ID: 954419508

View in Genome Browser
Species Human (GRCh38)
Location 3:50411180-50411202
Sequence ACATTTGAGGAGCGGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954419508 Original CRISPR ACATTTGAGGAGCGGTCCCC TGG (reversed) Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901165812 1:7220874-7220896 ACATATGGGGAGCGATCTCCAGG + Intronic
901675385 1:10880414-10880436 ACAGTAGAGGAGAGGCCCCCAGG - Intergenic
902335324 1:15751251-15751273 ATCATTGAGGAGAGGTCCCCAGG + Intergenic
904061267 1:27712642-27712664 ACATTTTAGAAGCATTCCCCGGG + Intergenic
904361006 1:29971789-29971811 ACATTTCAGGAGTTGTCCCCGGG - Intergenic
909797872 1:79765879-79765901 ATATTTGAGGTGGGGTCCACGGG - Intergenic
911682187 1:100729772-100729794 ACATTTGATGAGCTGTCTGCAGG + Intronic
915740588 1:158115784-158115806 ACATCTGAGGAGCAGTGACCAGG + Intergenic
1063887548 10:10594999-10595021 ACATTTGAGGGACTGCCCCCAGG + Intergenic
1069707379 10:70467349-70467371 ATATTTGAGGGGCAGTCCCCCGG + Intergenic
1087085877 11:94218587-94218609 ACATTAGAGGAGAGGGCCCATGG - Intergenic
1092891920 12:12977078-12977100 ACATTTGAGGAGCACTCCTTTGG - Intronic
1101441363 12:104706525-104706547 GCATTTGAGAAGCGACCCCCTGG + Intronic
1122111334 14:99505158-99505180 TCATTTGAGAAGGAGTCCCCTGG + Exonic
1126574938 15:50187224-50187246 ACATTTCAGGATCGTTCTCCAGG + Intronic
1133128747 16:3663423-3663445 AAGTTTGAGGACAGGTCCCCAGG - Exonic
1134634009 16:15778594-15778616 ACATGTGTGGACCGGACCCCTGG - Intronic
1138450010 16:57088129-57088151 ACAGTAGAGGAGCTTTCCCCAGG + Intergenic
1141430437 16:83968299-83968321 ACTTTTGGGGAGCAGGCCCCAGG + Intergenic
1144481297 17:15631617-15631639 ACATTGGAGGAACTGTTCCCTGG + Exonic
1144917008 17:18732114-18732136 ACATTGGAGGAACTGTTCCCTGG - Exonic
1145003254 17:19320322-19320344 ACATTTGGTCAGCAGTCCCCAGG - Intronic
1145778923 17:27549286-27549308 ACATTTCAGGAGCTCTCCCTGGG + Intronic
1147400636 17:40178240-40178262 TCATCTGACGAGCTGTCCCCAGG + Intronic
1148054473 17:44786007-44786029 ACATTTCAGGAGCTGTCGCCAGG - Intergenic
1164715777 19:30389291-30389313 ACATTTGGGGAGAGGTTTCCTGG + Intronic
1166329717 19:42070801-42070823 AGATATGGGGAGCGGTCCACAGG + Exonic
1166660492 19:44643960-44643982 GCACTGGAGGAGCGGCCCCCCGG + Exonic
1166729759 19:45052469-45052491 GTATTTGAGGGGCGGGCCCCAGG - Intronic
1168498949 19:56877262-56877284 ACATTTGTGGAGTGGTCATCTGG - Intergenic
938384230 2:130853084-130853106 ACATTTGAGAAACAGCCCCCTGG - Intronic
939020549 2:136953386-136953408 TCATATGAGGAGAAGTCCCCAGG - Intronic
940198221 2:151120263-151120285 ACATTTGAGGGGCAGTCTCCAGG - Intergenic
940858215 2:158746265-158746287 ACAGATTAGGAGCTGTCCCCAGG + Intergenic
942259274 2:174141230-174141252 ACATTTAAGAAACGGTGCCCTGG - Intronic
947424912 2:229974609-229974631 ACATTTCTGGAGCGGTGCCCTGG + Intronic
1170664866 20:18378132-18378154 ACATCTCAGGAGCGTTCCCACGG + Intergenic
1172390844 20:34564024-34564046 ACAGTTGAGGAGCGCTGGCCAGG - Intronic
1175561257 20:59933096-59933118 ACAGGCGAGCAGCGGTCCCCAGG + Intronic
954419508 3:50411180-50411202 ACATTTGAGGAGCGGTCCCCTGG - Intronic
956713042 3:72055288-72055310 AAATTTGAGAAGCGATCCCTAGG + Intergenic
958732987 3:97978524-97978546 ACATTTGAATAGCTGTCACCAGG + Intergenic
962661916 3:137610388-137610410 ACATTTAAGGAGCTGTCCTATGG - Intergenic
1012426110 6:99116449-99116471 ATATTTGAGGAGCTGTCCCATGG - Intergenic
1041539227 8:58964130-58964152 ACATTTGAGTAATGGTGCCCTGG - Intronic
1048013449 8:130477199-130477221 ACATTGGGGCAGGGGTCCCCTGG + Intergenic
1050649293 9:7757857-7757879 ACCTTTTAGGAGAGGTCTCCTGG + Intergenic
1052511146 9:29422374-29422396 TCACTTGTGGAGTGGTCCCCAGG - Intergenic
1061581165 9:131537380-131537402 AGATTAGAGCAGTGGTCCCCAGG + Intergenic
1198091865 X:133339315-133339337 TCATTTGAAGATCTGTCCCCAGG - Exonic