ID: 954421217

View in Genome Browser
Species Human (GRCh38)
Location 3:50420008-50420030
Sequence CCGCGTCTCCGCGGGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954421217 Original CRISPR CCGCGTCTCCGCGGGGGACC TGG (reversed) Intronic
900313460 1:2045886-2045908 CAGCCTCTCCCCCGGGGACCTGG + Intergenic
902383430 1:16063391-16063413 CCGCTTCTCCCTGTGGGACCAGG - Intronic
902601080 1:17540394-17540416 CCGCCTCTGGGCGGGGGTCCAGG - Intronic
904483710 1:30810188-30810210 CTGCGGCTCCACAGGGGACCTGG - Intergenic
912955668 1:114153023-114153045 CCGCGTCTCCGCTGGGGGGCGGG - Intronic
916108640 1:161447903-161447925 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916110228 1:161455284-161455306 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916111813 1:161462694-161462716 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916113400 1:161470075-161470097 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
917893678 1:179465484-179465506 CCTCGTCTCAGAGGGGCACCTGG + Intronic
1062964225 10:1594947-1594969 CCCCATCTCTGCTGGGGACCAGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065101479 10:22336068-22336090 CCCCGTCCCCGGTGGGGACCGGG - Intergenic
1068560958 10:58513453-58513475 CTCCGGCTCCGCGGGGGAGCGGG - Intronic
1072654321 10:97319710-97319732 CAGCGGCACCGCCGGGGACCTGG - Exonic
1073063170 10:100744196-100744218 CCGCGCTTCCGCGGGGCGCCCGG + Intronic
1075492115 10:122880113-122880135 TCGGGTCTCTGCGGGGGAGCGGG + Intergenic
1076683453 10:132186710-132186732 GCGGGTCTGCGCGGGGGCCCGGG + Intergenic
1076798538 10:132810287-132810309 CCGCTTCTCCGTGGGGGACCTGG - Intronic
1076809608 10:132879727-132879749 CCGGGTGTCCGCGAGGCACCGGG - Intronic
1076921636 10:133457433-133457455 CCACGTCCCGGCGGGGGGCCTGG - Intergenic
1077143908 11:1036420-1036442 CCGCGGCTGCTGGGGGGACCCGG + Intronic
1079035004 11:17013776-17013798 CCGCACCTACGCTGGGGACCTGG - Intronic
1080807021 11:35662965-35662987 CCGCGTCTCGAAGCGGGACCTGG - Exonic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1085835374 11:79950385-79950407 CTGCTACTCCCCGGGGGACCAGG + Intergenic
1086979446 11:93177735-93177757 CTTCGTCTCAGAGGGGGACCCGG + Intronic
1088745195 11:112799097-112799119 CCGCGTCTGACCGGGGCACCGGG + Intergenic
1092246730 12:6868002-6868024 CCGAGGCTCTGCGGGAGACCGGG + Intronic
1098320587 12:69239719-69239741 CCGCGTCGGCGGCGGGGACCTGG - Intronic
1099965588 12:89441393-89441415 CTTCGTCTCAGAGGGGGACCCGG - Intronic
1100869551 12:98895356-98895378 GCGCGGCTCCGCGGGTGCCCAGG + Intronic
1104858026 12:131910863-131910885 GCACGTCCCCGCGGGGGCCCAGG - Intronic
1104917123 12:132271532-132271554 CGGCGTCACCTCGGGGGACAGGG - Intronic
1113335443 13:109372332-109372354 TCGTGACCCCGCGGGGGACCTGG - Intergenic
1113799446 13:113078692-113078714 CCGCGGCTCAGCGGGGGAGGAGG + Exonic
1117358506 14:54948784-54948806 CCTCGTCTCAGAGGGGTACCCGG - Intronic
1117690434 14:58299452-58299474 GGTCGTCTCCGCGGGGGACCTGG + Intronic
1117841991 14:59870244-59870266 CCGCGTCGCCACGGGCGACTGGG - Intronic
1122582284 14:102778023-102778045 CCGCGGCCCCGCGGGGTGCCGGG - Intronic
1122649968 14:103220798-103220820 CGGCGACTCCTCGGGGCACCAGG + Intergenic
1125510812 15:40291480-40291502 CCGCGGCTCTGCGGAGGCCCGGG + Exonic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1132098434 15:99005563-99005585 CCGCGTGCTCGCCGGGGACCGGG + Intronic
1132365182 15:101251746-101251768 CCGCGTCCCCGCGCGCGAGCGGG - Exonic
1132527500 16:425070-425092 CCCCGGGTCCGCGCGGGACCCGG + Intergenic
1132603578 16:784450-784472 CCGCGTCTCGGCTGAGGACACGG + Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1140454213 16:75095418-75095440 CGCCGTCTCCGCTTGGGACCAGG + Intronic
1141132185 16:81444467-81444489 CCGCGCCCCCGCGGGTGCCCGGG - Intergenic
1141620563 16:85234941-85234963 CCGGGTCTCCGGCGGGGCCCAGG - Intergenic
1142222647 16:88863229-88863251 CCGCGTCTCCCCGTGGGACGGGG - Intergenic
1142413035 16:89925875-89925897 CCGCGTGACCGCCCGGGACCCGG - Intronic
1143155428 17:4833453-4833475 CCGCGCCTCCCCCGGAGACCGGG - Exonic
1143904532 17:10198450-10198472 CAGCGGCTCCGCGGGGTCCCAGG + Exonic
1144775528 17:17782939-17782961 CCGCGTCCCCGCGGCAGCCCCGG + Intronic
1145938604 17:28728999-28729021 CGGAGTCTCCCCGGGGGACTGGG - Intronic
1146281995 17:31550457-31550479 CCGAGTCCCCGCGGGCCACCTGG - Intergenic
1148867300 17:50635161-50635183 CCCCGACACCGCGTGGGACCCGG - Intronic
1149589299 17:57816777-57816799 CCACTTCTCTGCAGGGGACCGGG - Intergenic
1150267873 17:63842571-63842593 CCGCCTCCCCCCGCGGGACCCGG - Exonic
1152406612 17:80101587-80101609 CGGAGTCTCCGCGGGCGGCCAGG + Intergenic
1152530856 17:80918300-80918322 CTGCATCTCCGCAGGGGAACAGG - Intronic
1155055256 18:22176877-22176899 CCGCGTCACCCCGGGGACCCCGG - Intronic
1160960554 19:1718823-1718845 CCTGCTCTCCGCGGGGGCCCGGG + Intergenic
1162486031 19:10961114-10961136 CCGCCCCTCCGCGCGGGGCCGGG - Exonic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166055374 19:40285108-40285130 TCGCGGCACCGCGGGGGGCCCGG + Intronic
1166122604 19:40694382-40694404 CCACGGCTCCGCAGGGCACCTGG + Intronic
927809725 2:26174185-26174207 CCTCGTCTCCCCGTGGGGCCCGG + Intronic
931671775 2:64654011-64654033 CCGCCTCTCCCCGGCGGTCCCGG + Intronic
1168796065 20:610612-610634 CCGCGTCTCCCAGGTGGTCCAGG - Intergenic
1169278442 20:4248741-4248763 CCGGAGCTCCGCGGGGGAGCCGG - Exonic
1179661523 21:42879086-42879108 CCGCGGCGCCGGCGGGGACCGGG - Intronic
1180070715 21:45434759-45434781 CCACGTCTTGGCGGGGGTCCCGG + Intronic
1180092882 21:45541995-45542017 CGGGGTCTCCGCGGGGGTCGCGG - Intronic
1183461495 22:37953735-37953757 GCGGGTCTCCGCGCGGGACCGGG + Exonic
1183486166 22:38088812-38088834 GCGCTTCTCCGCTGGGGACGTGG - Exonic
950012126 3:9731404-9731426 CCGCGGCTGCGGGAGGGACCTGG - Intergenic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
956406335 3:68932326-68932348 CCGCCTCCCCGCGGGAGCCCCGG + Exonic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
968929659 4:3572101-3572123 CTGCATCTCCGGGCGGGACCGGG + Intergenic
972766001 4:42152489-42152511 CCGCGCCTCCGACGGGGAGCGGG + Intronic
983108905 4:163724371-163724393 CTTCGTCTCAGAGGGGGACCCGG + Intronic
986315325 5:6583118-6583140 CCGCGGCGCCGCGCAGGACCCGG + Intergenic
989209725 5:38846656-38846678 CCGCTTCTACGCTAGGGACCAGG - Intronic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
1001959695 5:175872519-175872541 GTGGGTCTCCGCGGGGGTCCGGG + Intronic
1002632342 5:180590439-180590461 CCGGGTCTCCGGGTGGGAACTGG - Intronic
1006427570 6:33975874-33975896 CCGCGTCTGCGCGGGGAGCGAGG + Intergenic
1009437539 6:63635714-63635736 CCGCGCCTCCGTGGGGCCCCGGG - Intergenic
1013576036 6:111483803-111483825 CCGCGGCTCCGCGCGTGGCCCGG + Intergenic
1022410212 7:30134629-30134651 CCGCAGCTCCGCGGGTTACCTGG - Intergenic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1023435068 7:40134274-40134296 CTGGGACCCCGCGGGGGACCTGG + Exonic
1026017414 7:66682197-66682219 CCGCGTCTGCGCCGTGGTCCAGG - Intronic
1027592699 7:80135301-80135323 CCGGGGGTCGGCGGGGGACCGGG + Intronic
1029440863 7:100586003-100586025 CTGCGTCTCCCCGGCAGACCTGG + Exonic
1033361400 7:140640917-140640939 CCGCAGCTCCGCGCGGGGCCGGG - Intronic
1035252014 7:157603874-157603896 CAGCGTCTCTGCGGTGGACAGGG - Intronic
1039996875 8:42541732-42541754 ACGCGGCCCCGCCGGGGACCGGG - Intronic
1042040207 8:64581369-64581391 CAGCGTCCCCCCGGGGGGCCTGG + Exonic
1044674986 8:94719826-94719848 CCGCGTCCCCGCAGGCGGCCCGG - Intronic
1052852826 9:33388134-33388156 CGTCATCTCCGCGGGGGAGCCGG + Intronic
1056517672 9:87370832-87370854 CCGCATCTCTCCTGGGGACCAGG + Intergenic
1057152962 9:92809952-92809974 CCGCGGCTCCGAGGGTGCCCGGG - Intergenic
1060106802 9:120877491-120877513 CCGCTCCTCGGCGGGGGGCCCGG - Intronic
1061656978 9:132099796-132099818 CTCCGCCTCCGTGGGGGACCAGG + Intergenic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1061863462 9:133479336-133479358 CCGGCGCTCCGCGGGGGCCCCGG - Intergenic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062551177 9:137087278-137087300 CTGCGGCTCCGAGCGGGACCTGG + Intronic
1062656061 9:137605192-137605214 CCGCGTCTCCGTCGGGGGGCAGG - Intergenic
1187547344 X:20266873-20266895 TCGCGCCTCCGCTGGGCACCGGG + Intronic