ID: 954421635

View in Genome Browser
Species Human (GRCh38)
Location 3:50421979-50422001
Sequence CCCCCAGGAACCAACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954421635 Original CRISPR CCCCCAGGAACCAACGTGGA TGG (reversed) Intronic
900315431 1:2053890-2053912 CCCACAGGAACCAACCTGGCTGG - Intronic
901118027 1:6864666-6864688 CCCAAGGGAACCAAGGTGGAGGG - Intronic
901756094 1:11442439-11442461 GCCCCAGAGACCAGCGTGGAAGG - Intergenic
903441443 1:23391047-23391069 CCATCAGGAACCCATGTGGACGG - Intronic
903449175 1:23441330-23441352 CCCCCAAGGCCCACCGTGGAGGG - Intronic
904107358 1:28097128-28097150 CACCCAGAATCCTACGTGGATGG - Intergenic
904319683 1:29688952-29688974 CAACCAGGAACCAAGGTGGAAGG - Intergenic
905865134 1:41372407-41372429 CCCCCAGGAGCCAGCCTGCAGGG + Intronic
907567721 1:55451912-55451934 CTGCCAGAAACCAACATGGATGG - Intergenic
908127154 1:61043323-61043345 CCCGGGGGAACCAGCGTGGAGGG + Intronic
908800203 1:67872148-67872170 CCCCCAGGAACTCCAGTGGAAGG + Intergenic
909509358 1:76434090-76434112 CACCCAGAAACCAAGGTGGCAGG + Intronic
910179406 1:84464652-84464674 CCCTGAGAAACCAATGTGGATGG - Intergenic
914332953 1:146689380-146689402 CACCCAGGAACCACAATGGAAGG + Intergenic
920088101 1:203432728-203432750 CCCCCCTCAACCAATGTGGAAGG + Intergenic
920842500 1:209566383-209566405 GCCCCAGGAACTAAAGTTGAGGG - Intergenic
921279483 1:213551379-213551401 TACCCAGGTACCACCGTGGAGGG - Intergenic
1063495283 10:6501930-6501952 TCCCCAGAAACCAAGGAGGATGG + Intronic
1064536942 10:16366881-16366903 CCCCAAGGAATCAACAGGGATGG - Intergenic
1066667850 10:37803629-37803651 TCCCTAAGAACCCACGTGGAAGG - Intronic
1067344677 10:45428757-45428779 CCCCCAGCAGCCTACCTGGATGG - Exonic
1069901513 10:71709091-71709113 CCCACAGGTGGCAACGTGGATGG + Intronic
1069976334 10:72216192-72216214 CCCCCAGGATCCTACCTGCAGGG + Exonic
1070427512 10:76304033-76304055 CCTCCAGGGACCAAAGGGGAAGG - Intronic
1071284396 10:84131310-84131332 TCACCAGGAACCAACCTGGCTGG - Intergenic
1074819335 10:117166978-117167000 CCCCCAGGAATCAGCTTGTAGGG + Intergenic
1077858674 11:6155807-6155829 GCCTCAGGAACCAAAGAGGATGG + Intergenic
1081724641 11:45319660-45319682 CACCCAGGAACGAACAGGGATGG + Intergenic
1090175686 11:124647401-124647423 CCCCTGGGAACCACGGTGGAAGG + Exonic
1090379971 11:126319525-126319547 TCCCCAGGAAGCATCTTGGAGGG + Intronic
1091974362 12:4812616-4812638 CTCCCAGGAAGCAAGGTAGAGGG - Exonic
1099883725 12:88501132-88501154 CTACAAGGAACAAACGTGGAAGG - Intronic
1101867591 12:108532361-108532383 CCACCAGGACACAAAGTGGAAGG + Intronic
1102040246 12:109796406-109796428 CCTCTAGGACCCAACGTGGTGGG - Intronic
1102926135 12:116827908-116827930 GCCCCAGGAACCAAAGAGGCTGG - Intronic
1105306725 13:19174119-19174141 CCCCCAGGGACCACCGTGGGGGG + Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1122933073 14:104943611-104943633 GCCCCAGGAGCCAAGCTGGATGG - Exonic
1122933535 14:104945591-104945613 GCCCCAGGAGCCAAGTTGGATGG - Exonic
1122933648 14:104946086-104946108 GCCCCAGGAGCCAAGTTGGATGG - Exonic
1122934226 14:104948561-104948583 GCCCCAGGAGCCAAGCTGGATGG - Exonic
1122934811 14:104951036-104951058 GCCCCAGGAGCCAAGCTGGATGG - Exonic
1123127029 14:105954050-105954072 CCCCCAGGAAACACCCTGGTTGG - Intergenic
1123407488 15:20029870-20029892 CCCCCAGGAAACACCCTGGTTGG - Intergenic
1123516816 15:21036526-21036548 CCCCCAGGAAACACCCTGGTTGG - Intergenic
1126594170 15:50369113-50369135 CCACCAGGAACCAAATTGGCTGG + Intergenic
1127562224 15:60150779-60150801 CCCCCAGCAAGCAACGCTGAGGG + Intergenic
1129691076 15:77713945-77713967 CCACCAGGAAGCGACGTGGGTGG - Intronic
1131347614 15:91665290-91665312 CCACCAGGAAGCCACCTGGAAGG - Intergenic
1134000539 16:10779515-10779537 CTCCCAGGCACCAACCTGGGAGG + Intronic
1136088684 16:27903264-27903286 CCGCCAGGGAGCAACGTGGTCGG + Intronic
1136319302 16:29472245-29472267 GACACAGGAACCAGCGTGGAGGG - Intergenic
1136433873 16:30211589-30211611 GACACAGGAACCAGCGTGGAGGG - Intergenic
1138347064 16:56326577-56326599 GCCCCAGCAGCCAACGTGGCAGG - Intronic
1139454877 16:67066160-67066182 GCTCCAGGAACCCACGTTGAGGG + Intronic
1139672671 16:68502337-68502359 ACCCCAGGAACACACGTGGAGGG - Intergenic
1140000665 16:71021864-71021886 CACCCAGGAACCACAGTGGAAGG - Intronic
1142881090 17:2883146-2883168 CCCCCAGGAGACCACGTGGGTGG + Intronic
1147998641 17:44375179-44375201 CCCCCAGGACCCAACGCAGAAGG + Intronic
1148595914 17:48855292-48855314 CCATCAGGAGCCAACGGGGATGG + Intronic
1150382922 17:64734641-64734663 CTCCCAAGGACCAAGGTGGATGG - Intergenic
1150885784 17:69083935-69083957 CTCCCAGGAAACAAAGTAGAAGG + Intronic
1154044121 18:10888305-10888327 TTCCCAGGAGCCAGCGTGGAGGG - Intronic
1156475813 18:37404637-37404659 TCCCCAAGAACCAAAGTGTATGG - Intronic
1157419490 18:47533455-47533477 GCCCCAGGTCCCAATGTGGAGGG + Intergenic
1157769664 18:50334743-50334765 CCCCAAGGATCAAATGTGGATGG + Intergenic
1160405567 18:78644149-78644171 TCCCCAGGAACCAGTGCGGAAGG + Intergenic
1161283262 19:3456816-3456838 CCCCCCAGGACCAAGGTGGAGGG - Intronic
1161509784 19:4663881-4663903 CCTCCAGGCACCAACCAGGATGG - Intronic
1164828681 19:31303431-31303453 CCCACAGTCACCAAGGTGGAGGG + Intronic
1166882368 19:45937403-45937425 CCCCCAGGACCCTATGAGGAAGG - Exonic
1167651900 19:50735937-50735959 CCCCCGGGAACCAACTTGGTGGG - Intergenic
1167989757 19:53348367-53348389 TCACCAGGAACCAATGTGGCTGG - Intronic
1167993248 19:53378631-53378653 TCACCAGGAACCAATGTGGCTGG - Intronic
1168498542 19:56874482-56874504 GCCACAGGAGCCATCGTGGATGG - Intergenic
926432794 2:12806653-12806675 CAGCCAGGAATCAGCGTGGAAGG - Intergenic
928651229 2:33405615-33405637 CCCCCAGGAACCCACGTGCTAGG - Intergenic
936697826 2:114971917-114971939 CCCCCAGGACTCATCATGGATGG + Intronic
937937352 2:127256914-127256936 GCACCAGGAGCCAACCTGGAAGG + Intergenic
938763872 2:134447664-134447686 CCTTCAGGAAGCAAGGTGGATGG + Intronic
943863683 2:192899644-192899666 AGCCCAGCCACCAACGTGGATGG - Intergenic
946366198 2:219250602-219250624 CCCCCAGGCACCACAGTGGGAGG + Exonic
946410044 2:219511253-219511275 CTCCCAGGATCCAACCTGGGGGG - Intergenic
1171241024 20:23567035-23567057 CATCCAGGAACCCACGTGGCAGG + Intronic
1175308407 20:57993996-57994018 TCCCCAGGAACTAATTTGGATGG + Intergenic
1176057007 20:63154378-63154400 CTCCCAGGGACCACCGTGCAGGG + Intergenic
1176430927 21:6575194-6575216 CACCCAGGAACCCACCTGCATGG - Intergenic
1179706321 21:43182656-43182678 CACCCAGGAACCCACCTGCATGG - Intergenic
1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG + Intergenic
1180224815 21:46386088-46386110 CCACCAGGAGCCAGCGTGCATGG - Intronic
1180843029 22:18968047-18968069 CCCCCAGGGCCCAACGGGCAAGG - Intergenic
1181117533 22:20642326-20642348 CCCCCAGGTGCCACAGTGGAGGG - Intergenic
1181170093 22:21003137-21003159 CCCACAGGGACCACCGTGGGGGG + Intergenic
1182236753 22:28882945-28882967 CCTCCAGGATCGAACGGGGAAGG - Intergenic
1183295899 22:37029429-37029451 CACCCAGGAGCCATCGTAGATGG - Exonic
1185244627 22:49766328-49766350 CCCCCAGGAGCCAGAGTGGGAGG + Intergenic
949219939 3:1619918-1619940 ATCCCAGGAACCAATGTGGCAGG + Intergenic
951415764 3:22419607-22419629 CACTCAGGAACCAGTGTGGAGGG + Intergenic
954421635 3:50421979-50422001 CCCCCAGGAACCAACGTGGATGG - Intronic
954915623 3:54146769-54146791 GGCCCAGGAGCCAACGGGGATGG - Intronic
956049621 3:65233767-65233789 CCCCCAGGAACCAGCTGGGGAGG + Intergenic
958579792 3:96003273-96003295 GCCCAAGGAACCAATGTGCAAGG - Intergenic
959932435 3:111999079-111999101 CCCCCAGGCAGCAAGGGGGATGG - Exonic
961651917 3:128421058-128421080 GCCCCAGGAGCCAGCGTGGCAGG + Intergenic
962847679 3:139286147-139286169 CCCCCAGGTATCAGCGGGGAGGG - Intronic
968732019 4:2273729-2273751 CCCCCAGCAGCCTACGTGGCTGG + Intronic
983129443 4:163997231-163997253 CCCCCTGTAACCAACATGTAGGG - Intronic
985395468 4:189538822-189538844 CCCCCAGGAAGCACCCTGGTTGG - Intergenic
993815438 5:92538981-92539003 TCACCAGGAACCAAACTGGATGG + Intergenic
1000320274 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG + Intergenic
1001944976 5:175771228-175771250 ACCCCAGGGGCCAACATGGATGG + Intergenic
1005384892 6:25276309-25276331 CCCCCAGTAACCATTGGGGAAGG - Intergenic
1005987455 6:30883832-30883854 CCCCTACGACCCAACCTGGAAGG - Intronic
1006483581 6:34319262-34319284 GCCCCAGAAACCAAGGTTGAGGG + Intronic
1006907525 6:37542991-37543013 CCCCCAACAACCCAGGTGGAGGG + Intergenic
1007821403 6:44563111-44563133 CCCACACAAACCAACCTGGAAGG - Intergenic
1007952171 6:45882177-45882199 CACCCTGGAACCATCTTGGATGG + Intergenic
1011081029 6:83490276-83490298 CCACCAAGAGCCAAGGTGGAAGG - Intergenic
1017277663 6:152588819-152588841 CTCCCAGGGACCCACCTGGATGG - Intronic
1017866329 6:158446739-158446761 CCACCAGGAACCAAATTGGCTGG - Intronic
1019552093 7:1608252-1608274 CCCCCAGGATCCCCCGTGGGAGG - Intergenic
1019668104 7:2262759-2262781 CCACCAGGAACAGATGTGGATGG + Intronic
1019990024 7:4683756-4683778 CCCCCAGGACCCAGACTGGATGG - Intronic
1022733883 7:33057878-33057900 CCCCTAAAAACCAACGAGGAAGG - Intronic
1023869748 7:44256885-44256907 CCCACAGCAACCAACGTGGGTGG - Intronic
1025526479 7:61818973-61818995 ACCCCAGGAAAAAAAGTGGAAGG + Intergenic
1025549855 7:62231529-62231551 ACCCCAGGAAAAAAAGTGGAAGG + Intergenic
1026882479 7:73916327-73916349 CCTCCAGCAACCAAGCTGGATGG + Intergenic
1027159419 7:75791467-75791489 AGCCCAGGAAGCAACCTGGAGGG - Intergenic
1027188915 7:75986917-75986939 ACCCCAGGAACCCATGTGGTGGG + Exonic
1028177479 7:87674714-87674736 CCCCCAGGAAGCACCCTGGTTGG + Intronic
1029514452 7:101017007-101017029 CCCCCAGGAGCCCCCGTAGAAGG + Intronic
1048471059 8:134704392-134704414 CCCCTAGAAACAAACATGGATGG + Intronic
1049216654 8:141411414-141411436 CCCCCAGGACACATGGTGGAGGG - Intronic
1056971786 9:91210879-91210901 CTCCTAGGAACCAACATGTAAGG - Intergenic
1057027902 9:91749335-91749357 CCACCAGGAGCCAAAGTGGCTGG - Intronic
1061000304 9:127899062-127899084 CCCCCACGAACCCGCGTGGGAGG + Intronic
1187271195 X:17781195-17781217 CCCCAAGGAACATACGTGGATGG - Intergenic
1188921679 X:35985597-35985619 CCCCCAGGAAGCACCCTGGTTGG + Intronic
1192690164 X:73354159-73354181 CCCCCAGGAAGCACCCTGGTTGG + Intergenic
1197820538 X:130536881-130536903 CCCCAGGGATCAAACGTGGATGG - Intergenic