ID: 954421564

View in Genome Browser
Species Human (GRCh38)
Location 3:50421623-50421645
Sequence CCTTGGTACTACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954421545_954421564 27 Left 954421545 3:50421573-50421595 CCCAGGGCACTCCTCCCACCCCA 0: 2
1: 0
2: 3
3: 66
4: 705
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421555_954421564 -2 Left 954421555 3:50421602-50421624 CCTGCTCCCCAACTCTTCAGCCC 0: 2
1: 0
2: 3
3: 49
4: 513
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421554_954421564 -1 Left 954421554 3:50421601-50421623 CCCTGCTCCCCAACTCTTCAGCC 0: 2
1: 0
2: 6
3: 60
4: 734
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421546_954421564 26 Left 954421546 3:50421574-50421596 CCAGGGCACTCCTCCCACCCCAT 0: 2
1: 0
2: 4
3: 61
4: 655
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421549_954421564 13 Left 954421549 3:50421587-50421609 CCCACCCCATGGTGCCCTGCTCC 0: 2
1: 0
2: 2
3: 33
4: 370
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421558_954421564 -9 Left 954421558 3:50421609-50421631 CCCAACTCTTCAGCCCTTGGTAC 0: 1
1: 1
2: 1
3: 21
4: 165
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421557_954421564 -8 Left 954421557 3:50421608-50421630 CCCCAACTCTTCAGCCCTTGGTA 0: 1
1: 1
2: 1
3: 20
4: 287
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421553_954421564 7 Left 954421553 3:50421593-50421615 CCATGGTGCCCTGCTCCCCAACT 0: 2
1: 0
2: 3
3: 39
4: 364
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421552_954421564 8 Left 954421552 3:50421592-50421614 CCCATGGTGCCCTGCTCCCCAAC 0: 2
1: 0
2: 2
3: 19
4: 189
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421550_954421564 12 Left 954421550 3:50421588-50421610 CCACCCCATGGTGCCCTGCTCCC 0: 2
1: 0
2: 1
3: 47
4: 434
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421548_954421564 16 Left 954421548 3:50421584-50421606 CCTCCCACCCCATGGTGCCCTGC 0: 2
1: 0
2: 2
3: 42
4: 450
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421551_954421564 9 Left 954421551 3:50421591-50421613 CCCCATGGTGCCCTGCTCCCCAA 0: 2
1: 0
2: 1
3: 20
4: 235
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115
954421559_954421564 -10 Left 954421559 3:50421610-50421632 CCAACTCTTCAGCCCTTGGTACT 0: 1
1: 1
2: 2
3: 20
4: 175
Right 954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954421564 Original CRISPR CCTTGGTACTACAGGGACAC AGG Intronic
902348704 1:15837376-15837398 CCTTGCACCTACAGGGACTCGGG - Intergenic
902749270 1:18495819-18495841 CCTTGATGCCACAAGGACACAGG + Intergenic
902837066 1:19054170-19054192 CCTGGGTGCTAATGGGACACTGG - Intergenic
903769579 1:25755258-25755280 CCTGGGACCTTCAGGGACACTGG + Intronic
904992111 1:34601473-34601495 GCTTGGAACCACAGGGCCACTGG - Intergenic
905643996 1:39611835-39611857 CCTTGGTAATGCAGGCACACGGG - Intergenic
909241605 1:73221231-73221253 CCTAGATACAACAGGGATACAGG + Intergenic
915695792 1:157740030-157740052 CCCTGGTCCCACAGGGTCACTGG + Intergenic
920201108 1:204260149-204260171 CCTTGATACTCCAGTGACAAAGG + Intronic
922604822 1:226883392-226883414 CCTTCCTAATACAGGGACTCAGG - Intronic
923211227 1:231806280-231806302 CCCTTTTACTACAGGTACACTGG - Intronic
1068285857 10:54933889-54933911 CCTTGGTACCTCATGAACACAGG - Intronic
1069604617 10:69731589-69731611 GCCTGGAACTACAGGGCCACTGG + Intergenic
1073357752 10:102870399-102870421 ACTTGGGACTACAGGCTCACTGG - Intronic
1076885202 10:133258952-133258974 CCTATGCACTGCAGGGACACTGG + Intergenic
1080739408 11:35049637-35049659 CCTAGGTACAACAGGGGTACAGG - Intergenic
1090326896 11:125895619-125895641 GCTTGGTTCTACAGGGGCCCAGG + Exonic
1093912029 12:24759268-24759290 CCATGGTACAAGAGGGACTCTGG + Intergenic
1098476898 12:70915450-70915472 CTTTGGTACTTAAGAGACACAGG - Intronic
1101046412 12:100810646-100810668 ACTTGGTACTAGAAGGATACAGG + Intronic
1102218911 12:111180982-111181004 CCTTCATACTACAGGGTCCCAGG + Intronic
1103155925 12:118684931-118684953 CCATGACACTCCAGGGACACTGG - Intergenic
1103335101 12:120183538-120183560 CCTTGCTACTTCAGAGACACAGG + Intronic
1104949822 12:132434366-132434388 CATTGGTACAACAGGGGCAACGG + Intergenic
1109053845 13:57520122-57520144 GATAGGAACTACAGGGACACCGG - Intergenic
1113643312 13:111973730-111973752 CCTGGGTTCTCCAGGGACCCCGG - Intergenic
1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG + Intronic
1124062458 15:26306717-26306739 CCTAGATACAACAGGGATACAGG - Intergenic
1127295401 15:57604598-57604620 CCTTGAAGCTGCAGGGACACTGG + Intronic
1128427950 15:67561849-67561871 CCTTGGAACTACAGCCAGACAGG + Intronic
1128718537 15:69928384-69928406 CCTAGATACAACAGGGATACAGG + Intergenic
1129098940 15:73240077-73240099 CCTTGGCACTACTGAGACATTGG - Intronic
1129605954 15:77025147-77025169 CCTTGGTTCTAGAGTGACCCAGG + Intronic
1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG + Intergenic
1134861293 16:17562643-17562665 CCTTGGTGCTGAAGGAACACCGG - Intergenic
1135400772 16:22164900-22164922 CTTTGGTACTCCATGGAAACTGG + Intergenic
1136187941 16:28599152-28599174 CCTTGTTTCTGCAGGCACACTGG - Intergenic
1136190413 16:28612146-28612168 CCTTGTTTCTGCAGGCACACTGG - Intronic
1136520607 16:30793478-30793500 CCTTGGTACCCAAGGGACAGAGG + Intergenic
1139243581 16:65419246-65419268 CCTTGGGTCTACAGAGACCCAGG - Intergenic
1139559709 16:67734321-67734343 CCTTGGGAGTTCAGCGACACTGG + Intronic
1140257672 16:73350755-73350777 CATTGCTACTCAAGGGACACTGG + Intergenic
1142330147 16:89446903-89446925 CCCTGGAACTGCAGGGACAGAGG - Intronic
1142595351 17:1027120-1027142 TCTGGGTACTACAGCAACACTGG + Intronic
1142600481 17:1051317-1051339 TCTTGGTACTGCGGGTACACCGG - Intronic
1143111616 17:4556045-4556067 CCTTGCAACTACAGAGACCCAGG + Intergenic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1143938573 17:10513647-10513669 CTTCGGTACCACAGGGAAACTGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1146470957 17:33124569-33124591 GCTTTTTACTACAGAGACACTGG - Intronic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1150741895 17:67785819-67785841 CCTAGGTTTTCCAGGGACACTGG + Intergenic
1153056916 18:955006-955028 CCTTGGGAGTAGAGTGACACAGG - Intergenic
1157568854 18:48699011-48699033 CCTTGGTGCTGGAGGGACAGAGG - Intronic
1158811205 18:61037924-61037946 CTTTAGTATTAGAGGGACACTGG - Intergenic
1159617620 18:70599242-70599264 CCTAGGTACTATAGGGGTACAGG - Intergenic
1160233859 18:77069927-77069949 TCTAGGTCATACAGGGACACAGG + Intronic
1161276984 19:3423850-3423872 CCCTGGGACTACAGGGGCAGAGG + Intronic
1162802860 19:13120510-13120532 CCTGGGAACTATAGGGAGACTGG - Intronic
1164777927 19:30868747-30868769 CCCTGATACTACAGGGAGTCAGG + Intergenic
1164808158 19:31133647-31133669 TCTTAATACTACAGGGCCACAGG + Intergenic
1168722261 19:58560631-58560653 CCTTAGTACTAGAGGAACAAAGG - Intergenic
926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG + Intronic
929340892 2:40815924-40815946 CATTGGGACTACAGGGACTAGGG + Intergenic
932045090 2:68340477-68340499 CCTTGGTACTAGATGGACCTGGG + Intergenic
932143845 2:69302031-69302053 CCTAGGTACTACAGTGTCATAGG - Intergenic
936094797 2:109523446-109523468 CCCTGGTCCCACAGGGACTCAGG + Intergenic
936788642 2:116124573-116124595 CCTAGATACAACAGGGATACAGG - Intergenic
937060168 2:118974886-118974908 CCTTGGTCCAACAAGGACTCTGG + Intronic
937940090 2:127278610-127278632 GCTTGCTCCTACAGTGACACAGG - Intronic
939431629 2:142117107-142117129 CCTTAGTACTGCAGGGACCTGGG - Intronic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
1170403095 20:16008808-16008830 CCTAAGAACTACAGGAACACTGG + Intronic
1171426321 20:25050908-25050930 CCCTGGAAAGACAGGGACACAGG - Intronic
1173068367 20:39736844-39736866 CCTTGCTAGTCCAGGGACATCGG + Intergenic
1174459499 20:50672630-50672652 CCTGGGGGCAACAGGGACACAGG + Intronic
1176203734 20:63876910-63876932 CCTGGGTATTCCAGGGACCCGGG + Intronic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1183469122 22:37996400-37996422 CCTTGGCACTAGGGGGACAAGGG + Intronic
1184257893 22:43297355-43297377 CCTTGGTCCCACAGGGTCTCTGG + Intronic
951030153 3:17872543-17872565 ACTCGGTACTACAGGGAGAAGGG + Intronic
952498424 3:33936320-33936342 TCTTGTTACTACAAGGGCACAGG - Intergenic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
954463972 3:50643901-50643923 CCTGGCTACTCCTGGGACACAGG + Intronic
962509573 3:136084895-136084917 CCTAGATACAACAGGGATACAGG - Intronic
965272322 3:166634469-166634491 CCTTCGTAATACAGTCACACTGG - Intergenic
982495206 4:156082761-156082783 CCTGGATACTTCAGGTACACTGG + Intergenic
983151418 4:164286550-164286572 CCTTGGTACTACAAAAACATGGG + Intronic
983330759 4:166325071-166325093 CCTTGGTAATAGAGGAACAAGGG + Intergenic
985393380 4:189514958-189514980 CCTTTGTCCCTCAGGGACACAGG - Intergenic
987100336 5:14585587-14585609 ACTGGGTGCTACAGGCACACAGG - Intronic
989767996 5:45109204-45109226 CCTTAGCACTAGAGGGACAAAGG + Intergenic
994515952 5:100773239-100773261 CCAAGGCACTACAGTGACACTGG + Intergenic
998678142 5:144433413-144433435 CCATGGTAGTGCAGAGACACCGG + Intronic
999399086 5:151250584-151250606 CCTTGGTAATTGAGGGAAACTGG - Intronic
1002305347 5:178279676-178279698 GCTGGGTGCTCCAGGGACACAGG + Intronic
1006877555 6:37311733-37311755 CCCTTGTGCTACAGAGACACAGG - Intronic
1007788733 6:44297176-44297198 CCTTGGTAACCCAGGGAAACCGG + Intronic
1013343187 6:109235664-109235686 CCTTGGTACTATAGGGAGGCTGG + Intergenic
1019126674 6:169845361-169845383 CATGGTTACTTCAGGGACACAGG + Intergenic
1021197401 7:17688552-17688574 TCTTGGTAGTGCAGGGCCACAGG - Intergenic
1024727281 7:52212185-52212207 CCTTGGCACTAATGGGGCACAGG + Intergenic
1029253445 7:99252833-99252855 CTTTGGAACCACAGGGAAACTGG + Intergenic
1035548125 8:499421-499443 CCCAGGTGCTACAGGGACAGTGG - Intronic
1037846745 8:22289906-22289928 CTATGGTACTACAGCAACACAGG + Exonic
1044630960 8:94278318-94278340 CCCTGGTGCTTCAGGGTCACAGG - Intergenic
1044733770 8:95256385-95256407 GCTAGGTACTGCAGGCACACTGG - Intronic
1049203672 8:141353592-141353614 CCTTGGTCCCACAGGGGCAGAGG - Intergenic
1049232994 8:141493905-141493927 CCTAGGAGCTACGGGGACACAGG - Intergenic
1050832359 9:10029649-10029671 CCTAGGTACAATAGGGATACAGG - Intronic
1053365656 9:37520835-37520857 ATTTGGTACTGCAGGGACAGGGG + Intronic
1059156872 9:111997843-111997865 CCTTTGGACTATAAGGACACAGG - Intergenic
1186999644 X:15162506-15162528 CCTTATTTCTACAGGGATACAGG + Intergenic
1191824930 X:65354228-65354250 GCTTTGTACTAAAGGGGCACCGG - Intergenic
1192266853 X:69544421-69544443 CCCTGGCACTGCAGGGACCCAGG + Intergenic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1194874304 X:99167340-99167362 CTTTGGTATTACAGTGATACTGG - Intergenic
1201490292 Y:14533792-14533814 CAATGGGAATACAGGGACACAGG - Intronic