ID: 954421040

View in Genome Browser
Species Human (GRCh38)
Location 3:50419135-50419157
Sequence AAAGCCTAAGCCTCTTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954421040_954421042 -6 Left 954421040 3:50419135-50419157 CCACGGAAAGAGGCTTAGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 954421042 3:50419152-50419174 GGCTTTTGCAAGAGGCATCATGG 0: 1
1: 0
2: 1
3: 19
4: 154
954421040_954421043 6 Left 954421040 3:50419135-50419157 CCACGGAAAGAGGCTTAGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 954421043 3:50419164-50419186 AGGCATCATGGTATCATACAAGG 0: 1
1: 0
2: 0
3: 6
4: 107
954421040_954421044 25 Left 954421040 3:50419135-50419157 CCACGGAAAGAGGCTTAGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 954421044 3:50419183-50419205 AAGGAAGAACTTCCATTTAGTGG 0: 1
1: 0
2: 1
3: 18
4: 214
954421040_954421045 26 Left 954421040 3:50419135-50419157 CCACGGAAAGAGGCTTAGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 954421045 3:50419184-50419206 AGGAAGAACTTCCATTTAGTGGG 0: 1
1: 0
2: 2
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954421040 Original CRISPR AAAGCCTAAGCCTCTTTCCG TGG (reversed) Intronic
905473629 1:38210619-38210641 AAATCCTAGGCCTCTTCCAGAGG - Intergenic
907862146 1:58363879-58363901 AAAGCCCCAGGGTCTTTCCGGGG - Intronic
912949745 1:114112427-114112449 AAATACTAAGCCTCTTTTCAAGG - Intronic
915296591 1:154925700-154925722 AAAGGTTAAGTCTCTTTCCCAGG - Intronic
918046930 1:180947261-180947283 AAAGCCAAAGCCCCTTACAGTGG - Exonic
918125552 1:181580476-181580498 AAAGGGCAGGCCTCTTTCCGTGG + Intronic
918132875 1:181644759-181644781 AAAGCCTCAGCCTGGTTCCATGG + Intronic
924061317 1:240177665-240177687 AAAACCTACGCCTCTTTCTTTGG - Intronic
924117906 1:240765943-240765965 AAAGCCGCAGCCTGTTTCCCAGG + Intergenic
1063180436 10:3593322-3593344 AAATCCTAAGCCTCTTTTAATGG - Intergenic
1079908382 11:26278264-26278286 AAAGTGTGAGCCTCTTTCCAAGG - Intergenic
1081489333 11:43555259-43555281 GAAACCTAAGCCTGTTTTCGTGG + Intergenic
1082078934 11:47996983-47997005 AAAGCCTAAGCCAGGTTCCAGGG - Intronic
1083572102 11:63766347-63766369 AAAGCCCTCGCCTCTTTCCCTGG - Intronic
1087279904 11:96198664-96198686 GAAGCCTAATCATCTCTCCGTGG - Intronic
1087522690 11:99262202-99262224 GCAGCTTAAGCCTCTTTCCTAGG - Intronic
1087665634 11:101044372-101044394 TAAGCCTAAGCCTCATCCAGAGG - Intronic
1089718785 11:120392031-120392053 AAACTCTAAGCCTGTTTCTGTGG + Intronic
1089984204 11:122797807-122797829 CAAGCCTAAGACTCTTTATGTGG - Intronic
1091183167 11:133625780-133625802 AAAACCTAAGCCTATTTCCAAGG - Intergenic
1096539786 12:52300499-52300521 AAAGCCTTAACCTATTTCCCAGG + Intronic
1096707306 12:53430278-53430300 ACAGCCTAGGCCTCTTACTGTGG - Exonic
1100531015 12:95461613-95461635 AAAGCGTAAGCCTCAATACGTGG + Intergenic
1102045657 12:109828583-109828605 AGAGCTTAAGCCACTTTCTGAGG + Intronic
1116512548 14:45764815-45764837 AAAGCCTAAGTCCATTTCCAAGG + Intergenic
1120897945 14:89551100-89551122 AAAGCTTAAACCTCTATCCCGGG - Intronic
1121516019 14:94550314-94550336 AAAGCCTAATCCTCTTTGAGGGG + Intergenic
1122441638 14:101736208-101736230 AAACCCTAAGCCTTTTTCTAAGG - Intergenic
1129814742 15:78541363-78541385 AAGGCCTCAGCCTCTTGCCTTGG + Intronic
1130896837 15:88177193-88177215 AAAAGCTAAGCCCCTTTCCATGG - Intronic
1131789524 15:95948971-95948993 AAAACCCAAGCCTGTCTCCGTGG - Intergenic
1137526381 16:49240038-49240060 AAAACCTAAACTTCTTTCCTTGG + Intergenic
1139464019 16:67144431-67144453 AAAGCCAAAAGCTCTTTCCTGGG - Intronic
1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG + Intronic
1143777339 17:9208249-9208271 AAAGCCTAAGCCCTTTACCCAGG + Intronic
1147991662 17:44337652-44337674 AAGGCCTAAACCCCTTTCTGTGG - Intergenic
1158155915 18:54425495-54425517 AGAGCCTAACCCTCTTGCCCAGG + Intergenic
1159791135 18:72780157-72780179 AAAGGATAAACCTGTTTCCGTGG + Intronic
1161315982 19:3617928-3617950 AAAGCCACAGGCTCTTTCCTAGG + Intronic
1164433682 19:28209687-28209709 AAAGCCTGTGCCTCCTTCTGTGG - Intergenic
1164888408 19:31802934-31802956 GAGGCCTCAGCCTCTTCCCGAGG - Intergenic
1166667726 19:44691220-44691242 AAAGCATAAGCCACTTTGCCTGG - Intergenic
925806550 2:7656052-7656074 AAATCCTAAAAGTCTTTCCGGGG - Intergenic
926373761 2:12206141-12206163 AAAGCCAAAGCATCTTTAGGAGG + Intergenic
930267770 2:49219748-49219770 AAAACCTAAGCCCCTTACCATGG - Intergenic
931319059 2:61158568-61158590 AAAGCCTAAGCCTTCTTCCCTGG - Intronic
933703722 2:85274322-85274344 AAAGCCTAGGGCTCTGTCCCGGG + Intronic
937231699 2:120401620-120401642 AAAGCCTTGGCCTCTGTCCTGGG - Intergenic
940549980 2:155141610-155141632 GAAGACGAAGCCTCTTTCAGGGG + Intergenic
942055946 2:172182169-172182191 AAAGCCAAAGACTGTTTCTGTGG - Intergenic
1175643477 20:60651154-60651176 AAAGCCTAACCCTTGTTCCTTGG - Intergenic
1182930990 22:34174198-34174220 AAAGCATATGCCTCTTCCCATGG + Intergenic
949398270 3:3638150-3638172 AAAGCCTAATGCCCTTTACGAGG + Intergenic
952743731 3:36759185-36759207 GAAGCTTAAGCCTCATTCTGAGG - Intergenic
954421040 3:50419135-50419157 AAAGCCTAAGCCTCTTTCCGTGG - Intronic
954886507 3:53879892-53879914 AAAGCCTAAGGTTGTTTCCCTGG - Intronic
957837741 3:85619751-85619773 AATGCCTAAACCTTTTTCTGTGG - Intronic
958807256 3:98826626-98826648 ACAGCCTCAGGCTCTGTCCGGGG - Intronic
964893431 3:161564561-161564583 AAATCCTAATCCTCTTTTTGAGG - Intergenic
965134987 3:164753228-164753250 AAAGCTTAGGCCTTTTTCCAAGG + Intergenic
966817231 3:183899261-183899283 AGAGCCAAAGCTCCTTTCCGAGG + Intergenic
967973147 3:195013960-195013982 AAAGCCTCAGCATCTTTAGGAGG + Intergenic
970531880 4:16993148-16993170 AAAGCCTTAACCCCTTTCCTTGG - Intergenic
975930347 4:79514164-79514186 AGAGGCTAAGCCTCCTTCCTGGG - Intergenic
979693166 4:123582237-123582259 AGAACCTAAGCCTGTTTCCAAGG + Intergenic
979808387 4:125003739-125003761 AAAGCCTTAGCTTCTCTACGTGG + Intergenic
981085175 4:140676130-140676152 CAAGCCTAAGCCTATTTACTCGG + Intronic
988049394 5:26005948-26005970 AATGCCTTAGCCTCTTTGCCTGG + Intergenic
989271938 5:39543973-39543995 AATGCCTATGCCTCTGTCAGCGG - Intergenic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
993604969 5:89978636-89978658 AAAGCCTAAGACTAATTCAGTGG + Intergenic
993811793 5:92488735-92488757 AAAGCCTAAGAATCTTTCACAGG + Intergenic
997483968 5:134212852-134212874 AAAGCCAAAGCCTAATTCAGAGG + Intronic
1002203810 5:177548854-177548876 AAAGCCTAAACCTCTTGGTGTGG + Intronic
1003861746 6:10328219-10328241 AAAGTCTCACCCTCTTGCCGAGG - Intergenic
1010779021 6:79921941-79921963 AAAACCTAAGCATCTCTCCATGG + Intronic
1011996593 6:93597033-93597055 AAGGCCTAAGCTTCTTTGGGAGG + Intergenic
1018643084 6:165922865-165922887 AGAGCCTAAGCCACCTTCCGGGG + Intronic
1021689806 7:23221068-23221090 GAAGCCGAAGCCTCTGTCAGTGG + Intergenic
1026982102 7:74532890-74532912 AGAGCCCAAGGCTCTGTCCGTGG + Intronic
1027501092 7:78952040-78952062 AAAACCTAAACCTCTTTGCCTGG + Intronic
1031872922 7:127107094-127107116 AAAGCCAAAGCCAGTTTCAGAGG - Intronic
1034001822 7:147422522-147422544 TAAGCCTATGCCTCATTCCTGGG + Intronic
1048407567 8:134138842-134138864 CAAGCCTAAACCTCTTTAAGCGG - Intergenic
1054736591 9:68758074-68758096 AAGTTCTAAACCTCTTTCCGTGG - Intronic
1058769600 9:108217297-108217319 ATAGCCTTTGCCTATTTCCGTGG - Intergenic
1060116898 9:120948921-120948943 AAAGCCAAAGCCTCTTCCATTGG + Intergenic
1060808210 9:126591973-126591995 AAATCATAAGCCTCTGTCAGTGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1189695069 X:43655074-43655096 AACGCCTCAGCCTCCTTCCCCGG + Intronic
1190200074 X:48353913-48353935 AATGCCTGAGGCTCTTTCCCAGG + Intronic
1190654546 X:52599325-52599347 AATGCCTGAGGCTCTTTCCCAGG - Intergenic
1195896561 X:109751190-109751212 AAAGTGTAATCCTCTTTCTGAGG + Intergenic