ID: 954424755

View in Genome Browser
Species Human (GRCh38)
Location 3:50437531-50437553
Sequence CAGGGGAATGTTGAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 943}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954424755_954424768 12 Left 954424755 3:50437531-50437553 CCCTCCCCCTCAACATTCCCCTG 0: 1
1: 0
2: 1
3: 73
4: 943
Right 954424768 3:50437566-50437588 TTGTTCCTGTCTTCTAGGGTGGG 0: 1
1: 0
2: 4
3: 13
4: 203
954424755_954424764 7 Left 954424755 3:50437531-50437553 CCCTCCCCCTCAACATTCCCCTG 0: 1
1: 0
2: 1
3: 73
4: 943
Right 954424764 3:50437561-50437583 TCCAATTGTTCCTGTCTTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 289
954424755_954424766 8 Left 954424755 3:50437531-50437553 CCCTCCCCCTCAACATTCCCCTG 0: 1
1: 0
2: 1
3: 73
4: 943
Right 954424766 3:50437562-50437584 CCAATTGTTCCTGTCTTCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 261
954424755_954424767 11 Left 954424755 3:50437531-50437553 CCCTCCCCCTCAACATTCCCCTG 0: 1
1: 0
2: 1
3: 73
4: 943
Right 954424767 3:50437565-50437587 ATTGTTCCTGTCTTCTAGGGTGG 0: 1
1: 0
2: 4
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954424755 Original CRISPR CAGGGGAATGTTGAGGGGGA GGG (reversed) Intronic
900031162 1:374000-374022 GAGGGGGATGGAGAGGGGGATGG - Intergenic
900051730 1:602249-602271 GAGGGGGATGGAGAGGGGGATGG - Intergenic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901835844 1:11923504-11923526 AAGCGGCATGTTAAGGGGGAAGG + Intronic
901844426 1:11972951-11972973 CAGGGCGATGTTGATGGTGAAGG - Exonic
902083353 1:13836969-13836991 CAGGGGAAGGTGGGGTGGGAGGG - Intergenic
902320340 1:15658941-15658963 AAGGGGAATGTGGAGGGAGATGG - Intronic
902563365 1:17292898-17292920 GAGGGGAATGGGGAAGGGGAGGG + Intergenic
902998691 1:20248591-20248613 CTGGGGCTTGTTGAGGGGGTTGG + Intergenic
903450822 1:23452623-23452645 CAGGAGACTGTTGGGGGGCAGGG - Intronic
903617515 1:24672062-24672084 CCGGGGACTGTTGTGGGGTAGGG - Intronic
903686331 1:25134970-25134992 CAGGGCAATGGGGATGGGGAGGG - Intergenic
904200963 1:28818778-28818800 CATGGGGATGGTGAGAGGGAGGG + Intronic
904322344 1:29706099-29706121 CAGGGGAAAGATGATGGGAAGGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904502085 1:30919063-30919085 AAGGGGATTGTTGAGGGTGAGGG + Intergenic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
905174502 1:36127271-36127293 AGGGGGAAGGTTGAGGGGGGTGG - Intergenic
905352733 1:37358786-37358808 CAGGGGAGACTTCAGGGGGAAGG + Intergenic
905542521 1:38771684-38771706 CACGGGAATGTTCAAGGTGAGGG + Intergenic
905959582 1:42032647-42032669 CAGGGGAATGGTGGGGGAGGGGG - Intronic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
908907839 1:69037193-69037215 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
909935658 1:81547348-81547370 GAGGGGAATGGTGAGGGGAAAGG - Intronic
910208853 1:84774140-84774162 CTGGGGAATGCAGAGGGGAAGGG + Intergenic
910224958 1:84927029-84927051 CGGGGAAATGTTGGGGGGTAGGG + Intronic
911813531 1:102313296-102313318 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
911827898 1:102511180-102511202 CTGGGGACTGTTGTGGGGGGGGG - Intergenic
911848214 1:102781370-102781392 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
912480448 1:109978596-109978618 CAGGGCAATGGTGAGTGGGCTGG - Intergenic
912518914 1:110232240-110232262 CAGGTGAATGCTGAAGGGGAAGG - Exonic
912933470 1:113983573-113983595 CAGGGAGGGGTTGAGGGGGAAGG + Intergenic
913169101 1:116216219-116216241 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
913667282 1:121059997-121060019 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
913699209 1:121357803-121357825 CAAGTGAGTGTTGAGGGGGCTGG + Intronic
914018972 1:143847140-143847162 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
914138336 1:144922242-144922264 CAAGTGAGTGTTGAGGGGGCTGG - Intronic
914394326 1:147250540-147250562 CAGGGGAAAGCTAAGGGGTAGGG + Intronic
914657523 1:149755347-149755369 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
914677159 1:149914091-149914113 CAGGGGAATGGGAAGGGGAAGGG + Exonic
915040979 1:152968044-152968066 CAGGGGACTGTTGTGGTGGGGGG + Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915147087 1:153801684-153801706 CAGGGGAATGTGAAGGGGACGGG - Intergenic
915267942 1:154732142-154732164 CAGGGGAAAGTGGAGATGGAGGG - Intronic
915730726 1:158052299-158052321 AAGGGGAATGTTGGGTGGGTTGG - Intronic
915780556 1:158545315-158545337 CCGGGGAATGTTGTGGGTGGGGG + Intergenic
915862397 1:159458800-159458822 CTGGGGCTTGTTGTGGGGGAGGG + Intergenic
915887318 1:159736399-159736421 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
916904993 1:169273615-169273637 CTGGGGACTGTTGTGGGGTAGGG - Intronic
917072174 1:171163840-171163862 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
917581961 1:176388033-176388055 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
917780255 1:178387528-178387550 CCGGGGACTGTTGTGGGGTAGGG - Intronic
918067159 1:181109199-181109221 CAGGGGGCTGCTGATGGGGATGG - Intergenic
918160407 1:181893471-181893493 CTGGGGCCTGTTGAGGGGGTGGG + Intergenic
918855329 1:189747458-189747480 CCGGGGACTGTTGTTGGGGAGGG + Intergenic
918942042 1:191013104-191013126 CTGGGGACTGTTGTGGGGGTGGG - Intergenic
919259962 1:195179430-195179452 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
919321595 1:196047620-196047642 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
919701985 1:200640006-200640028 TAGAGGAATATTGAGGGGAAAGG + Intronic
920075930 1:203336593-203336615 GTGGGGAATGATGAGGGGCAGGG - Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920285151 1:204873834-204873856 CAGGAGAATGTTCTGGGGGTGGG + Intronic
920330237 1:205202089-205202111 AAGGGGAAGGGAGAGGGGGAAGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920486620 1:206376515-206376537 CAAGTGAGTGTTGAGGGGGCTGG + Intronic
920960949 1:210663657-210663679 TAGGGGAATCTGCAGGGGGAAGG - Intronic
921250414 1:213292087-213292109 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
921405655 1:214776350-214776372 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
922213499 1:223502668-223502690 CAGGGGAATGGGGAAGGGGCTGG + Intergenic
922535937 1:226381101-226381123 CGGGGGGAAGTTGACGGGGACGG - Exonic
922618241 1:226976013-226976035 CAGGGGGCTGTTGGGGGAGAGGG - Intronic
922982538 1:229839847-229839869 CAGGGAGCTGTTGAAGGGGAAGG + Intergenic
922985045 1:229859981-229860003 CAGGGGAAGATTGAGGTTGAGGG - Intergenic
923082860 1:230675896-230675918 CTTTGGAAGGTTGAGGGGGAAGG - Intronic
923307224 1:232699254-232699276 CAGAGGAGTGTTGATGGGCAGGG + Intergenic
923947503 1:238904594-238904616 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
924575910 1:245280758-245280780 CTGGGGACTGTTGTGGGGTAGGG - Intronic
924639703 1:245822384-245822406 CTGGGGACTGTTGTGGGGTAGGG + Intronic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
1063801611 10:9585242-9585264 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1064026076 10:11849825-11849847 CATGGCCATGTTGAGGGGCAGGG + Intronic
1064805570 10:19126912-19126934 CTGGGGACTGTTGAGGGGTGAGG - Intronic
1064866320 10:19884507-19884529 CTGGGGAATGTTGTGGGGTAGGG - Intronic
1064949279 10:20829423-20829445 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1064956371 10:20915409-20915431 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1065563759 10:26988963-26988985 AAGGGGAGTGTTGCAGGGGATGG + Intergenic
1065946582 10:30610530-30610552 CTGGGGCCTGTTGAGGGGGTTGG + Intergenic
1066028490 10:31391329-31391351 CAGGTGACTGTTTTGGGGGAGGG - Intronic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066507609 10:36061807-36061829 CAGGGGACTGTTGTGGGGTGAGG - Intergenic
1066594838 10:37038905-37038927 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1066974563 10:42355022-42355044 CTGGGGACTGTTGCGGGGTAGGG + Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067058424 10:43065438-43065460 GAGGGGAGTGTTCAGGGGGTGGG - Intergenic
1067302657 10:45026621-45026643 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1067792229 10:49296996-49297018 CTGGGGAATGTTCCGGGGGCCGG - Intergenic
1067985181 10:51135952-51135974 CTGGGGACTGTTGTGGGGGAAGG + Intronic
1068254653 10:54494073-54494095 CTGGGGATTGTTGTGGGGTAGGG + Intronic
1068297608 10:55094378-55094400 CAGGGGCCTGTTGTGGGGTAGGG + Intronic
1068601060 10:58957081-58957103 CACTGGAATGCTGAGGGGAAGGG + Intergenic
1068952173 10:62788626-62788648 CAGGGGCCTGTTGAGGGGTGGGG + Intergenic
1069127469 10:64654286-64654308 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1070157824 10:73847076-73847098 CAGAGGACTGTTGAGGGCCAGGG - Intronic
1070383236 10:75900609-75900631 CAGGGGCATGCTGCGGGGGCTGG - Intronic
1070561485 10:77570574-77570596 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1070567243 10:77613251-77613273 CTGGGGAAGGTTGTGGGGGAAGG - Intronic
1070619653 10:77999138-77999160 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1071027922 10:81137942-81137964 CAGGGGCCTGTTGGGGGAGAGGG - Intergenic
1071083269 10:81838363-81838385 CAGAGGAATGGTGAGAGGAAGGG + Intergenic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1071558077 10:86621772-86621794 CTGGGGACTGTTGTGGGGGTGGG + Intergenic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073275685 10:102308712-102308734 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1073975653 10:109097760-109097782 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1074287244 10:112109785-112109807 CTGGGGAATGTTGTGGGGTGGGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074746140 10:116534465-116534487 CAGGGGAATGGTGGGGGGCAAGG - Intergenic
1075549156 10:123379430-123379452 CTGGGGAATGCAGAGGGAGAGGG - Intergenic
1075724132 10:124603090-124603112 CAGGGCAATGGTGAGGGGCCTGG - Intronic
1076071168 10:127490970-127490992 AAGGGGACTGGGGAGGGGGAGGG - Intergenic
1076881732 10:133242679-133242701 CATGGGGATGTTGAGTGGGGTGG - Intergenic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077097118 11:803801-803823 CTGGGGAAGGTTGTGGGTGATGG - Intronic
1077562555 11:3273009-3273031 CGGGTGAATGTTCAGGGAGATGG - Intergenic
1077568448 11:3318828-3318850 CGGGTGAATGTTCAGGGAGATGG - Intergenic
1078510032 11:11978175-11978197 CAGGAGAAGGTTGAGAAGGAAGG + Intronic
1078750364 11:14155654-14155676 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1078761664 11:14256553-14256575 GAAGGGAATGTGTAGGGGGAAGG - Intronic
1079036057 11:17021134-17021156 AAGGGGATTGTGGAGGGTGAGGG - Intergenic
1079099770 11:17533908-17533930 CAGGGGCCTGGGGAGGGGGAAGG - Intronic
1079633722 11:22709999-22710021 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1079958069 11:26888476-26888498 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1080068316 11:28046533-28046555 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1080079947 11:28205260-28205282 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1080082103 11:28233958-28233980 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1080508342 11:32941385-32941407 CTGGGGACTGTTGTGGGGGGTGG - Intronic
1080600343 11:33816409-33816431 AAGTGGAATGATGAGGGTGATGG + Intergenic
1081149552 11:39610057-39610079 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1081330473 11:41794069-41794091 CAGGGAAATGTTATGGGAGAAGG + Intergenic
1081613120 11:44575351-44575373 CAGGAGACTGTTGGGGAGGAAGG - Intronic
1081735947 11:45404372-45404394 CAGGAGGATGGTGATGGGGAAGG - Intergenic
1082153395 11:48771817-48771839 CTGGGGACTGTTGAGGGGTGGGG - Intergenic
1082771474 11:57211005-57211027 GCAGGGAATGTGGAGGGGGAAGG - Intergenic
1083419261 11:62544246-62544268 CAGGGACCTGTTGAGGGAGAAGG - Intronic
1083806187 11:65075553-65075575 GGGGGGGATGTTGAGGGGGATGG + Intronic
1083891155 11:65596393-65596415 CAGGGGAGAGTTGGGGGTGAAGG + Intronic
1085047966 11:73364251-73364273 CAGGGGCAGGGTGTGGGGGAGGG - Intronic
1085604989 11:77889383-77889405 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1085609338 11:77933198-77933220 GAGGGGGATGGAGAGGGGGACGG - Intronic
1085638423 11:78175887-78175909 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1085845620 11:80061313-80061335 CAGGCGAATGTGGAGAGGGAGGG + Intergenic
1085961672 11:81469300-81469322 CAGGGGGACGGTGAGGGAGATGG + Intergenic
1086286950 11:85261860-85261882 CAGGGGGAAGGTGAGGGAGAAGG + Intronic
1087477129 11:98650318-98650340 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087642456 11:100769825-100769847 CAGGGGGAGGTGTAGGGGGATGG + Intronic
1087867642 11:103251683-103251705 CAGGGGAATGAAGGAGGGGATGG - Intronic
1088090676 11:106035780-106035802 CAGGAGAACACTGAGGGGGATGG - Intergenic
1088427536 11:109720976-109720998 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1089312285 11:117566732-117566754 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1089993683 11:122884686-122884708 CTGGGGAAAGTTGAGTGGGTGGG - Intronic
1090186387 11:124741708-124741730 CAGGGGAGTATTGCTGGGGAAGG + Intronic
1090776298 11:129968777-129968799 CAGGGGGATGGTGAGTGGGTAGG - Intronic
1090868993 11:130726315-130726337 AAGGGGAGTGTGGAGGGAGATGG + Intergenic
1090921538 11:131210479-131210501 AAGGGTAATGGTGATGGGGAGGG + Intergenic
1091729090 12:2866495-2866517 CAGGGAAAGGTTGTGGCGGATGG + Exonic
1091937624 12:4445966-4445988 CTGGGGAGTGTGGAGGGTGATGG - Intergenic
1092122928 12:6057127-6057149 CAGGGGAGTGTTGACCGGGAGGG - Intronic
1092633616 12:10414597-10414619 CAGGGGACTGTTGTGGGGTGGGG + Intronic
1092772972 12:11915144-11915166 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1093389360 12:18599485-18599507 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1094218711 12:27971148-27971170 CCTGGGACTTTTGAGGGGGAGGG - Intronic
1095077250 12:37945761-37945783 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
1095184359 12:39184696-39184718 GTGGGGGGTGTTGAGGGGGATGG - Intergenic
1095191750 12:39265709-39265731 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
1096021184 12:48326951-48326973 CAGGTGTGTGTTGAGGGGCAGGG - Intergenic
1096077263 12:48813657-48813679 CAGGGGAGTGTAGGTGGGGAGGG + Intergenic
1096228163 12:49882454-49882476 CAGGGGAATGTTGATGAGAGGGG - Intronic
1096420275 12:51451060-51451082 CAGGGGAATGGGGAGGCTGAGGG + Intronic
1096608614 12:52786284-52786306 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1096618536 12:52848205-52848227 CAGGGGAAAGGTGAGGCTGATGG - Intronic
1096805938 12:54141146-54141168 CTGGGGAATGTGGAGAGGGGAGG - Intergenic
1096880457 12:54664428-54664450 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1096883652 12:54694887-54694909 CTGGGGACTGTTGGGGGGTAGGG + Intergenic
1097119837 12:56722874-56722896 GAAGGGAATGTTAAGGGGGGCGG + Intronic
1097389483 12:58992646-58992668 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1097453339 12:59764486-59764508 CCGGGGACTGTTGTGGTGGAGGG - Intronic
1097771701 12:63593627-63593649 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1098389693 12:69956535-69956557 AAAGGAAATGTGGAGGGGGATGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099041544 12:77659946-77659968 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1099211531 12:79795848-79795870 CAGGGGACTATCTAGGGGGATGG + Intronic
1099377618 12:81911542-81911564 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1099380527 12:81946808-81946830 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1099823906 12:87750607-87750629 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1100189065 12:92171219-92171241 CAGGGGAAGGCTGCGGGTGACGG - Intergenic
1100482786 12:94995340-94995362 CAGGGGAATGTGCAGGCAGATGG + Intronic
1101190219 12:102325103-102325125 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1101282288 12:103270732-103270754 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1101296670 12:103430950-103430972 CTGGGGCCTGTTGAGGGGTAGGG + Intronic
1101463167 12:104917808-104917830 CTGGGGAATGTTGTGGGGTGGGG + Intronic
1101628722 12:106472016-106472038 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1101659222 12:106751090-106751112 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1101741883 12:107507159-107507181 CAGGAGAGTGCTGAGGGGCAAGG + Intronic
1101795600 12:107970347-107970369 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1101869909 12:108557585-108557607 CATGGGACTGTTGTGGGGCATGG - Intronic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102222268 12:111202505-111202527 CAGGGGACTGATGGGGGTGACGG + Intronic
1103000731 12:117383559-117383581 AAGGAGAAAGTCGAGGGGGAGGG + Intronic
1103584789 12:121944298-121944320 AAGAGGAATGTTGGGGGGAAAGG - Intronic
1103874485 12:124116515-124116537 TTGGGGAATGTTGTGGGGGCGGG + Intronic
1104236878 12:126947373-126947395 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1104472139 12:129037710-129037732 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1104949200 12:132431469-132431491 CACGGGGGGGTTGAGGGGGAAGG - Intergenic
1105339052 13:19502635-19502657 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1105500476 13:20967337-20967359 GAGGGGAGTGTAGAGAGGGAAGG - Intergenic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1107231758 13:38118009-38118031 CTGGGGAATGTTGTGGGGTGGGG + Intergenic
1107944597 13:45406661-45406683 GAGGGGAGTTTTGAGGGTGAGGG - Intronic
1108093250 13:46873600-46873622 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1108492369 13:50994222-50994244 GAGGGGAAGGCGGAGGGGGAGGG - Intergenic
1108739951 13:53326315-53326337 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1109236258 13:59825191-59825213 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1109400928 13:61827865-61827887 CAGGGGACTGTTGTGGGTGGGGG - Intergenic
1110071059 13:71178269-71178291 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1110157659 13:72338001-72338023 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1110186128 13:72676780-72676802 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1110394965 13:75019166-75019188 CAGGGGCCTGTTGCGGGGTAGGG + Intergenic
1110400251 13:75081451-75081473 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1110566639 13:76963999-76964021 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1111091273 13:83451476-83451498 CTGGGGCCTGTTGTGGGGGAAGG - Intergenic
1111096407 13:83521759-83521781 CTGGGGACTGTTGAGGGGTGGGG - Intergenic
1111224683 13:85253883-85253905 CAGGGGCCTGTTGAGGGGTGGGG + Intergenic
1111329654 13:86747840-86747862 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1111345875 13:86953540-86953562 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1111605191 13:90529199-90529221 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1111995146 13:95158277-95158299 CAGAAGCATGATGAGGGGGATGG + Intronic
1112095249 13:96125934-96125956 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1112907249 13:104439164-104439186 CCGGGGACTGTTGTGGGGGAAGG + Intergenic
1112982870 13:105408441-105408463 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1113094181 13:106646349-106646371 AAGGGAAATCTTGATGGGGAAGG - Intergenic
1113520630 13:110937996-110938018 CGGGGGAAAGTTGATGGGGACGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1115017592 14:28635821-28635843 CTGGGGCCTGTTGAGGGGGTGGG - Intergenic
1115380648 14:32734934-32734956 CAGGAGAGTGTTGTCGGGGAGGG - Intronic
1115456189 14:33606227-33606249 CTGGGGAATGTTGTGGGGTGGGG - Intronic
1115828030 14:37299276-37299298 CAGGGGACTGTTGTAGGGTAGGG + Intronic
1116129461 14:40836103-40836125 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1116242796 14:42367527-42367549 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1117045401 14:51808430-51808452 CAGAGGTATGTAGAGGGAGAGGG + Intergenic
1117258478 14:54004416-54004438 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1117269150 14:54123792-54123814 CAGATGAATGTTGAGAGAGAAGG - Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1118481625 14:66173358-66173380 CTGGGGCTTGTTGATGGGGAGGG - Intergenic
1118649395 14:67873925-67873947 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1118682651 14:68259288-68259310 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1118743659 14:68758887-68758909 GAGGGGAAGGGTCAGGGGGAGGG - Intergenic
1118782386 14:69017710-69017732 CAGGGGAGGGTTGGGGGGGTGGG - Intergenic
1118782427 14:69017805-69017827 CAGGGGAGGGTTGTGGGGGTGGG - Intergenic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119195832 14:72716002-72716024 CAGAGGGGTGTGGAGGGGGAGGG - Intronic
1119391630 14:74295000-74295022 CAGGGGGAGGTAGAGGGAGAGGG + Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120070236 14:80094506-80094528 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1120684694 14:87524653-87524675 CAGGGGCCTGTCGAGGGGGCAGG + Intergenic
1121468175 14:94129307-94129329 CAGGGGAAGGCAGAGGGAGATGG + Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1121970640 14:98352898-98352920 CAGAGGAATCTTGGGGGGGTGGG - Intergenic
1122204771 14:100142986-100143008 CAGGAGAAGGTTGTGGGGGCTGG - Intronic
1123061107 14:105594892-105594914 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1123085562 14:105715803-105715825 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1124700989 15:31911778-31911800 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1125384799 15:39125953-39125975 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1125697537 15:41651764-41651786 GAGGGGAAAGGAGAGGGGGAGGG - Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126383947 15:48074996-48075018 TAGGGGAATGGAGTGGGGGACGG - Intergenic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1126907201 15:53380730-53380752 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1126928047 15:53612909-53612931 GAAAGGAAGGTTGAGGGGGATGG + Intronic
1126958748 15:53965720-53965742 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1126966544 15:54060954-54060976 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1126979071 15:54220433-54220455 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1127156639 15:56134768-56134790 CTGGGGACTGTTGTTGGGGAGGG - Intronic
1127607489 15:60602900-60602922 CAGAGGAATATTGGGGGAGAGGG - Intronic
1127677814 15:61259992-61260014 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1127751361 15:62048254-62048276 CAGGGGCCTGTTGGGGGGGGTGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128384183 15:67135326-67135348 CAGGGGACTGTGAAGGGGGCAGG - Intronic
1128952996 15:71907097-71907119 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1129559300 15:76549584-76549606 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1129621439 15:77150666-77150688 CCGGGGAATGTTGTGGGGTGGGG - Intronic
1129654733 15:77516623-77516645 CTGGGGACTCTTGAGGGGGATGG - Intergenic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1130736946 15:86560293-86560315 CCGGGGACTGTTGCGGGGGTGGG - Intronic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131342228 15:91613121-91613143 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1131342641 15:91616968-91616990 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1131564935 15:93477442-93477464 CAGGGGCGTGTTGGGGGGAATGG + Intergenic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131724989 15:95211951-95211973 CAGGGCAATTTTGCAGGGGAAGG - Intergenic
1132222163 15:100113094-100113116 CCGGGGACTGATGAGGGGGCCGG - Intronic
1132240395 15:100253355-100253377 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240403 15:100253373-100253395 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240411 15:100253391-100253413 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240419 15:100253409-100253431 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240427 15:100253427-100253449 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240435 15:100253445-100253467 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240443 15:100253463-100253485 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240450 15:100253481-100253503 GAGGGGAACGTAGAGGGGGAGGG + Intronic
1132240458 15:100253499-100253521 GAGGGGAAGGTAGAGGGGGGAGG + Intronic
1132697115 16:1206965-1206987 CAGGGGCGTGTTGAGGGTGGAGG - Intronic
1132734588 16:1379276-1379298 CAGGGGAACGGGGCGGGGGAGGG - Intronic
1133692569 16:8230700-8230722 CAGGGGAAAGGAGAAGGGGATGG + Intergenic
1134324003 16:13190234-13190256 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1134433199 16:14231120-14231142 CTGGGGACTGTTGTGGGGTAAGG + Intronic
1134449429 16:14354289-14354311 AAGGGGAAAGGGGAGGGGGAAGG + Intergenic
1134744290 16:16575401-16575423 CTGGGGAATGTTGTGGGGTGGGG - Intergenic
1135133769 16:19872860-19872882 GAGGGGAATGGTTGGGGGGAAGG + Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1136344299 16:29664983-29665005 CAGTGGGATGGTGAGAGGGAAGG - Exonic
1137394081 16:48104794-48104816 CAGTGGAATGCAGAGGGGGCTGG + Intronic
1137458116 16:48633809-48633831 CTGAGGAATGTTGTGGGGGATGG + Intergenic
1137629408 16:49931686-49931708 CAGGGGGACTTTGAAGGGGAGGG - Intergenic
1138396710 16:56710034-56710056 CAGGGGGCAGTAGAGGGGGAAGG + Intronic
1139272334 16:65695844-65695866 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1139298209 16:65921383-65921405 CAGGTGAAGGGTGATGGGGAAGG - Intergenic
1139394571 16:66630298-66630320 GAGGGGGAGGGTGAGGGGGAGGG - Intronic
1139573968 16:67829809-67829831 CAGGGGACTGCTGAGGCTGACGG - Exonic
1139847027 16:69928565-69928587 CAGGGGAATGTTCATGGAGTGGG - Intronic
1140639389 16:76954350-76954372 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1140694964 16:77523752-77523774 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1141083607 16:81075825-81075847 CAGGGGAATGTTGAAGGACCAGG + Intronic
1142032313 16:87844658-87844680 CATGGGAATGTGGAGATGGAGGG + Intronic
1142572146 17:881969-881991 CAGGGGACTGTGCAGGGAGATGG + Intronic
1145402752 17:22555710-22555732 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1145826596 17:27881662-27881684 CATGGGAATGTTTAGGGGTAAGG - Intronic
1145850671 17:28092635-28092657 TAGGTGACTGTTGAAGGGGAGGG - Intronic
1145994983 17:29099933-29099955 CCTGGGAAGGTTGAGGGAGAAGG + Intronic
1146930105 17:36770892-36770914 GAGGGGAAGGTTGAAGGGGAAGG - Intergenic
1147352374 17:39859986-39860008 CTTGGGAAGGTTGAGGCGGAAGG + Intronic
1147510812 17:41067488-41067510 CAAGGGTATGCTGAGGTGGAGGG - Intergenic
1147512867 17:41086890-41086912 CAGGGGCCTGTTGTGGGGGTGGG + Intronic
1147742410 17:42676649-42676671 CAGGGGAAAGATGAGGTGGGAGG + Exonic
1147917688 17:43898491-43898513 GAGGGGAATGTTGCCGGGGAGGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148191903 17:45685074-45685096 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1148320645 17:46748985-46749007 AAGGGGCATGTGGTGGGGGAAGG + Intronic
1148675347 17:49441663-49441685 GAGAGGAAGGTGGAGGGGGAGGG + Intronic
1148772230 17:50074114-50074136 CAGGGGAAAGTGGTGGGGGCAGG - Intronic
1149017079 17:51920351-51920373 CAGGGAAATGATGAAAGGGAGGG + Intronic
1149195171 17:54110792-54110814 GAGGGGGAGGTGGAGGGGGAGGG + Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149500577 17:57149313-57149335 GAGGGGAAAAATGAGGGGGAAGG + Intergenic
1149811701 17:59680511-59680533 TAGGGGAAGGTTGTGGGGGTGGG + Intronic
1149865670 17:60149850-60149872 CAGGGGAAGGTGGAGAGGGGAGG + Intergenic
1150023933 17:61651943-61651965 CAGGGGAATGATGAGAATGATGG + Intergenic
1150606405 17:66695005-66695027 AAGGGGAAAGGTGAGGGGAAGGG + Intronic
1151453079 17:74211243-74211265 CAGGTGAATGGGGAGGGGGGAGG + Intergenic
1151583861 17:74996623-74996645 TAGGGGGATGTTGTGGGGGATGG - Intronic
1152295402 17:79464331-79464353 GAGGGGAATGTTTACGTGGACGG + Intronic
1152371364 17:79890714-79890736 CAAGGGAATCTTGACAGGGACGG - Intergenic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152586426 17:81191450-81191472 CAGGGGTCTGGAGAGGGGGAAGG - Intronic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152948491 17:83211713-83211735 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1153078851 18:1196839-1196861 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1153180458 18:2427095-2427117 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153795261 18:8616141-8616163 CAGGGGAAGGTCGAGCAGGATGG - Intronic
1154460280 18:14576634-14576656 CTGGGGACTGTGGTGGGGGAGGG + Intergenic
1154944706 18:21150055-21150077 CAGGGCAATGGTGGTGGGGAGGG - Intergenic
1155861708 18:30909577-30909599 CCGGGGACTGTTGTGGGGGAGGG + Intergenic
1155949113 18:31888747-31888769 CTGGGGCCTGTTGAGGGGTAGGG + Intronic
1155996149 18:32333235-32333257 AAGGGGAGTGGAGAGGGGGAGGG + Intronic
1156075150 18:33266628-33266650 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1156118108 18:33811567-33811589 CGGGGGACTGTTGTGGGGTAGGG + Intergenic
1156122579 18:33863258-33863280 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1156276547 18:35589064-35589086 CGGGGGAAGGTTGGTGGGGAGGG + Intronic
1156388819 18:36631132-36631154 CAGGGGTTTGTTGTGGGGCAGGG + Intronic
1156462099 18:37326822-37326844 CAGAGGGATGGGGAGGGGGAAGG - Intronic
1156771216 18:40728725-40728747 CAGGGGCCTGTCGAGGGGTAGGG - Intergenic
1156858608 18:41811945-41811967 CAGGGGGATGTTGAGAAGGGTGG + Intergenic
1157244961 18:46045498-46045520 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1157863900 18:51164933-51164955 CAGGGGAGAGCTGAGTGGGAGGG + Intergenic
1158752180 18:60274746-60274768 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1158909823 18:62048856-62048878 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1159130819 18:64278460-64278482 CAGTAGACTGTTGAGGGGTAGGG - Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159375907 18:67592765-67592787 CAGGGGCATGTTGTGGGGTGGGG - Intergenic
1161104284 19:2435545-2435567 CTGGGGACTGCTGATGGGGAGGG + Intronic
1161319470 19:3634291-3634313 CAGGGGGAGCTTGAGGGGGTGGG - Intronic
1161470819 19:4456112-4456134 GAGGGGAAGGTTGGAGGGGAAGG - Intronic
1161523363 19:4738382-4738404 GAGGGGAGTGGAGAGGGGGATGG + Intergenic
1161861626 19:6802177-6802199 CAGGGGACTGTTGTGGGGTCGGG + Intronic
1162343337 19:10105602-10105624 CAGGGGGAAGACGAGGGGGAGGG + Intergenic
1162443415 19:10707450-10707472 CAGGGGCCTGGTGAGGGGGTAGG - Intronic
1162959279 19:14116929-14116951 CTGGGAAATGTTCAGGGGGCAGG + Intronic
1163339784 19:16698045-16698067 CAGAGGAATTTTGGGAGGGAAGG + Intergenic
1163531073 19:17849185-17849207 CAGGGGTGAGATGAGGGGGAAGG + Intergenic
1164169189 19:22709366-22709388 CAGGGGAATGAGGAGGGGCTGGG + Intergenic
1164284521 19:23801243-23801265 TAGGGGAGGGTTGGGGGGGATGG + Intronic
1164430435 19:28183449-28183471 CTGGGGACTGTTGTGGGGCAGGG + Intergenic
1164443466 19:28297980-28298002 CAGGGCAATGGGGAGGGGGGAGG - Intergenic
1164998128 19:32738439-32738461 AAGGAGAATGTTGACTGGGATGG + Intronic
1165272244 19:34720676-34720698 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1165288711 19:34866041-34866063 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1165346007 19:35249169-35249191 GAGGGAACTGTAGAGGGGGATGG + Intronic
1165415966 19:35693727-35693749 CTGGTGAAGGTTGATGGGGAGGG - Intergenic
1165802803 19:38563171-38563193 CAGGGGAAAGTGGAATGGGAAGG - Intronic
1165898956 19:39159724-39159746 AAGGTGAAGGTTGAGGGGGCAGG + Intronic
1165940260 19:39411426-39411448 CAGGGGAGTGTTCAGGCAGAGGG - Intergenic
1166440046 19:42805604-42805626 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1167118697 19:47503594-47503616 CAGGTGAAGGGTGAGGGGTAGGG - Intronic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1168389701 19:55996490-55996512 CCGGGGACTGTTGTGGGGGAGGG - Intergenic
1202658344 1_KI270708v1_random:45246-45268 CTGGGGACTGTTGAGGGGTTGGG - Intergenic
925746829 2:7050810-7050832 GAGGGGAATGTCGAAGGGAACGG + Intronic
926686679 2:15703641-15703663 TTGTGGAATGTTGAGGAGGAAGG + Intronic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
927799318 2:26083405-26083427 GAGGGGAAAGCTGAGGGGGAAGG - Intronic
927799329 2:26083435-26083457 GAGGGGAAGGTTTTGGGGGAGGG - Intronic
927867647 2:26601401-26601423 CATGGCAATGCTGTGGGGGAAGG + Intronic
928046347 2:27936785-27936807 CTGGGGACTGTTGTGGGGTAGGG + Intronic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928390870 2:30910047-30910069 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
929074034 2:38062771-38062793 CTGGGGACTGTTGTGGGGGGGGG - Intronic
929518074 2:42622406-42622428 TAGGGGGAGGTAGAGGGGGAGGG + Intronic
929670843 2:43875649-43875671 CAGGTGGATGTGGAGAGGGAGGG - Intronic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
930281475 2:49375064-49375086 CTGGGGAATGTTGTGGGGTCGGG - Intergenic
930464841 2:51734986-51735008 CTGGGGACTGTTGCGGGGTAGGG + Intergenic
931137958 2:59425532-59425554 CACTGGAATGTGGAGGGGGGGGG + Intergenic
931614439 2:64142017-64142039 CAGTGGAATTTGTAGGGGGAGGG - Intronic
931627607 2:64271033-64271055 CAGGGTCTTGTTGAGGGTGATGG + Intergenic
931999430 2:67870781-67870803 CAGAGGAATGGTGATGAGGATGG - Intergenic
932876405 2:75456774-75456796 CAGCTGACTGTTGAGTGGGAAGG + Intergenic
932979567 2:76648149-76648171 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
933020731 2:77187461-77187483 CAGGGGACTGTTGTGGGGTGGGG + Intronic
933102419 2:78276855-78276877 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
933112630 2:78423114-78423136 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
934661449 2:96145589-96145611 GGGGGGGAGGTTGAGGGGGAAGG + Intergenic
935308412 2:101759666-101759688 GAGGGGAATGGGGAGGGGGAGGG - Intronic
935690142 2:105723559-105723581 CAGGGAAATGTGGAAAGGGATGG + Intergenic
935804522 2:106732708-106732730 AAGGGAAATGTTGAGGGGCAGGG + Intergenic
936315724 2:111422708-111422730 CAGGGGGATGGAGCGGGGGATGG - Intergenic
936509672 2:113134966-113134988 GAGGGGAATGTTGATTTGGATGG + Intergenic
936664026 2:114574261-114574283 CAGGGGAACTTTGAATGGGAGGG - Intronic
937080455 2:119136505-119136527 CAGGGGAAGGGCGGGGGGGATGG - Intergenic
937345212 2:121121156-121121178 CACGGGACTGTGGAAGGGGAGGG + Intergenic
937663767 2:124461514-124461536 CAGGGGACTGTTGTGGGGTGGGG + Intronic
938108361 2:128548495-128548517 CAGAGAGATGTTGAGTGGGATGG + Intergenic
938251056 2:129816033-129816055 AAGGGGAATATGGAGGGCGAGGG + Intergenic
938536335 2:132252579-132252601 CAGAGGAGTGTTGGGGAGGAGGG + Intronic
939205867 2:139102998-139103020 CTGGGGACTGTTGAGGGGTGGGG - Intergenic
939490846 2:142874431-142874453 CAGGGATATGGTGAGGGGAAAGG + Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939890738 2:147732855-147732877 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
940059086 2:149545241-149545263 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
940413889 2:153398076-153398098 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
941337782 2:164266970-164266992 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
941534166 2:166702880-166702902 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
943181143 2:184542859-184542881 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
943287790 2:186026565-186026587 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
943593200 2:189823427-189823449 CCGGGGCCTGTTGAGGGGGTGGG - Intronic
943696480 2:190940925-190940947 TAGTGAAATGCTGAGGGGGATGG - Intronic
943775200 2:191757980-191758002 CAGGTGAAAATGGAGGGGGAGGG + Intergenic
944026949 2:195181892-195181914 CTGGGGACTGTTGTGGGGGTGGG - Intergenic
944077623 2:195749819-195749841 CTGGGGACTGTTGTGGGGAAGGG + Intronic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945185760 2:207137843-207137865 CTGGGGAAAGATGAGGGAGAGGG + Intronic
945348285 2:208746642-208746664 CTGGGGACTGTTGTGGGGGGGGG - Intronic
945780982 2:214172249-214172271 CTGGGGACTGTTGTGGGGTAGGG - Intronic
945916907 2:215713939-215713961 CAGAGGATTGGTGAGGGGTATGG - Intergenic
946621724 2:221570251-221570273 TAGGCTAATGTTGAAGGGGAGGG - Intronic
946842534 2:223832748-223832770 CAGGGAGTTGTTGAGGGTGAGGG - Intronic
947117348 2:226785897-226785919 CTGGGGACTGTTGTGGGGTAGGG - Intronic
947242838 2:228015074-228015096 CTGGGGACTGTTGTGGGGGAGGG - Intronic
947283796 2:228487001-228487023 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
947478263 2:230471866-230471888 TAGGGGAATTTTGTGGGGGAGGG + Intronic
947550049 2:231038883-231038905 CAGGAGAATGTGGAGGGAAAAGG - Intronic
947597361 2:231421524-231421546 CAGGGAGATGTAGAAGGGGATGG - Intergenic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
947864063 2:233383927-233383949 CAGGTGAATGATGGAGGGGAGGG + Intronic
948763023 2:240204283-240204305 AAGGGAAATGCTGAGAGGGAAGG - Intergenic
1168821011 20:773931-773953 CAGGAGAATGTGGAGGGGGGCGG - Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168991315 20:2098082-2098104 CAGGGGAATTTTCTGGGTGATGG - Intergenic
1169192973 20:3669510-3669532 CAGGGGGAGGTGGAGAGGGAAGG - Intronic
1169468121 20:5859272-5859294 CAGGGGAGGGGTGAGGGGCAGGG + Intronic
1169901761 20:10560242-10560264 CAGGGGACTGTAGACAGGGATGG - Intronic
1170007872 20:11688105-11688127 CAGGGGAATATTCTGGGGAAAGG - Intergenic
1170221938 20:13950615-13950637 CATGGGAGTGTTAAGGAGGATGG + Intronic
1170518277 20:17154386-17154408 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1171046976 20:21818117-21818139 CAAGGAAATTTAGAGGGGGATGG - Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171350280 20:24496915-24496937 CAGGAGGATTTTGAGGGGGAAGG - Intronic
1171511008 20:25684963-25684985 CTGGGGCATGTTGGGGGGTAGGG + Intronic
1171733706 20:28742314-28742336 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1171910167 20:30944266-30944288 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1172603957 20:36202191-36202213 CAGGAGAATGATGCGGGGGCGGG - Intronic
1172649288 20:36491634-36491656 AAGGGGTATGCTGAGGGGGTGGG + Intronic
1172767059 20:37356509-37356531 CAGGGGAGTGGTGGGGGGCAGGG + Intronic
1173359089 20:42323598-42323620 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1173670160 20:44793387-44793409 CAGATGAATGCGGAGGGGGAGGG + Intronic
1173843814 20:46175620-46175642 CTGGGGAATCTTGCAGGGGAAGG - Intronic
1174584014 20:51593427-51593449 CATGAGAAAATTGAGGGGGACGG + Intergenic
1175042226 20:56064301-56064323 CCGGGGCCTGTTGAGGGGGTGGG + Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175402559 20:58708771-58708793 CAGAAGAATGCTGAGGCGGACGG + Intronic
1175625222 20:60484010-60484032 CAGGAGAGTGGGGAGGGGGAGGG - Intergenic
1176000923 20:62830788-62830810 CAGGGGACTGTGGTGGGGGGTGG - Intronic
1176274131 20:64254329-64254351 CAGGGGAATGGTGGGAGGGGTGG + Intergenic
1176350352 21:5789467-5789489 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
1176357166 21:5910051-5910073 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
1176544673 21:8187537-8187559 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
1176563624 21:8370582-8370604 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
1177079026 21:16615306-16615328 CTGGGGACTGTTGTGGGGGGGGG + Intergenic
1177259307 21:18708379-18708401 CAGGGGCATCTTGGGTGGGAAGG + Intergenic
1177482545 21:21709499-21709521 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1177988741 21:28012127-28012149 CAGGGGAATAGAGTGGGGGAGGG - Intergenic
1178322278 21:31614736-31614758 CAGGGGAATAGGGAGGGGAAGGG + Intergenic
1178773289 21:35525809-35525831 TAGAGGAATGTTGAGAAGGAAGG - Intronic
1179264088 21:39786945-39786967 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1179902856 21:44402826-44402848 CAGGGCAGTGGTGAGGGGGTGGG + Intronic
1180183690 21:46129262-46129284 CAGGGGAATGGTCCTGGGGAAGG - Intronic
1180230394 21:46423767-46423789 GAGGGGGATGAGGAGGGGGAGGG + Intronic
1180295658 22:10932054-10932076 CAGTGGTATCTTGATGGGGATGG + Intergenic
1180510038 22:16073282-16073304 CCGGGGAATGTTGTGGGGTGGGG + Intergenic
1180964170 22:19777214-19777236 CCGGGGACTGTTGTGGGGTAGGG - Intronic
1181082379 22:20424023-20424045 CTGCGGAAGGTTGAGGGAGACGG - Intergenic
1182073947 22:27482139-27482161 CAGGGGAATTTGGAAAGGGAAGG - Intergenic
1182114917 22:27750838-27750860 TGGGGTAAGGTTGAGGGGGAAGG + Exonic
1182350001 22:29694048-29694070 CAGGGAGATGTGGAAGGGGATGG - Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1183683939 22:39350851-39350873 CAGGTGCATGCTGAGTGGGAGGG - Intronic
1183726787 22:39594366-39594388 GAGGGGAAAGGCGAGGGGGATGG + Intronic
1184118996 22:42438343-42438365 CGGGGGAACGGAGAGGGGGAGGG - Intergenic
1184428275 22:44425760-44425782 GAAGGGAATGGTGAGGAGGAAGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184677598 22:46052287-46052309 CAGGGGTGTGTGGAGTGGGAGGG - Intronic
1203249541 22_KI270733v1_random:103774-103796 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
949194807 3:1291960-1291982 CAAAGGAATGTTGAGGCTGAAGG + Intronic
949430888 3:3974448-3974470 CTGGGGACTGTTGTGGGGTAGGG - Intronic
949550691 3:5110506-5110528 CCTGGGAATGTAGATGGGGAAGG - Intergenic
949673734 3:6428657-6428679 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
949765867 3:7525102-7525124 CTGGGGACTGTTGAGGGGTGGGG + Intronic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950059888 3:10061957-10061979 CCGGGGAATGTTGTGGGGTGGGG + Intronic
950091364 3:10297567-10297589 CTGGGGACTGTTGTGGGGGGAGG - Intronic
950296614 3:11837861-11837883 TTGGAGAATCTTGAGGGGGAGGG + Intronic
950492600 3:13315009-13315031 CAGGGGCATGAGGAGGGTGAGGG + Intergenic
950654888 3:14430442-14430464 CAATGGAAAGTTGAGGGAGATGG + Intronic
951104360 3:18725736-18725758 GAGGGGGATGTGGAGGCGGAGGG + Intergenic
951363308 3:21750649-21750671 CAGGGACATGTGGAGGGGGCGGG - Intronic
951451976 3:22850374-22850396 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
951769434 3:26239234-26239256 CAGGGGACTGTTGTGGGGTTGGG - Intergenic
952157307 3:30657180-30657202 CACGGGAATGTGGAAGGGTAAGG - Intronic
952436970 3:33281198-33281220 CTGGGGCCTGTTGAGGGGTAGGG - Intronic
952558544 3:34561598-34561620 CCGGGGTCTGTTGAGGGGTAGGG + Intergenic
952565472 3:34652376-34652398 CAGGGGAAGGATGAGCGGGACGG - Intergenic
952702633 3:36342526-36342548 CAGGGGGAAGGTGAGGGAGAAGG + Intergenic
953014588 3:39061253-39061275 CTGGGGCATGTTGGGGGGTAGGG - Intronic
953015401 3:39070836-39070858 CTGGGGACTGTTGTGGGGGTGGG - Intronic
953202540 3:40790360-40790382 CAGGGGAATGTTGAGTGCTGAGG + Intergenic
953293544 3:41690278-41690300 CCGGGGACTGTTGTGGGGTAGGG + Intronic
953303491 3:41803639-41803661 CTGGGGACTGTTGTGGGGTAGGG - Intronic
953306011 3:41830133-41830155 CTGGGGACTGTTGTGGGGTAGGG + Intronic
953970340 3:47342350-47342372 CACAGGAATGTTGATGGTGAGGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954440478 3:50519113-50519135 CAGGTGACTGTGGATGGGGATGG - Intergenic
955027462 3:55183521-55183543 CAGGGGGATGTGGAGGGGTCTGG + Intergenic
955653239 3:61216981-61217003 CTGGGGACTGTTGTGGGGTAGGG + Intronic
956243268 3:67153625-67153647 CTGGGGACTGTTGCGGGGTAGGG + Intergenic
956363612 3:68475313-68475335 CAGGGGACTGTTGTGGGGTGGGG - Intronic
956411604 3:68985456-68985478 AAGAGGAAAGTTGAGGGGGGAGG - Intronic
958145796 3:89622910-89622932 CAGGGGGATGGTGGGGGGGTGGG + Intergenic
958846618 3:99272829-99272851 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
959011050 3:101076842-101076864 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
959290162 3:104463997-104464019 CTGGGGCCTGTTGAGGGGTAGGG - Intergenic
960343616 3:116505570-116505592 CTGGGGAATGTTGCAGGGTAGGG - Intronic
960544646 3:118899693-118899715 GAGGGGATTTTTGAGGGTGATGG + Intergenic
960909721 3:122637228-122637250 CAGGGGAGGGTTGGGGGAGAAGG - Intronic
961004425 3:123395378-123395400 GAGGGGGATTTTGATGGGGAGGG - Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
961146005 3:124593853-124593875 CAGGGGAATGTGGCGGGAGAGGG - Intronic
961905380 3:130257498-130257520 CAGGAGTATATTGAGGGGAAAGG - Intergenic
962081423 3:132143048-132143070 CTGGGGACTGTTGTGGGGTAGGG + Intronic
963107498 3:141659739-141659761 CTGGGGAATGTTAAGGAGAAAGG - Intergenic
963681459 3:148383294-148383316 CAGGATACTGTTGTGGGGGATGG - Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964102781 3:153006877-153006899 TGGGGGAATGTGGATGGGGAAGG - Intergenic
964294613 3:155219726-155219748 CTGGGGCCTGTTGTGGGGGATGG - Intergenic
964552726 3:157902667-157902689 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
966010556 3:175069999-175070021 CTGGGGACTGTTGTGGGGTAGGG + Intronic
966231720 3:177659515-177659537 CCGGGGACTGTTGCGGGGTAGGG - Intergenic
966238948 3:177733630-177733652 CATGGGATTGCTGAGGGGAATGG - Intergenic
966925414 3:184641427-184641449 CAGGGGCAGGTTGAGGGGAGTGG + Intronic
967152655 3:186664043-186664065 AATGGGAATGTTGAGGGGATGGG - Intronic
967847925 3:194058558-194058580 GAGGGGAGTGGGGAGGGGGACGG + Intergenic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
969172143 4:5372709-5372731 CAGGAGAAAGTTGGGGGGGGGGG + Intronic
969223476 4:5777992-5778014 CTGGGGACTGTTGTGGGGTAGGG - Intronic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
969870211 4:10099831-10099853 CAGGTGGGTGTTGCGGGGGAAGG + Intronic
970305547 4:14728176-14728198 CTGGGGACTGTTGTGGGGGAGGG + Intergenic
970893236 4:21071796-21071818 CCGGGGACTGTTGTGGGGTAGGG - Intronic
970919789 4:21380419-21380441 CTGGGGGATGATGAGGGAGAGGG + Intronic
971162189 4:24144689-24144711 AAGGGGAAAGTGGAGGGAGAAGG - Intergenic
971373997 4:26041496-26041518 TAGGGGAATTTGGAGGGTGATGG + Intergenic
972093936 4:35324839-35324861 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
972390054 4:38605856-38605878 CAGGAGACTTTTGAGGGGGTTGG - Intergenic
972845297 4:42982209-42982231 CTGGGGACTGTTGTGGGGTAGGG - Intronic
972901991 4:43696592-43696614 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
973060903 4:45722890-45722912 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
973087026 4:46077137-46077159 CTGGGGACTGTTGTGGGGTAGGG + Intronic
973554626 4:52070521-52070543 CTGGGGACTGTTGTGGGGTAGGG + Intronic
973640238 4:52895325-52895347 CTGGGGACTGTTGTGGGGTAGGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974131882 4:57766996-57767018 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
974342802 4:60636112-60636134 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974759075 4:66251568-66251590 CCGGGGACTGTTGTGGGGGGTGG + Intergenic
974798675 4:66785124-66785146 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
975139341 4:70903385-70903407 GAGGGGAACGTGGAGGGGGAAGG + Intronic
975427316 4:74245631-74245653 CTGGGGACTGTTGTGGGGTAGGG - Intronic
975456167 4:74593449-74593471 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
975536425 4:75456032-75456054 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
976177913 4:82373381-82373403 CGGGGGAATAAAGAGGGGGAGGG + Intronic
976357261 4:84132638-84132660 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
976533412 4:86183293-86183315 CTGGGGACTGTTGTGGGGTAGGG - Intronic
977291661 4:95171394-95171416 CTGGGGACTGTTGTGGGGTAGGG - Intronic
977671944 4:99705031-99705053 CTGGGGCATGTTGGGGGGCAGGG + Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977873487 4:102122364-102122386 CTGGGGAATGTTGTGGGGTGGGG - Intergenic
978027093 4:103890164-103890186 CAGGGGCATGTTGTGGGGTGGGG + Intergenic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978157394 4:105505589-105505611 GGGGGGTATGTGGAGGGGGACGG - Intergenic
978702322 4:111662613-111662635 GAGGGGGATGGGGAGGGGGAGGG + Intergenic
978971941 4:114819116-114819138 GTGGGGAGTGTTGAGGGTGATGG - Intergenic
979765992 4:124464296-124464318 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
980092327 4:128455611-128455633 GAGGGAAGTGTGGAGGGGGAAGG + Intergenic
980308298 4:131093897-131093919 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
980332239 4:131424932-131424954 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
980542595 4:134213756-134213778 CTGGGGACTGTTGTGGGGGGGGG + Intergenic
980544907 4:134246627-134246649 CAGGGGACTGTTGTGGGGAGGGG - Intergenic
980808955 4:137851102-137851124 CAGGGGCCTGTTGGGGGTGAGGG - Intergenic
980857715 4:138460021-138460043 CAGGGGACTGTTGTGGGGAGGGG - Intergenic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
981654674 4:147099892-147099914 CAAGGGAATGTGGTGGGGGATGG + Intergenic
981832607 4:149019751-149019773 CAGGAGAAAGTTGATTGGGAGGG - Intergenic
982582969 4:157202755-157202777 GAGGGGAATGTTTTGGGTGATGG + Intergenic
982648103 4:158049309-158049331 CATGGGCCTGTTGAGGGGTAGGG + Intergenic
982734153 4:158987616-158987638 CTGGGGACTGTTGTGGGGTAGGG + Intronic
983109672 4:163733609-163733631 CCGGGGACTGTTGTGGGGTAGGG - Intronic
983137845 4:164106603-164106625 CTGGGGACTGTTGTGGGGTAGGG + Intronic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
985658118 5:1142472-1142494 GAGGGGAAAGGGGAGGGGGAGGG - Intergenic
986934845 5:12870452-12870474 CAGGGGACTGTTGTGGGGTGTGG - Intergenic
986939040 5:12927324-12927346 CTGGGGCCTGTTGAGGGGGTGGG + Intergenic
987088138 5:14488043-14488065 CAGGGGGCTGCTGGGGGGGAAGG - Exonic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987447655 5:18040700-18040722 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
987561585 5:19530587-19530609 CTGGGGACTGTTGTGGGGTAGGG - Intronic
987626407 5:20406420-20406442 CCGGGGCCTGTTGTGGGGGAGGG + Intronic
987990671 5:25207409-25207431 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
988066541 5:26232943-26232965 CAGGTGACTGTTGGGGGGCAGGG - Intergenic
988210364 5:28196308-28196330 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
988217528 5:28294423-28294445 TAGTGGAGTGTTGACGGGGAAGG - Intergenic
988287759 5:29242502-29242524 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
988945908 5:36199038-36199060 CTGGGGACTGTTGTGGGGTAGGG + Intronic
989128812 5:38083679-38083701 CAGGGGAATGTCTTGGAGGAAGG - Intergenic
989941192 5:50151709-50151731 CTGGGGACTGTTGAGGGGTGGGG + Intergenic
990192839 5:53279844-53279866 CCGGGGACTGTTGTGGGGGGTGG - Intergenic
990448568 5:55915333-55915355 CCAGGGAATGTTGATGGGCATGG + Intronic
990572013 5:57088321-57088343 CAGGGGCCTGTTGGGGGTGAGGG + Intergenic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990792178 5:59494785-59494807 GAGGGGCATGTTTACGGGGAAGG - Intronic
990929121 5:61067313-61067335 CTGGGGACTGTTGTGGGGTAGGG - Intronic
991392867 5:66167157-66167179 CAGGGAAAGGCTGTGGGGGAGGG - Intronic
992133413 5:73718477-73718499 CAGGGGAGTGTTGGAGGTGAGGG + Intronic
992347600 5:75896217-75896239 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
992778166 5:80105953-80105975 CTAGGGATTGCTGAGGGGGAAGG - Intergenic
992970282 5:82049385-82049407 CTGGGGACTGTTGTGGGGGTGGG + Intronic
992990767 5:82280651-82280673 GAGGGGAATGTGGAGTTGGAGGG + Intronic
993229949 5:85221970-85221992 CTGGGGCATGTTGTGGGGTAGGG - Intergenic
993268522 5:85762229-85762251 CTGGGGACTGTTGTGGGGGGGGG + Intergenic
994317486 5:98348973-98348995 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
994329971 5:98492921-98492943 CAGGGGACTGTTGTGGGGTCGGG + Intergenic
994601652 5:101913001-101913023 CTGGGGAATGTTGTGGGGTCGGG - Intergenic
994951634 5:106471007-106471029 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
994982839 5:106899142-106899164 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
995276024 5:110278819-110278841 CTGGGGACTGTTGTGGGGTATGG - Intergenic
995304070 5:110622829-110622851 CTGGGGAATGTTGTGGGGTGTGG + Intronic
997854216 5:137358540-137358562 GAGGGGAAGGTGGAGGGGAAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998487474 5:142515742-142515764 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
998916239 5:147014721-147014743 CTGGGGACTGTTGTGGGGTAGGG + Intronic
999234742 5:150083624-150083646 CAGGGGCATGGTGTGTGGGAGGG - Intronic
999266598 5:150270726-150270748 TAGGTGAGTGTTGAGGGGGTGGG - Intronic
999647176 5:153729221-153729243 CTGGGGACTGTTGTGGGGTAGGG + Intronic
999706024 5:154273010-154273032 ATGGGGAATGCTGAGGGCGAGGG + Intronic
999836155 5:155375367-155375389 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1000308213 5:160015609-160015631 CAGGGAAAGGTAGAGGGAGAAGG - Intronic
1001740197 5:174046826-174046848 CAAGGGAGTGATGAGAGGGACGG - Exonic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002058311 5:176610914-176610936 CAGGGAAATGTGGAGGGGGTGGG - Intergenic
1002065909 5:176651545-176651567 CCGGGGAAGGATGAGGGGGGAGG + Intronic
1002398008 5:178972774-178972796 CAGGGGGAAGATGTGGGGGAAGG + Intergenic
1002448170 5:179302712-179302734 CAGAGTATTGTTGAGGGGGGCGG + Intronic
1002742658 5:181444868-181444890 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1003005268 6:2375452-2375474 CAAGGGAATGGTGAGGGAGTGGG + Intergenic
1003682274 6:8267869-8267891 CAGGGGAATATTGAGAGTGATGG - Intergenic
1003818589 6:9869175-9869197 GTGGGGAATGCTGAGGGGCAGGG - Intronic
1003990995 6:11486426-11486448 CAGGGGTATGGTAAGTGGGAAGG + Intergenic
1003991842 6:11494040-11494062 CATTGGCATGTAGAGGGGGAGGG + Intergenic
1004542285 6:16562409-16562431 AAGGGGAATGGGGAAGGGGAAGG + Intronic
1004814144 6:19294205-19294227 CAGGGGCATACTGAGTGGGAGGG + Intergenic
1005027488 6:21477318-21477340 CATGTGAATGTGGTGGGGGAGGG + Intergenic
1005321239 6:24656448-24656470 GAGGGGAATGGTGGGAGGGAGGG + Intronic
1006215047 6:32434328-32434350 CAGGGGCCTGTTGGGGGGGTGGG + Intergenic
1006234577 6:32617501-32617523 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006689030 6:35863624-35863646 GAGGGGGAGGTGGAGGGGGAGGG + Intronic
1006967055 6:37998323-37998345 CGGGGGAATTTTTAGAGGGATGG + Intronic
1007125735 6:39424103-39424125 CCTGGGAATGTTGTGGGGGATGG - Intronic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1007651932 6:43427943-43427965 GAAGGGAAAGTTGAGGGTGACGG - Intronic
1007654817 6:43445687-43445709 CAGGAGGATGTTGAGGATGAAGG - Exonic
1008194085 6:48496550-48496572 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1008504074 6:52212013-52212035 CAGGGGAATTGTAATGGGGAAGG - Intergenic
1009486839 6:64235243-64235265 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1009949345 6:70377861-70377883 CTGGGGACTGTTGAGGGGTGGGG - Intergenic
1010267577 6:73884239-73884261 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1010443856 6:75929536-75929558 CAGGGGACTGTTGTGGGGTGGGG + Intronic
1010668003 6:78652705-78652727 CCGGGGAATGTTGTGGGGTGGGG + Intergenic
1010914764 6:81602492-81602514 CTGGGGCCTGTTGAGGGGTAGGG - Intronic
1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG + Intronic
1011331530 6:86212615-86212637 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1011626797 6:89289689-89289711 AAGGGGAAGGGTGAGGAGGAGGG + Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1011852889 6:91652580-91652602 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1011950406 6:92957842-92957864 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
1012435430 6:99210265-99210287 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1012613441 6:101246131-101246153 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1012692697 6:102334901-102334923 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1012807887 6:103918016-103918038 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
1013144776 6:107377873-107377895 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1014038543 6:116797037-116797059 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1014146389 6:118002438-118002460 CTGGGGATTGTTGTGGGGTAGGG + Intronic
1014349029 6:120316091-120316113 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1014380103 6:120729299-120729321 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1014713269 6:124834241-124834263 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1015083191 6:129253369-129253391 CAGGGAAATGATGAGGGACAGGG - Intronic
1016084388 6:139894824-139894846 GAGGGGAATGGTGAGGGGACGGG + Intergenic
1016339292 6:143044383-143044405 CAGGAGCTTGTTGAGGGGGCAGG - Intergenic
1016830107 6:148425710-148425732 GAGGGGAAGGGAGAGGGGGATGG - Intronic
1017330131 6:153187883-153187905 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1017895667 6:158677394-158677416 CCGGGGAATGTTGTGGGGAGCGG + Intronic
1017981401 6:159403581-159403603 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1019028645 6:168992168-168992190 CAGGGGCACGTTGGGGGGCAGGG - Intergenic
1019247793 6:170720607-170720629 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1019560107 7:1651629-1651651 CAGGGAACTATTCAGGGGGAGGG + Intergenic
1019940797 7:4288301-4288323 CTGGGGACTGTTGAGGGGTGGGG - Intergenic
1020279789 7:6644307-6644329 CAGGGAAAGGTTCAGAGGGAAGG + Intronic
1020519924 7:9173069-9173091 AAGGGGAAGGATGAGAGGGAAGG - Intergenic
1020900473 7:13997301-13997323 TAGGGGACTGTTGGGAGGGAAGG - Intergenic
1020976739 7:15015746-15015768 AAGGAGAATGTCAAGGGGGAGGG + Intergenic
1021163562 7:17305514-17305536 CAGGGGAATGTTGAATGGAAGGG + Intronic
1021389451 7:20073774-20073796 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1022655754 7:32318339-32318361 TTGGGGAATGTTTAGAGGGAGGG - Intergenic
1022924275 7:35044323-35044345 CTGGGGAATGGTGAGAGGCAAGG - Intergenic
1022931259 7:35117281-35117303 CTGGGGACTGTTGTGGGGCAGGG + Intergenic
1023042075 7:36180852-36180874 CAGGTGCATGATGAGGGGGTGGG - Intronic
1023050123 7:36243884-36243906 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1023193774 7:37612207-37612229 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1023346494 7:39276889-39276911 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1023419269 7:39961790-39961812 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1023421229 7:39982169-39982191 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1023740662 7:43278111-43278133 CAGGGGAACATTCAGGGGCAGGG - Intronic
1023803761 7:43856651-43856673 CAGGGGCATGGTGAGGGTCAGGG + Intergenic
1024268278 7:47622893-47622915 GAGAGGAAGGTTGGGGGGGAAGG - Intergenic
1025581299 7:62721821-62721843 CCGGGGACTGTTGGGGGGGTGGG + Intergenic
1025581779 7:62728750-62728772 CTGGGGACTGTTGGGGGGGTGGG - Intergenic
1027248659 7:76384742-76384764 CAGTGGAATGCTGAGGGCTAGGG - Intergenic
1027884744 7:83890380-83890402 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1028056923 7:86256616-86256638 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1028068176 7:86414364-86414386 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1028202092 7:87973925-87973947 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1028434011 7:90780579-90780601 CTGGGGAATGTTGTGGGGTGGGG - Intronic
1028740714 7:94271251-94271273 CCGGGGACTGTTGTGGGTGAGGG + Intergenic
1029241213 7:99164475-99164497 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1029313652 7:99691280-99691302 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1029545193 7:101206803-101206825 GAGGGCAACGTTGAGGGTGAAGG + Exonic
1029611612 7:101629649-101629671 CAGGGGAATTTGGCTGGGGATGG - Intergenic
1029822582 7:103160089-103160111 CTGGGGAATGGTGAGAGGCAAGG - Intergenic
1029827162 7:103209794-103209816 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1029890974 7:103930413-103930435 CAGGGGGTTGTGGCGGGGGACGG + Intronic
1029975537 7:104829484-104829506 CCGGGGACTGTTGTGGGGTAGGG - Intronic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1031446702 7:121863999-121864021 GATGGGAATGTTGAGGAAGAAGG + Intergenic
1031826081 7:126567395-126567417 CCGGGGACTGTTGTGGGGTAGGG + Intronic
1031866085 7:127039891-127039913 GAGGGGGAAGGTGAGGGGGAAGG + Intronic
1031892534 7:127311377-127311399 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032244828 7:130202026-130202048 AAGGGGAAGGTGGAGCGGGAGGG + Exonic
1032280418 7:130495434-130495456 CAGGGGAGAGCTGAGGGGGTGGG - Exonic
1032445421 7:131978499-131978521 CTGGGGACTGTTGTGGGGGGGGG - Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034398570 7:150846459-150846481 CAGGGGCATGTGGTGGGGGCAGG - Intronic
1034412172 7:150947399-150947421 GAGGGGGATGTTGAGGAGGCTGG + Exonic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1034450701 7:151135684-151135706 CAGGGGAGTGGCCAGGGGGAGGG + Intronic
1034737667 7:153443994-153444016 CAGGGGTGTGTTCTGGGGGAAGG + Intergenic
1035500324 8:87257-87279 GAGGGGGATGGAGAGGGGGATGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1035885675 8:3288980-3289002 CCGGGGACTGTTGTGGGGTAGGG - Intronic
1035890653 8:3338989-3339011 CAGGGGACTGTTGTGGGGTGGGG - Intronic
1035982863 8:4392625-4392647 CAGGGGTTTTTTGGGGGGGAGGG + Intronic
1036022408 8:4860248-4860270 CAGGGGACTGTTGTGGGGTGGGG + Intronic
1036462416 8:8965117-8965139 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1036628319 8:10491498-10491520 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1037069514 8:14626309-14626331 CAGGAGCCTGTTGAGGGGGTTGG - Intronic
1037439090 8:18895964-18895986 CAGGGAAGTGTGGAGGGGAAGGG - Intronic
1037760406 8:21738153-21738175 GAGGGGGATGAGGAGGGGGAGGG - Intronic
1038483801 8:27919545-27919567 CAGGGGAGTGTTAAGGGTTATGG - Intronic
1038681731 8:29674845-29674867 CAGTGGAGTGTTGAAGGTGAAGG + Intergenic
1038882744 8:31632665-31632687 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1038907010 8:31916358-31916380 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1039032145 8:33322164-33322186 TAGGGAAAAGTTGAAGGGGAAGG - Intergenic
1039346739 8:36713131-36713153 CAGGGGACTGTTGTGGGGTACGG + Intergenic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039564675 8:38542512-38542534 GAGGGGAATGGAGAGGGGGAGGG - Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039977930 8:42383128-42383150 AAGGGGCATGTTGATGGGGCGGG + Intergenic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1040777439 8:51062998-51063020 CCGGGGACTGTTGTGGGGGAGGG + Intergenic
1040965876 8:53080625-53080647 CTGGGGAATGTTGTGGGGTGGGG - Intergenic
1041485934 8:58376007-58376029 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042999829 8:74744479-74744501 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1043064437 8:75549763-75549785 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1043142691 8:76609455-76609477 CTGGGTAATGTTGGTGGGGATGG + Intergenic
1043511600 8:80955514-80955536 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1043790671 8:84464295-84464317 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1044058730 8:87605714-87605736 CAGGGGGAAGGTGGGGGGGAGGG + Intronic
1044109216 8:88250931-88250953 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1044131739 8:88532217-88532239 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1044152696 8:88800979-88801001 CAGGGCAATGCAGAGGGGGAAGG + Intergenic
1044220059 8:89660201-89660223 CCGGGGAATGTTGTGGGGTGGGG - Intergenic
1044220146 8:89660958-89660980 CCGGGGAATGTTGTGGGGTGGGG + Intergenic
1044279254 8:90337414-90337436 AAGGGGGGTGTAGAGGGGGATGG - Intergenic
1044441606 8:92230775-92230797 CAGGGGGGTGTGGAGGGAGAGGG + Intergenic
1044797703 8:95921059-95921081 CTGGGGCCTGTTGAGGGGGTGGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045610655 8:103837515-103837537 CTGGGGTCTGTTGAGGGGGGAGG - Intronic
1045639939 8:104238285-104238307 CTGGGGCCTGTTGAGGGGTAGGG + Intronic
1045663653 8:104464382-104464404 AAGTGGAATGCTGTGGGGGAGGG - Intronic
1045669138 8:104527669-104527691 CTGGGGACTGTTGTGGGGTAAGG + Intronic
1045744411 8:105400417-105400439 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1045789713 8:105968326-105968348 CCGGGGACTGTTGTGGGGCAGGG + Intergenic
1045799507 8:106086237-106086259 CAGGGAAATGTTGATGCAGATGG - Intergenic
1045881524 8:107045964-107045986 GAGGGGAAAGCAGAGGGGGAAGG + Intergenic
1045957353 8:107924246-107924268 AAAAGGAATGCTGAGGGGGAGGG + Intronic
1046266593 8:111838282-111838304 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1046722804 8:117639594-117639616 CAGGGGACTGTTGTGGGGTGGGG + Intergenic
1046835899 8:118800920-118800942 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1046895991 8:119474019-119474041 CTGGGGACTGTTGAGGGGTTGGG - Intergenic
1047473426 8:125201912-125201934 CGGGGGAATGGGGTGGGGGACGG - Intronic
1047474672 8:125215195-125215217 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1047701395 8:127452702-127452724 AAGGGGAAGGGAGAGGGGGAAGG + Intergenic
1048010749 8:130453744-130453766 CAGGGGAATGAGGAAGGGAAAGG + Intergenic
1048118394 8:131550970-131550992 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1049431511 8:142567434-142567456 GAGGGGCATGGTGATGGGGAGGG - Intergenic
1049439613 8:142603128-142603150 CAGTGGAATGTTGCGTGGGATGG + Intergenic
1049615076 8:143572448-143572470 CAGGGCACTGTTGAGGGAGCAGG + Exonic
1049622406 8:143604640-143604662 CAGGTGAATCTTGTGGGGCAGGG + Exonic
1049882643 8:145077067-145077089 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1050218187 9:3353184-3353206 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1050743506 9:8849746-8849768 CAGGGCTATGGTGAGGGAGAAGG + Intronic
1051708843 9:19909319-19909341 CAGGGGCCTGTTGTGGGGGACGG + Intergenic
1051793348 9:20834286-20834308 CTGGGGTCTGTTGTGGGGGAGGG + Intronic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052197626 9:25736659-25736681 TGGGGGGATGTAGAGGGGGAGGG + Intergenic
1052478865 9:28995857-28995879 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1052554676 9:29998784-29998806 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1052776154 9:32734871-32734893 CCGGGGACTGTTGTGGGGCAGGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1054355868 9:64062271-64062293 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1055043596 9:71901700-71901722 GAGAGGAATGAAGAGGGGGATGG - Intronic
1055129379 9:72756913-72756935 CAGGGGAAAGTAGAGGGAAAGGG + Intronic
1055214017 9:73836099-73836121 CTGGGGAATGTTGTGGGGTGGGG + Intergenic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055629583 9:78210104-78210126 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1056187242 9:84147459-84147481 CAAGGAAATGCTGAGGGAGAAGG - Intergenic
1056485073 9:87047730-87047752 CTGGGGACTGTTGTGGGGGAGGG + Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1057386495 9:94609824-94609846 CAGGGGTATGTGGAGGTGGGAGG - Intronic
1057833176 9:98422765-98422787 CTGGGGACTGTTGTGGGGTAGGG - Intronic
1057844672 9:98514241-98514263 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1057884744 9:98821798-98821820 CAGAGGAGTGGGGAGGGGGAAGG - Intronic
1058049444 9:100392189-100392211 AAGGGGGATGGGGAGGGGGAGGG - Intergenic
1058330154 9:103750483-103750505 CTGGGGACTGTTGAGGGGTAGGG - Intergenic
1058509697 9:105704069-105704091 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1059349949 9:113657248-113657270 CAGGCGGATGTGGACGGGGAGGG - Intergenic
1059400336 9:114065642-114065664 CAAGGGAATGGTGAGGGTGGGGG - Intronic
1059600133 9:115768239-115768261 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1059932760 9:119277657-119277679 CAGGTGAATGCTGAGGGAAAAGG + Intronic
1060293296 9:122324347-122324369 CAGGGCAAGGTTGAGGGAGAGGG + Intergenic
1060521152 9:124294850-124294872 CAGGGGAGTGTGGAGGCTGAAGG + Intronic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1061766785 9:132886535-132886557 CAGGGGACAGGTGAGGGGTAGGG + Intronic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062552856 9:137098046-137098068 CAGGGGGATGCTGAAGGGCAAGG - Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1203465935 Un_GL000220v1:87035-87057 CTGGGGAATGTTGTTGGGGGGGG + Intergenic
1203608565 Un_KI270748v1:76087-76109 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1186065876 X:5764163-5764185 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1186070737 X:5816822-5816844 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1186179053 X:6954974-6954996 CAGTGGAATGTAGGGGGGCAGGG - Intergenic
1186390214 X:9151227-9151249 CAGGGGAATGTGATGGGGAATGG - Intronic
1186539415 X:10385042-10385064 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1186947230 X:14582220-14582242 CTGGGGACTGTTGTGGGGGTGGG - Intronic
1186971825 X:14854344-14854366 AAGGGGCATGTTAAGGAGGAAGG - Intronic
1187043746 X:15624898-15624920 CCGGGGAATGTTGTGGGGTGGGG + Intergenic
1188360903 X:29252102-29252124 CTGGGGACTGTTGTGGGGTAAGG + Intronic
1188759758 X:34013029-34013051 AAGGGGAAGGTTGAGGTGCATGG + Intergenic
1188798462 X:34496135-34496157 CAGGGGACTGTTGTGGGGTGAGG + Intergenic
1188839009 X:34991953-34991975 CTGGGGACTGTTGTGGGGTAAGG + Intergenic
1189272457 X:39760897-39760919 CAGGGGGTTGGTGAGGGGTATGG - Intergenic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1189906928 X:45770757-45770779 CAGGGGTATTTTGAGGGGATGGG - Intergenic
1190592604 X:52020178-52020200 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1190641047 X:52482883-52482905 GAGGGGAAGGGTGTGGGGGAGGG - Intergenic
1190646625 X:52529982-52530004 GAGGGGAAGGGTGTGGGGGAGGG + Intergenic
1190726191 X:53192501-53192523 CAGGGGAAGGGAGAGGGAGAAGG + Exonic
1190793442 X:53721108-53721130 GAGGGGGATGGGGAGGGGGAGGG - Intergenic
1190933946 X:54977013-54977035 CAGGAGAATTTTTAGGGTGATGG + Intronic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191255784 X:58279016-58279038 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256187 X:58280654-58280676 CAGGGGGAGGTTGAGGAGGTGGG - Intergenic
1191256396 X:58281419-58281441 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191589063 X:62860723-62860745 CATGGGTAGGTTGATGGGGATGG - Intergenic
1191757573 X:64610372-64610394 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1191767354 X:64712686-64712708 CTGGGGACTGTTGTGGGGCAGGG - Intergenic
1191928317 X:66340235-66340257 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1192004917 X:67200080-67200102 CCGGGGACTGTTGAGGGGTGGGG - Intergenic
1192041452 X:67626784-67626806 CTGGGGAATGTTGTGGGGTGGGG - Intronic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192477764 X:71458420-71458442 TAGGGGAATGGTGATGGTGATGG + Intronic
1192490695 X:71574473-71574495 CAGGAGAATTTTAAGGGTGAGGG - Exonic
1192835607 X:74795565-74795587 CAGAGGAATTTTGAGAGTGATGG + Intronic
1192844213 X:74888529-74888551 CCGGGGCATGTTGAGGGGTGAGG + Intronic
1193326793 X:80187698-80187720 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1193877820 X:86883961-86883983 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1193956642 X:87871875-87871897 CAGGGGTGTGTTGTGGGGTAGGG + Intergenic
1194556844 X:95370079-95370101 CTGGGGAATGTTGTGGGGTGGGG - Intergenic
1194636143 X:96346907-96346929 CAGGGGTAGCTTGATGGGGACGG + Intergenic
1194657453 X:96589926-96589948 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1194929199 X:99865947-99865969 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1194952311 X:100140793-100140815 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1195227317 X:102811119-102811141 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1195779931 X:108450998-108451020 CTGGGGACTGTTGAGGGGTGGGG - Intronic
1196149195 X:112353670-112353692 CCGGGGACTGTTGTGGGGTATGG + Intergenic
1196171779 X:112596105-112596127 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1196325922 X:114402414-114402436 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1196332319 X:114486812-114486834 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1196524589 X:116717412-116717434 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1196845365 X:119892936-119892958 CAGGGGAATGGAGGGTGGGAAGG - Intergenic
1197060231 X:122170586-122170608 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1197098302 X:122621460-122621482 CAGGGGCCTATTGAGGGGTAAGG + Intergenic
1197140772 X:123115201-123115223 CAGGGCAAGATTGAGGGAGAGGG - Intergenic
1197243834 X:124147973-124147995 CTGGGGACTGTTGAGGGGTGGGG + Intronic
1197292912 X:124682141-124682163 TTGGGGGATGTTGATGGGGATGG - Intronic
1197362507 X:125523131-125523153 CAGGGGAATGGATAGAGGGAGGG - Intergenic
1197636326 X:128918612-128918634 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1197659689 X:129156762-129156784 CTGGGGACTGTTGTGGGGTAGGG - Intergenic
1197847860 X:130822614-130822636 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1199013654 X:142786264-142786286 CCGGGGACTGTTGTGGGGCAGGG - Intergenic
1199017064 X:142830461-142830483 CTGGGGACTGTTGTGGGGGGCGG - Intergenic
1199386859 X:147233132-147233154 GAGGAGAAAGTAGAGGGGGAGGG - Intergenic
1199393320 X:147306767-147306789 CAAGAGAGGGTTGAGGGGGAAGG + Intergenic
1199876398 X:151932280-151932302 AAGGGGAATGGTGAGTTGGAGGG - Intergenic
1199919803 X:152387134-152387156 CTGGGGACTGTTGTGGGGTAGGG + Intronic
1199939207 X:152608294-152608316 CAGGGGACTGTTGTGGGGTGGGG - Intergenic
1200142746 X:153909999-153910021 CAGGAGGATGGTGAGGGCGATGG - Exonic
1200714891 Y:6526984-6527006 CCGGGGACTGTTGTGGGGTAGGG + Intergenic
1200772509 Y:7140095-7140117 CTGGGGACTGTTGTGGGGTAGGG + Intergenic
1200814029 Y:7513219-7513241 CAGGGGAATGGTAAGCGGGATGG + Intergenic
1200895293 Y:8369349-8369371 CCGGGGAATGTTGTGGGGTGGGG + Intergenic
1201016104 Y:9603623-9603645 CTGGGGAATGTTGTGGGGTTGGG - Intergenic
1201018932 Y:9634147-9634169 CCGGGGACTGTTGTGGGGTAGGG - Intergenic
1201546206 Y:15164845-15164867 CTGGGGAATGTTGTGGGGTTGGG + Intergenic
1201570823 Y:15412097-15412119 CTGGGGACTGTTGTGGGGGTTGG + Intergenic
1201759892 Y:17525302-17525324 CTGGGGTATGTTGAGAGGAATGG - Intergenic
1201774580 Y:17649063-17649085 CAGGGAAATGTTGTGGGGTGGGG - Intergenic
1201780363 Y:17714328-17714350 CTGGGGAATGTTGTGGGGTGGGG + Intergenic
1201821191 Y:18191664-18191686 CTGGGGAATGTTGTGGGGTGGGG - Intergenic
1201826976 Y:18256926-18256948 CAGGGAAATGTTGTGGGGTGGGG + Intergenic
1201841662 Y:18380688-18380710 CTGGGGTATGTTGAGAGGAATGG + Intergenic
1201987752 Y:19988029-19988051 CTGGGGACTGTTGTGGGGAAGGG - Intergenic
1202109019 Y:21402732-21402754 CTGGGGACTGTTGTGGGGTAGGG + Intergenic