778410 AAGAGGGAGGTAGGGAGAGAAGG - Intronic
1179644131 21:42765219-42765241 CAGATGGATGTGTGGACAAATGG + Intronic
1179657623 21:42854901-42854923 AAGAGGGAGCGGAGGACACAGGG + Intronic
1181114075 22:20620488-20620510 CAGAGGGTGGAGGGGAGAAAGGG - Intergenic
1181400768 22:22648861-22648883 GAGATGGAGGTGGGCTCAAATGG + Intergenic
1181441502 22:22938225-22938247 AAGAAGGAGGGAGGGAGAAAGGG + Intergenic
1181712407 22:24698751-24698773 AAGAGGGAGGGAGGGGAAAAAGG - Intergenic
1182619786 22:31612828-31612850 AAGAGGGAGCTGGGGACGTGTGG - Intronic
1182773608 22:32814259-32814281 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
1182973030 22:34595345-34595367 GGGAGGGAGGGAGGGACAAAGGG + Intergenic
1183067846 22:35375833-35375855 AGGACGGAGGTGGGGGCAACTGG + Intergenic
1183627086 22:39011045-39011067 AAGAAAGAGATGGGGGCAAAGGG - Intergenic
1183754347 22:39746192-39746214 AAGATGGAGGCGGGGAAAATGGG - Intronic
1184238735 22:43200447-43200469 AAGATGGAGGTGTAGAGAAAAGG - Exonic
1184241724 22:43214519-43214541 ATGGGGGAGGTGGGGACCACAGG - Intronic
1184376480 22:44116942-44116964 AAGAGGGAGATGGGGAGGAGTGG + Intronic
1184402199 22:44280686-44280708 GGGAGGGAGGTGGGGACAATGGG + Intronic
1184453977 22:44598862-44598884 AAGAGGAAGGAGGGGAGAAGAGG + Intergenic
1184912700 22:47547068-47547090 AGGAGGGAGGTAGGGAGACAAGG - Intergenic
1185064701 22:48625600-48625622 CTGAGGGAGCTGGGGAGAAAAGG - Intronic
1185135798 22:49071422-49071444 AAGAGGGAGGGAGGGACAGAGGG - Intergenic
949562206 3:5213440-5213462 AAGAGGGAGGGCAGGACCAAGGG + Exonic
950094293 3:10319821-10319843 AAGAGGGAGGGGGAGAGAAAAGG + Intronic
950472276 3:13193669-13193691 AAGAGGCAGTTGGAGACCAAAGG + Intergenic
950582109 3:13869311-13869333 AAGAGGGAGGGAGGGAGAGAGGG + Intronic
950709310 3:14803601-14803623 AAGGGGGAGGTGGTGAGAGATGG + Intergenic
950763742 3:15257830-15257852 AAGAGAAAGGGGGGGAAAAATGG - Intronic
951923896 3:27886427-27886449 GAGAGAGAGGTGGGGAGGAAAGG + Intergenic
952892172 3:38050658-38050680 AAGTTGGAGGTGGGGCCCAATGG - Intronic
952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG + Intronic
953225448 3:41014923-41014945 AAGTGAGAAGTGGGAACAAAGGG + Intergenic
953392376 3:42540993-42541015 AGGTGGCAGGTGGGGACAGAGGG + Intergenic
953685075 3:45071263-45071285 AGAAGAGAGGTGGGGGCAAAAGG + Intergenic
953685300 3:45073470-45073492 AGAAGAGAGGTGGGGGCAAAAGG - Intergenic
953717206 3:45325922-45325944 AAGTGGGAGGTGGGGAGGCAGGG - Intergenic
953720583 3:45351243-45351265 AAGAGATAGGTGGGGCCAAGAGG + Intergenic
953933014 3:47015953-47015975 GGGAGGGGGGTGGGGAGAAAGGG - Intergenic
954280417 3:49573250-49573272 AATAGGTAGGTGGGGAGGAAAGG + Intronic
954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG + Intronic
954535801 3:51358462-51358484 AGGAGGGAGATGGGGAGAGAAGG - Intronic
954535823 3:51358576-51358598 AAGAGGGAGGGAGAGACAGAGGG - Intronic
954827369 3:53385878-53385900 AAGATGGTGGTGGTGACAAGGGG - Intergenic
954937976 3:54344387-54344409 ATGAGGGAGGGAGGGAGAAAGGG + Intronic
954994817 3:54871737-54871759 CAGAGGGACGTGGAGACAAGGGG + Intronic
955796462 3:62642475-62642497 AAGTGGGAGGGGTGGAGAAAAGG + Intronic
956360600 3:68442621-68442643 AAGAGGGAGGCAGGGAGGAAAGG + Intronic
956733081 3:72214622-72214644 AGGAGGGAAGTGGGGACATGGGG - Intergenic
957085162 3:75670812-75670834 AAGAGGGAGAGAGGGAGAAAGGG + Intergenic
957187637 3:76963052-76963074 AAAATGAAGGTGGGAACAAATGG + Intronic
957550164 3:81694172-81694194 ATGAGGGAAGGGGGGAGAAAAGG + Intronic
958558434 3:95709750-95709772 AAGAGGGAAATGGGGAAAAAGGG + Intergenic
958821901 3:98984622-98984644 AAGAGGCAGGGAGGGACAAGTGG - Intergenic
960059384 3:113304626-113304648 GTGAGGGAGGTCAGGACAAAAGG - Intronic
960071279 3:113433993-113434015 AAGAGGGAGGGATGGACCAAAGG - Intronic
960151440 3:114252684-114252706 AAGTGAGAGGTGAAGACAAAAGG + Intergenic
960333741 3:116392169-116392191 CAGTGGGAGCTGGGGACAAGCGG + Intronic
960386111 3:117023774-117023796 AAGAGGGAGGGGGGAAGGAAGGG - Intronic
960944717 3:122958199-122958221 GAGCTGGAGGTGGGGACTAAAGG - Intronic
960966220 3:123106682-123106704 AAGAGGGAGGTGGGGGAATCAGG - Intronic
961197374 3:125014243-125014265 AAAAGAGAAGTGGGGACTAAGGG + Intronic
961804726 3:129481357-129481379 AAGAGGGGGGTGGGGGGCAATGG - Intronic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
962587848 3:136860791-136860813 ATGTTGGAGGTGGGGACTAATGG - Intergenic
962769717 3:138601025-138601047 AAGGAGGAGGTTGGGAGAAAGGG + Intergenic
962866422 3:139451408-139451430 TCTAGGAAGGTGGGGACAAAGGG + Intergenic
962904539 3:139789870-139789892 GAAAAGGAGGTGAGGACAAAAGG + Intergenic
963263549 3:143216701-143216723 AGGAGGGAGAGGGGGAGAAAAGG - Intergenic
963349132 3:144131576-144131598 AAGAGAGAGTTGGGGAGATAAGG + Intergenic
963566118 3:146933126-146933148 TAGAGGGAGGTGGGGATAGCTGG - Intergenic
964040214 3:152252291-152252313 AAGAGAGAGGGAGGAACAAAGGG - Intronic
964244384 3:154633810-154633832 AAGAGGGAAGTGGAGAAAAATGG - Intergenic
964878851 3:161400971-161400993 AAAAAGGAGGTGGGGAAATATGG - Intergenic
965512377 3:169582411-169582433 AAGAGGGAGATGGGGAAAAACGG + Intronic
966679553 3:182626873-182626895 AAGGGGGAGGGAGGGAGAAAAGG + Intergenic
967137340 3:186523575-186523597 CAGACAGAGGTGGGAACAAAGGG - Intergenic
967234292 3:187369162-187369184 AAGAGGGAAGTGGTGAGTAAGGG - Intronic
967290671 3:187916784-187916806 ATGCAGGAGGTGGGGACAATTGG - Intergenic
967423416 3:189298888-189298910 GAGAGGGTGGTGGGTACAGAAGG - Intronic
968010130 3:195269112-195269134 CAGCGGGAGCTGGGGACAAGGGG + Intronic
968599197 4:1501234-1501256 AAGAGAGGAGTGGGGAGAAAGGG + Intergenic
968779972 4:2573116-2573138 AAGAGTGAGGCGGGAAAAAAAGG - Intronic
968905827 4:3450067-3450089 CAGGGGGAGGTGGGGCCAGAGGG + Intergenic
969229987 4:5823509-5823531 AAGTTGGAGGTGGGGCCTAATGG + Intronic
969341827 4:6546897-6546919 AAGATGGAAGAGGGGAGAAAAGG + Intronic
969454693 4:7294639-7294661 AAGAGGGAGAGGGGGAGGAAAGG - Intronic
969495261 4:7522865-7522887 AGGAGGGAAGAGGGGAGAAAGGG - Intronic
970409940 4:15795136-15795158 AAGGGGGTGGTGGGAAAAAATGG + Intronic
970914956 4:21321887-21321909 AGGAGGGAGGAAGGGACAGAGGG + Intronic
970915021 4:21322135-21322157 AGGAGGGAGGGAGGGACAGAAGG + Intronic
971258586 4:25035452-25035474 AGGAGGGAGGTGGAAAGAAATGG + Intergenic
971360114 4:25930387-25930409 AAGAGGGAGGGAGGGAGGAAAGG - Intergenic
972004512 4:34083115-34083137 GAGAGGGAGGGAGGGAGAAAGGG - Intergenic
972400117 4:38693848-38693870 AAGAAGGTGGTGGAGAGAAAAGG - Intronic
974435907 4:61857040-61857062 GAGAGGGAGGGAGGGAGAAAGGG - Intronic
975966005 4:79973116-79973138 AAGAGGAAGGTGGGGAGGAAGGG + Intronic
976040568 4:80880126-80880148 AGGAGGGAAGCGGGGAGAAAGGG + Intronic
976140569 4:81987224-81987246 AAGAGAAAGGTAGAGACAAAAGG + Intronic
976225843 4:82795353-82795375 AGTAGGGAGGTGGTGAAAAAGGG + Intronic
976327061 4:83783630-83783652 ATGTTGGAGGTGGGAACAAATGG - Intergenic
976559478 4:86485128-86485150 AAAAGGGAGGTGGGGGTAACAGG - Intronic
976720720 4:88166377-88166399 AAAAGGGAGGAGGAGAGAAAGGG - Intronic
976842893 4:89452404-89452426 GAGAAGGAGGAAGGGACAAATGG + Intergenic
977470185 4:97433625-97433647 AAGAGAGAGGTTGGGAGATATGG + Intronic
977912082 4:102548813-102548835 AAGAGGGAGATTTGGACACAGGG - Intronic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
977919216 4:102625178-102625200 AGGAGGGAGGTGAGGAGGAAGGG - Intergenic
978133337 4:105226621-105226643 AAGAGGGAGGGAAGGACAGAGGG - Intronic
978535342 4:109756318-109756340 AGGAGGGAGGGAGGGAAAAAAGG + Intronic
978649572 4:110984361-110984383 AAGAGGGAAGAGAGGAAAAAAGG - Intergenic
979506390 4:121502581-121502603 AGGAGGGAGGGAGGGAGAAAAGG - Intergenic
979994353 4:127412543-127412565 CAGAGGGAGGTGGGGAAGGAGGG + Intergenic
980325485 4:131339418-131339440 AAGAGGGAAGTGAGAAGAAAAGG + Intergenic
980431287 4:132700219-132700241 GAGATGGAGGTGGGGAAAACTGG + Intergenic
980621380 4:135309039-135309061 GTGTGGGAGGTGGGGACTAATGG + Intergenic
981253621 4:142634034-142634056 AGGAGGGAGGTGGGGGGAAAAGG + Intronic
981413339 4:144458756-144458778 AGGAGGGAGGAGGGGAGGAAGGG + Intergenic
981557234 4:146008429-146008451 GAGAGGGAGGTAGGGAAGAAAGG - Intergenic
981601255 4:146491539-146491561 TGGAGGGAGGAGGGGAAAAAAGG + Intronic
981653392 4:147084541-147084563 AAGTGTGAGGTGGAGACAACAGG - Intergenic
982220881 4:153124233-153124255 AAGAGGGAAGTTGGGGCTAAAGG - Intergenic
982349513 4:154399673-154399695 CAGAGGGAGTTGGTGACAAAGGG + Intronic
983691035 4:170469550-170469572 AAATGGGAGGGAGGGACAAAGGG - Intergenic
984106992 4:175559952-175559974 AAGAGGGAGGGAGGGAAAGAAGG + Intergenic
984226289 4:177039313-177039335 AAGAGGGACTTGGGAAGAAAAGG - Intergenic
985025731 4:185737478-185737500 AAGTGGGCAGTGGGGAGAAACGG + Intronic
985445781 4:190020754-190020776 AAGAGGGAGGGAGGGAGAAAGGG - Intergenic
985487233 5:158501-158523 CAGAGGGAGGAGGGGAGATAGGG - Intronic
985623382 5:968391-968413 GTGAAGGAGGTGCGGACAAATGG + Intergenic
985776431 5:1846498-1846520 AAGAGGGGGCTGGGGACCAGGGG + Intergenic
986752121 5:10796658-10796680 AAGAGGTAGGTGGAGGGAAATGG - Intergenic
988920474 5:35936657-35936679 AAGAGGGAGGAGGAGAGACAGGG - Intronic
989404012 5:41040281-41040303 ACAAGAGAGGTGGGGACAGAGGG - Intronic
989568634 5:42925122-42925144 AAGGGGGAGGTGGGGACAAAGGG - Intergenic
989577212 5:42999611-42999633 AGGAGGGAGGGAGGGACATAAGG + Intergenic
989846960 5:46156817-46156839 AATAGGATGGTGGGGTCAAATGG + Intergenic
990774200 5:59286949-59286971 GAGAGGGAGGTGGAGCCATATGG + Intronic
991092914 5:62710131-62710153 AAGAGGGAGGAAGGGAGGAAGGG - Intergenic
991127878 5:63088080-63088102 AAGAGGGAGCTGGGAAGAGAAGG + Intergenic
991270700 5:64776043-64776065 AAGAGAGAGGTGGGGAGGAGTGG + Intronic
991558642 5:67924748-67924770 AAGGGTGAAATGGGGACAAAGGG - Intergenic
991988128 5:72310401-72310423 AAGAGGGGGGTGGGGGAAAATGG + Intronic
992022391 5:72637228-72637250 GAGAGGGAGGGAGGGAGAAAGGG + Intergenic
992059650 5:73029877-73029899 ACGTGGGAGGTGGGGCCTAATGG - Intronic
992084897 5:73269684-73269706 AGGTGGTAGGTGGGGACCAAAGG + Intergenic
992290467 5:75274224-75274246 GAGAGGGAGGTAGAGAGAAATGG + Intergenic
992531348 5:77654433-77654455 AGGACAGAGGTGGGGACAAGAGG - Intergenic
992678930 5:79133999-79134021 AAGAGGAAGGAAGGGAGAAAGGG + Intronic
993626545 5:90231796-90231818 AGGAGGGAGGGAGGGACAGACGG + Intergenic
995436014 5:112136196-112136218 AAGAGAGAGGTGGGGAGGGAGGG + Intergenic
996420910 5:123261302-123261324 GAGAGGGAGTTGAGTACAAAAGG + Intergenic
997632522 5:135379474-135379496 AAGAGGGTGGTGGGAAGAGACGG + Intronic
997700512 5:135894935-135894957 AACAGGGTGGTGGGGAGGAAGGG + Intronic
997863775 5:137443306-137443328 AAGAGGGAGGAGGAGACCTAAGG - Intronic
997880835 5:137588115-137588137 AAGAGGGAGGTGGAGAGCCACGG - Intronic
998012348 5:138705336-138705358 AAGAGGGAGGTGGGGGAACCAGG + Intronic
998503156 5:142651169-142651191 AAGAAGGAGGTGGAGACCCAGGG - Intronic
998697540 5:144657203-144657225 AAGAGCGGGATGGGCACAAAAGG + Intergenic
999268803 5:150284480-150284502 TGGAGGGAGGTGGGGAGGAAGGG + Intronic
999372561 5:151064697-151064719 AAGAGGGAGGCGTGGGCTAAGGG - Intronic
999380512 5:151117939-151117961 CAGGGGGAGGTGGGGATGAAAGG + Intronic
999642416 5:153685184-153685206 AAGAGGGATCTGAGGACACATGG + Intronic
999747437 5:154603172-154603194 AAGGGCAAGGTGGGGACACAGGG - Intergenic
1001003766 5:168031674-168031696 AAGAGGGAGGAAGGGAGCAAGGG + Intronic
1001159726 5:169301997-169302019 AAGAAGGCGCTGGGGACAGAAGG - Intergenic
1001417371 5:171555525-171555547 CAGAGGGAAGTGTGGACACAAGG + Intergenic
1001594407 5:172888656-172888678 AGGAGTGAGGTGGGCACAAAGGG - Intronic
1001634318 5:173198835-173198857 AAGAGGGAGAGAGGGAGAAAGGG - Intergenic
1001919421 5:175588685-175588707 AAGTGGGAGGGGAGGAGAAAAGG + Intergenic
1002083089 5:176748999-176749021 AAGGGGGTGGTGGGGTGAAATGG - Intergenic
1002317272 5:178351228-178351250 AAGATCTAGGTGGGGAGAAAGGG + Intronic
1002391331 5:178914650-178914672 AGAAGGGAGGGGGGGACAGAAGG + Intronic
1002414987 5:179115657-179115679 GAAAGGGAGGGAGGGACAAAAGG + Intronic
1002972948 6:2043070-2043092 AAGAGTGATGTGAAGACAAAGGG + Intronic
1002993294 6:2257764-2257786 AATTGGGAGGTGTGGACTAACGG + Intergenic
1003642561 6:7887953-7887975 TAGAGAGAAGTGGGGGCAAATGG - Intronic
1003681970 6:8265691-8265713 AAGAGGAAGGAAGGGAAAAAAGG + Intergenic
1004347432 6:14861717-14861739 ACTGGGGAGGTGGAGACAAAAGG + Intergenic
1004354599 6:14920231-14920253 AAGAGGGACAAGGGGACAGAGGG - Intergenic
1004390103 6:15202806-15202828 AAGAAGGAGGTGGAGAGAGAAGG + Intergenic
1005257823 6:24023228-24023250 AAGTGGGAGAAGGGGAGAAAGGG + Intergenic
1005631283 6:27710656-27710678 AAGAAGTAAGTGGGGAAAAAGGG - Intergenic
1005719295 6:28585386-28585408 AGGAAGGATGTGGGGGCAAATGG + Intronic
1005850765 6:29819046-29819068 GAGAGGGAGGGAGGGACAGAAGG - Intergenic
1005851488 6:29826550-29826572 GAGAGGGTGGTGGGGATTAAGGG + Intergenic
1005863400 6:29918574-29918596 AAGAGGGAAGGAGGGACAGAAGG - Intergenic
1005864006 6:29924997-29925019 GACAGGGTGGTGGGGACTAAGGG + Intergenic
1006038111 6:31229953-31229975 CAGAGGCAGGTGGGGAGAGAAGG - Intergenic
1006113017 6:31760137-31760159 CAGAATGTGGTGGGGACAAAGGG + Exonic
1006184743 6:32175492-32175514 AAGAGTCATGTGGGGTCAAAGGG + Intronic
1006299472 6:33185943-33185965 AGGAGGGAGGTGGGGAGAGGTGG + Intronic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1007056933 6:38895670-38895692 CAGAGGGAAGAGAGGACAAAGGG - Intronic
1007160937 6:39791489-39791511 CAGAGGGAGCTGGGGAAAATAGG + Intergenic
1007187123 6:39981375-39981397 AAGATGGGGGTGGGGAGTAAGGG + Intergenic
1007217114 6:40249041-40249063 CAGAGGAAGGTGGGGAAGAAGGG - Intergenic
1007424650 6:41739128-41739150 GTGAGAGAGGTGGGGATAAAGGG + Intronic
1007686924 6:43672453-43672475 AGGAGGGGGGTGGGGAAAGATGG + Exonic
1007756966 6:44105950-44105972 CAGAGTGAGGTGGGGAGAACTGG - Intergenic
1007913523 6:45539024-45539046 AAGATGGAGGGGGAGAGAAAAGG - Intronic
1008161412 6:48080809-48080831 AAGAGGTACTTGGGAACAAAAGG - Intergenic
1008341800 6:50374878-50374900 AGAAGGCAGGTGGGAACAAAGGG - Intergenic
1008891707 6:56500545-56500567 AAGAGTGACATGGAGACAAAGGG + Intronic
1009594011 6:65711084-65711106 AAGAGGGAGGTGGGCAAGAGTGG - Intergenic
1009843026 6:69100949-69100971 AGGAGGGAGGGAGGGAGAAAGGG + Intronic
1009923021 6:70086415-70086437 AAGAGGAAGGTGAGGGAAAAAGG + Intronic
1010622097 6:78089472-78089494 AAGAGGGAGGGAGGGAGAGAGGG + Intergenic
1010656582 6:78518525-78518547 CAGAGGGAGGTGGGGTGGAAGGG - Intergenic
1010914673 6:81601151-81601173 AGGAGGGAGGGGAGGAGAAAAGG + Intronic
1011366332 6:86586322-86586344 AAGAGGGAGATGAGGTCAACAGG + Intergenic
1011949134 6:92942597-92942619 AAGGGGGAGGGAGGGAGAAAAGG - Intergenic
1012291849 6:97466063-97466085 GAGAGGGAAGTGGGGGCACAAGG - Intergenic
1012449207 6:99337266-99337288 AAGAGGCAGGAGGGGAGACAAGG + Intronic
1013216608 6:108033109-108033131 AAGAGGGAGGGAGGGAGGAAGGG - Intergenic
1013644520 6:112123363-112123385 AATAGGGAGGCAGGGACTAAAGG - Intronic
1013705319 6:112826318-112826340 AAGAGGGAGATGGTGAAGAATGG + Intergenic
1014078666 6:117265249-117265271 GAGAAGGAGGCGGGGACGAAGGG - Intergenic
1014408118 6:121077373-121077395 AAAAGGAAGGTGGAGACAAGAGG - Intergenic
1014468583 6:121786249-121786271 AAAAGGAAGCTGGGGAAAAAAGG - Intergenic
1014474936 6:121860401-121860423 GAGAGGCAGGTGTGGATAAAGGG + Intergenic
1014913883 6:127121239-127121261 CTGGGGGAGGTGGGCACAAAAGG - Intronic
1015093356 6:129385251-129385273 AAGAGGAAGGGGGGGAAAGAAGG + Intronic
1016029427 6:139322482-139322504 AGAAGGGAGGTGGGGCCTAATGG - Intergenic
1016094110 6:140014970-140014992 AGGAGGGAGGGAGGGACAGAGGG - Intergenic
1016301701 6:142638834-142638856 AAGAGGGAGGGAGGGAGAGAGGG + Intergenic
1017430900 6:154369807-154369829 AAGAGGGAGGTGGGAACATCAGG - Intronic
1018005862 6:159620933-159620955 GAGAGGGAGGGAGGGAAAAAAGG + Intergenic
1018631443 6:165826282-165826304 AAGACGGACATGGGGACAGAGGG - Intronic
1018631486 6:165826471-165826493 CAGAGGGACGTGGGGACAGGTGG - Intronic
1018791700 6:167153714-167153736 AAAAGGGAAGTGTGGACAGACGG - Intronic
1019556527 7:1634205-1634227 CAGGGGAAGGTGGGGACAGAAGG - Intergenic
1020500237 7:8909241-8909263 AAGAGGGAGGAGGGGAAGGATGG - Intergenic
1021006248 7:15397606-15397628 GAGGGAGAGGTGGGGAGAAAAGG - Intronic
1021033867 7:15772685-15772707 CAGGAGGAGGTGGGGAGAAAGGG + Intergenic
1021952175 7:25785777-25785799 ATGAGGGAGGTGGAGATTAATGG + Intergenic
1021988445 7:26119647-26119669 CTGAGGGAGGTGAGGAGAAATGG + Intergenic
1022090254 7:27103477-27103499 AAGAGAGAGGGAGGGAGAAAGGG - Intergenic
1022225683 7:28360575-28360597 AATAGGGAGATGTGGTCAAAGGG + Intronic
1022285716 7:28955487-28955509 GAGAGGCCGGTGGGGACAGAGGG - Exonic
1022329500 7:29363926-29363948 ACTTGGGAGGTGGGGACAAGAGG + Intronic
1022385460 7:29894725-29894747 AACAAGCAGGTGGGGACAGAGGG - Intronic
1022642507 7:32201641-32201663 AAAAGGGAGGTGGAAATAAAGGG + Intronic
1022927594 7:35071725-35071747 AAGAGGGATGTGGAGGGAAAAGG - Intergenic
1023233867 7:38064013-38064035 AGAAGGGAGGTGGAGGCAAATGG + Intergenic
1023247946 7:38226733-38226755 CAGAGGGAGGTGAGCAGAAAGGG - Intronic
1023584406 7:41714310-41714332 AAGAGGGAGGGAGGGATAGAGGG + Intergenic
1023588253 7:41753446-41753468 AAGAAGCAGGAGGGGAAAAAAGG + Intergenic
1023638280 7:42235639-42235661 AAGAGGGAGGAGAGGAAAAGGGG + Intronic
1024168102 7:46755003-46755025 GACAGGGTGGTGGGGACATAGGG - Intronic
1024241665 7:47440493-47440515 AAGAGGGAAGAGGGCAGAAATGG + Intronic
1024294093 7:47829036-47829058 GGGAGGGAGGAAGGGACAAAGGG + Intronic
1024471351 7:49770956-49770978 AAGAGGGAGGGAGGGAATAAAGG + Intergenic
1026112093 7:67466431-67466453 AGGAGGGAGGGAGGGAAAAAGGG - Intergenic
1026516807 7:71079885-71079907 AAGAGGGAGAAAGGGAAAAAGGG + Intergenic
1026684390 7:72495670-72495692 AACAGAGAAGTGTGGACAAACGG + Intergenic
1026927473 7:74204264-74204286 AGGAGGGAGGGAGGGAGAAAGGG + Intronic
1026927487 7:74204305-74204327 AGGAGGGAGGGAGGGAGAAAGGG + Intronic
1026927544 7:74204478-74204500 AGGAGGGAGGGAGGGAGAAAGGG + Intronic
1026963611 7:74425367-74425389 AAGAGGGAGGGAGGGAAAGAGGG + Intergenic
1027464009 7:78491988-78492010 AAGAAGCAGGTGAGGACAAAAGG - Intronic
1027848518 7:83418407-83418429 AAGGAGGAGCTGGGGTCAAAAGG + Exonic
1029027768 7:97435518-97435540 AAGATGGAGGTAAGGAAAAAAGG + Intergenic
1029106370 7:98179625-98179647 GAGAGGGAGGGAGGGAGAAAGGG - Intronic
1029236861 7:99127328-99127350 AAGAGGGAGGGAGTGAGAAAAGG + Intronic
1029634139 7:101772742-101772764 AAGAGGGAGGAAGGGAGGAAAGG + Intergenic
1029745279 7:102512840-102512862 AAGAGGGAGGGGGAGACTGAGGG + Intronic
1030365501 7:108641365-108641387 AAGAGGGAGGGAGGGACAGAGGG - Intergenic
1030744923 7:113153496-113153518 AAGAGGGATGTGGGGAAAGCAGG - Intergenic
1030889804 7:114985630-114985652 GAGAGGGAGGTGGTGAGAGATGG - Intronic
1031491675 7:122397399-122397421 AGGAGGGAGTGGGGGAGAAATGG + Intronic
1031567418 7:123318123-123318145 ATGAGGGGGGTGGGGGCATAGGG - Intergenic
1031723229 7:125203998-125204020 AAGAGGGAGGTAAAGAGAAACGG - Intergenic
1032177065 7:129639527-129639549 AAAAGGGTTGTGGGGACAAGGGG - Intronic
1032402147 7:131630870-131630892 GAGAGGGAGGGAGGGAGAAAAGG - Intergenic
1032791005 7:135242238-135242260 GAGAGGGAGGGAGGGAAAAAGGG + Intronic
1032819258 7:135509774-135509796 AGGCGGGGGGTGGGGAGAAAGGG + Intronic
1033154580 7:138946022-138946044 AAGAGGGAGGGGAGGAGAGAAGG - Intronic
1033245371 7:139713113-139713135 CAGAGGGATGTGGGGACACAGGG + Intronic
1033463948 7:141573735-141573757 CAGAGGGACGTGGGGACATAGGG + Intronic
1033558091 7:142506621-142506643 ATGAGGGACTTGGGGAGAAAGGG - Intergenic
1033610424 7:142959230-142959252 AAGAGGGAGGGTGGGAGACAGGG + Intronic
1033614200 7:142996539-142996561 AAGAAGGAGGGAGGGATAAAGGG + Intergenic
1033930980 7:146521058-146521080 GAGATGGGGGTGGGGTCAAAGGG + Intronic
1034031449 7:147770378-147770400 AAGAGGGAGGAGTGGGGAAATGG + Intronic
1034134702 7:148755951-148755973 AAGAGGAAGGTGGGGGCAGGAGG - Intronic
1034494941 7:151414616-151414638 AAGAGTGAGGTGCTGATAAACGG + Intergenic
1034520731 7:151617282-151617304 AAGAGGGAGGGGGGGAGGGAGGG + Intronic
1034746308 7:153526902-153526924 ATGAGGGCGGTGGGGGCAGATGG + Intergenic
1035301979 7:157903278-157903300 GAGAGGGAGGTGGGAGAAAAGGG + Intronic
1036608052 8:10325063-10325085 AAGAGGCAGATGGGGCCACAGGG + Intronic
1037589806 8:20303364-20303386 AAGTGGGAGGTGGGGACGCGAGG - Intronic
1037662028 8:20936128-20936150 GAAAGGGAGGTGAGGACAGAAGG - Intergenic
1037739927 8:21600521-21600543 AAGAGGGACGTGGGGGTCAAGGG + Intergenic
1037742122 8:21616321-21616343 AGGAAGGTGGTGGGGACAATGGG + Intergenic
1038331742 8:26614393-26614415 AAGAGAGGGGTGGGGACAGGCGG + Intronic
1038414994 8:27388646-27388668 AAAGGGGAGTTGGGGAGAAATGG - Intronic
1038461516 8:27721104-27721126 ATGAGGGAGGTGGGGAGGGAGGG - Intergenic
1039694718 8:39898276-39898298 TAGTGGGGAGTGGGGACAAAGGG - Intergenic
1039728495 8:40249165-40249187 AAGAGGGAGATGGGCCCTAATGG - Intergenic
1040533436 8:48284586-48284608 AAGAGGGAGGGAGGGAGAGAGGG - Intergenic
1041063771 8:54061479-54061501 ATGAGGTGGATGGGGACAAATGG - Intronic
1041196465 8:55406612-55406634 AAGAGGGAGCTGGGATCAAGTGG - Intronic
1041571001 8:59336820-59336842 CAGAGGGAGGTGGAAACACACGG + Intergenic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1041843279 8:62296847-62296869 GAGAGGGAGGAGGAGACCAAGGG - Intronic
1042317438 8:67438773-67438795 AAGAGGGAGGTGGGCAGGGAAGG + Intronic
1042685839 8:71439362-71439384 AAGTTGGAGGTGGGGGTAAAGGG + Intronic
1042942124 8:74118388-74118410 GGGAGGGAGGTGGGGAGAGAGGG - Intergenic
1043058107 8:75466484-75466506 GAGAGGGAGGAAGGGACAGAGGG - Intronic
1043888557 8:85631054-85631076 AAGAGGGAGGGAGGGAGGAAGGG - Intergenic
1044006554 8:86943814-86943836 AAAAGGGAAGGGGGGACAGATGG + Intronic
1044730819 8:95227127-95227149 AGGTGGGAGGTGGGGAAGAAAGG + Intergenic
1044926113 8:97210147-97210169 GAGAGGGAGTTGGGGGCAACTGG - Intergenic
1045345878 8:101292901-101292923 AAGAAGGGAGTGGGTACAAATGG + Intergenic
1045414763 8:101954611-101954633 GAGAGAGAGGAGAGGACAAAGGG + Intronic
1045480799 8:102590667-102590689 AAGGGGGAGGAAGGGACGAAGGG - Intergenic
1045818774 8:106309897-106309919 AATAGAGAGGTGGGAAGAAAGGG - Intronic
1046588421 8:116176122-116176144 AAGAGGGAGGGAGGGAGGAATGG + Intergenic
1047494722 8:125401545-125401567 AAAGGGGAGGTGGGCAGAAAAGG - Intergenic
1048190974 8:132288645-132288667 ATGAAAGAGGTAGGGACAAATGG - Intronic
1048205412 8:132411667-132411689 AGGAGGGAGGTGGAGACAGGAGG - Intronic
1048292373 8:133190891-133190913 AGGCTGGAGGTGGGGACAGAGGG + Intergenic
1048555813 8:135475020-135475042 AAGAGAGAGGAGCGGAGAAATGG - Intronic
1048876462 8:138840190-138840212 AAGAGGGAGTTGTGGAGAGATGG - Intronic
1049212779 8:141394429-141394451 AGGGTGGAGGTGGGGAGAAACGG - Intronic
1049236661 8:141515558-141515580 CAGAGTGCGGTGGGGACAAGGGG - Intronic
1049342459 8:142120522-142120544 AAGAGGGAGGTGTGGGCACAGGG - Intergenic
1050407597 9:5326589-5326611 AGGAGCCAGGTGGGGACAAGGGG + Intergenic
1050483840 9:6114056-6114078 CAGTGGGAGCTGGGGACAACCGG + Intergenic
1050921615 9:11209721-11209743 AAAATAGAGCTGGGGACAAAAGG - Intergenic
1051261110 9:15265641-15265663 AAAAGGGAGGAGGGGAAAAAGGG + Intronic
1051320560 9:15900301-15900323 AAGAGGGCGGTGGGGGCATTTGG + Intronic
1051580287 9:18665650-18665672 AAGAAGATGGTGGGAACAAAAGG - Intronic
1052462667 9:28786319-28786341 ATATGGGAGGTGGGGACAAAGGG + Intergenic
1052790419 9:32870313-32870335 GATAGAGAGCTGGGGACAAACGG + Intergenic
1052854023 9:33395829-33395851 AAGAGAGAGGGAGGGAGAAAAGG + Intronic
1052952995 9:34228910-34228932 AAGGAGGAGGTAGGGATAAAGGG - Intronic
1053004729 9:34596917-34596939 GAGAAGCAGGTGGGGAGAAAGGG + Intergenic
1053107575 9:35424995-35425017 AAGAAGGAGGAGGGCAGAAAAGG - Intergenic
1053288812 9:36866674-36866696 CTGAGGGGGGTGGGGACAATAGG + Intronic
1053401439 9:37827220-37827242 AAGTTGGAGGTGGGGATAAATGG + Intronic
1053932025 9:43120319-43120341 AAGAGAGAGGGAGGGAGAAAAGG + Intergenic
1054337075 9:63817070-63817092 AAGAGGGAGGGAGGGAGAAAGGG - Intergenic
1055574713 9:77648940-77648962 ACGAGGGGGCTGGGGAGAAAGGG + Intergenic
1056165542 9:83937391-83937413 AAGAGGGGGGAGGGGAAAGAAGG + Intergenic
1056311007 9:85341050-85341072 ACAAGTGAGGAGGGGACAAAGGG - Intergenic
1056540233 9:87564622-87564644 AAGAGGGAGGGAGGGAGGAAGGG + Intronic
1056833230 9:89933255-89933277 AAGAGGGTGGTAGGGATGAATGG + Intergenic
1056906630 9:90656310-90656332 AAGAGAGAGATGGGAAGAAAGGG - Intergenic
1057149172 9:92781030-92781052 AAGAGGAAAGAGAGGACAAAGGG - Intergenic
1057914955 9:99048227-99048249 CAGAGGGAGTAGGGGAGAAAGGG + Intronic
1058010815 9:99974815-99974837 AAGATGGAGTTATGGACAAAGGG + Intergenic
1058510580 9:105713042-105713064 CAGAGGGAGCTGGGGACATGCGG + Intronic
1058682482 9:107452259-107452281 TAGAGGGAGGTAGTGCCAAAAGG - Intergenic
1058782307 9:108350562-108350584 AAGAGGGAGGCAGAGAGAAAAGG + Intergenic
1058815919 9:108682811-108682833 GAGAGGGAGGTGGGGCCAAGGGG - Intergenic
1058892592 9:109373795-109373817 AAGTTGGAGGTGGGGCCTAATGG + Intergenic
1059210572 9:112511101-112511123 AAGAGGGAGGATGGGGCAAAAGG + Intronic
1059405013 9:114094064-114094086 AGGAAGCAGGTGGGGACATAAGG + Intronic
1059731391 9:117060562-117060584 AAGAGGGAGGGAGGGAAAGAAGG + Intronic
1060011091 9:120043343-120043365 AGGGTGGAGGTGAGGACAAAGGG + Intergenic
1060033557 9:120235795-120235817 AAGTGGGAAGTGGGAACATATGG - Intergenic
1060212239 9:121717743-121717765 AAGAGGGAGGTGGTGCTCAAAGG - Intronic
1060389529 9:123267370-123267392 CAGAGAGAGGTGGGGACAGTAGG - Intronic
1060705726 9:125798474-125798496 AAATGGGAGGTGGGGATAAGAGG - Intronic
1060723035 9:125990749-125990771 AAGAGGGAGGAGGTGAGAAGAGG - Intergenic
1061407511 9:130400650-130400672 AGGAGGGAGGTGGCAACAGAGGG - Intronic
1061777922 9:132978126-132978148 AGGAGGGAGGCAGGGAAAAAAGG + Intronic
1062542907 9:137049414-137049436 GTGAGGGAGGTGGGGACAGGCGG - Intronic
1203377013 Un_KI270442v1:384491-384513 AAGATGGAGGGAGGGAGAAAGGG - Intergenic
1185598886 X:1325452-1325474 GAGAGGGAGGTGGGGAGGAGAGG + Intergenic
1185604497 X:1360155-1360177 AAGATGGAGGGAGGGAGAAAGGG - Intronic
1185734273 X:2485542-2485564 AAAAGGGAGGGAGGGACAGAGGG + Intronic
1185918133 X:4058880-4058902 GAGAGGGAGGGAGGAACAAAGGG + Intergenic
1186077571 X:5897866-5897888 AGGAGGGAGGGAGGGACAATTGG - Intronic
1186306169 X:8260979-8261001 AAGTGGGAGCTGGGAACACATGG + Intergenic
1186721861 X:12313066-12313088 ATTAGGGAGGTGGAGAAAAAAGG + Intronic
1187126322 X:16457634-16457656 GAGAGGGAGGGAGGGAGAAAGGG + Intergenic
1187325982 X:18288910-18288932 GAGTGGGAGGAGGGGACTAAGGG + Intronic
1187492104 X:19761391-19761413 GAGAGGGAGATGGGGAGAGAGGG + Intronic
1187918475 X:24177845-24177867 GAGAGGGAGGTGGAGCAAAAAGG + Intronic
1189224118 X:39398384-39398406 AAGAGGGAGGGAGGGAAATAAGG - Intergenic
1189224139 X:39398481-39398503 AAGAGGGAGGAAGGGAGAAAAGG - Intergenic
1189224157 X:39398589-39398611 AAGAGGGAGGAAGGGAGAAATGG - Intergenic
1189260214 X:39673144-39673166 CAAAGGGAGGTGGTGAGAAATGG - Intergenic
1190401977 X:50046359-50046381 GACAGGGAGGTGAGGAAAAAAGG - Intronic
1190974746 X:55388168-55388190 AAGGGGAAGCTGGGGACAATGGG + Intergenic
1191604296 X:63044441-63044463 AAGTGGGAGATGGGGAAGAATGG - Intergenic
1191957952 X:66666836-66666858 AAAAGGGAAGTGGAGAAAAAGGG - Intergenic
1192583691 X:72304746-72304768 AAGAGGGAGGCGCGGTAAAATGG - Intronic
1192809041 X:74533514-74533536 GAGAGTGAGGTGGGGAGAAATGG - Exonic
1193380359 X:80809882-80809904 AAGAGGTGGGCGGGGGCAAAGGG + Intergenic
1193656295 X:84201821-84201843 ATGAGTGAGAAGGGGACAAAGGG - Intergenic
1193767258 X:85545014-85545036 TAGAGGGAGGAGGGGAGGAATGG - Intergenic
1193920799 X:87423718-87423740 AAAAAGGAAGTGGGGAGAAAAGG - Intergenic
1194904481 X:99557781-99557803 AAGCGTGATTTGGGGACAAAAGG - Intergenic
1195014813 X:100767412-100767434 AGGAGGGAGGTGGAGCAAAATGG - Intergenic
1195396021 X:104411408-104411430 AGGAGGGAGGTGGAGCAAAATGG + Intergenic
1195532808 X:105976317-105976339 AGGAGGGAGGAAGGGAGAAAAGG + Intergenic
1195613746 X:106896467-106896489 AAAAGGGAAGTGGGGAGGAAAGG + Intronic
1195682688 X:107560746-107560768 AGGAGGGAGGGGGGAAGAAAGGG - Exonic
1195694790 X:107658912-107658934 AGGAGGGAGGGAGGGAAAAAAGG + Intergenic
1195751859 X:108167887-108167909 AAGAGGGTGGAGGGCACACAAGG - Intronic
1195856812 X:109340572-109340594 AAGATGGGGGTGGGGAAAACAGG + Intergenic
1196243502 X:113370569-113370591 AAGGGCGTGGTGGGGCCAAAAGG + Intergenic
1196380879 X:115087974-115087996 AAGAGGGTGGTGTTGACAAAGGG + Intergenic
1196393109 X:115230485-115230507 AAAAGTGTGATGGGGACAAAGGG + Intronic
1196667846 X:118334998-118335020 AAGAGGGATGAGGGTAAAAAGGG - Intergenic
1196935220 X:120723756-120723778 AAAAAGGGGGGGGGGACAAAAGG - Intergenic
1197077508 X:122370439-122370461 AAAAAGGAGGTGGGGAAAAGTGG + Intergenic
1197430053 X:126351180-126351202 GAGAGAGAGGTGGAGAGAAAAGG + Intergenic
1197875040 X:131093440-131093462 AAGGGGGTGGTGGGGATGAAAGG - Intergenic
1198102876 X:133437104-133437126 AAGGCGGAGCTGGGAACAAAGGG + Intergenic
1198817232 X:140604783-140604805 AAGTGGGAGGTAGCAACAAAGGG - Intergenic
1198934844 X:141895111-141895133 GGTAGGGAGGTGGGCACAAAGGG + Intronic
1199599451 X:149533301-149533323 AACAGGGAGGTGTGGAGCAAGGG - Exonic
1199651180 X:149946906-149946928 AACAGGGAGGTGTGGAGCAAGGG + Intergenic
1199739927 X:150725644-150725666 AAAGGGTAGGAGGGGACAAATGG - Intronic
1199765008 X:150935080-150935102 GAGAGGAAGGTGGGCAGAAAAGG - Intergenic
1201130457 Y:10948235-10948257 AAGAGGGATGTGGGGTGGAATGG - Intergenic
1201294943 Y:12454460-12454482 AAGAGGGAGAGGGAGACAGAAGG + Intergenic
1201517746 Y:14835846-14835868 AGGAGGGAGGGAGGGACAATTGG + Intronic
1201741146 Y:17325677-17325699 GAGAGGGAGGGAGGGAGAAAGGG + Intergenic
1201888953 Y:18920442-18920464 AAGAGGGAGGGAGGGAAGAAGGG + Intergenic
1202043513 Y:20712847-20712869 TAGAGTGAGGTGGGGTGAAAGGG + Intergenic