ID: 954424802

View in Genome Browser
Species Human (GRCh38)
Location 3:50437722-50437744
Sequence GAGTTGCCCTGGGCTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954424802 Original CRISPR GAGTTGCCCTGGGCTCTCCT GGG (reversed) Intronic
900207500 1:1437893-1437915 GAGGTGCCCTGTGCTCTCTGGGG - Intronic
900250967 1:1669506-1669528 GAGTTGCCCTGGGAGCCACTCGG - Intronic
900287268 1:1907668-1907690 GGCTTGCCCTGGGGTCCCCTGGG + Intergenic
900595009 1:3476654-3476676 GAGGGGCCCTGGGCTGTCCCAGG - Intronic
900598861 1:3494549-3494571 GAGGTGCCCTGGGCTGCCATAGG - Intronic
900692418 1:3988570-3988592 TTTTTGCCCTGAGCTCTCCTGGG + Intergenic
901004763 1:6166373-6166395 CTGCAGCCCTGGGCTCTCCTGGG - Intronic
901019696 1:6249515-6249537 GCGTGGCCCTGGGCTCCGCTGGG + Exonic
902348388 1:15835659-15835681 CAGTGGCCTTGGGCTCTGCTTGG + Intergenic
903226581 1:21897192-21897214 GGGTTCCCTTGGGCTCCCCTGGG - Intronic
903872493 1:26446495-26446517 GAGACGTCCTGGGCTTTCCTTGG + Intronic
905183421 1:36179815-36179837 GGGGTGGCCTGGGCTTTCCTGGG + Intronic
907381068 1:54089588-54089610 GAGTTGCTCTGGGATATCCTGGG - Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
912449535 1:109760657-109760679 GAGTCCTCCTGGCCTCTCCTCGG + Intronic
913108640 1:115639218-115639240 GAGCTGCAGTGGGCTCTGCTCGG + Intergenic
913536201 1:119775097-119775119 GTTTTGCCCAGGCCTCTCCTGGG - Intergenic
914803714 1:150977548-150977570 GAGATGGCCTGTCCTCTCCTTGG - Intergenic
915191805 1:154157155-154157177 GAGTCTCCCTGGGCTCTGTTTGG + Intronic
915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG + Intronic
915623073 1:157098011-157098033 GAGGTGTGATGGGCTCTCCTTGG + Intronic
918111626 1:181459799-181459821 GAGATGCACAGGACTCTCCTGGG + Intronic
918319591 1:183352040-183352062 TATTTTCCCAGGGCTCTCCTGGG + Intronic
919753614 1:201053362-201053384 GCCTTGCCCAGGGCTCCCCTGGG + Intronic
919931626 1:202224908-202224930 GACTGTCCCTGGGCTCCCCTTGG - Intronic
920193115 1:204207479-204207501 GGGTGGCCATGGGCTCTTCTTGG - Intronic
920344618 1:205298364-205298386 CAGCTGCCTTGGGCCCTCCTTGG - Intergenic
922894546 1:229090026-229090048 CAGAAGCCCTGGGCTTTCCTGGG + Intergenic
923008876 1:230072756-230072778 TAGCTGCCCTGGTCTTTCCTTGG + Intronic
1063209042 10:3862094-3862116 GAGCTGCCCTCAGCGCTCCTGGG + Intergenic
1065861334 10:29874762-29874784 CAGTTGCCTTAGCCTCTCCTCGG + Intergenic
1067708072 10:48625981-48626003 GATTTGCCCAGGTCTCTCTTGGG - Intronic
1068018830 10:51554730-51554752 TAGGTGCCCAGGGCTGTCCTTGG + Intronic
1069075486 10:64034557-64034579 GACTTTCCCTCAGCTCTCCTAGG - Intergenic
1069578978 10:69552292-69552314 AAGTTCCCCTGGCCTCTCCCTGG + Intergenic
1069796125 10:71053112-71053134 GAGTGGCCCCGGGCTCCTCTGGG + Intergenic
1070726437 10:78794689-78794711 GACTTGCCCTCACCTCTCCTGGG - Intergenic
1072618630 10:97065888-97065910 GAGCTGACCTGGGCTCTCAGAGG - Intronic
1073186911 10:101620518-101620540 GGGTTGCCCTGGGCACCACTTGG - Intronic
1073319828 10:102608458-102608480 AAGTTCCCCTGGGCTTGCCTTGG - Intronic
1074055864 10:109922813-109922835 AGCCTGCCCTGGGCTCTCCTTGG - Intronic
1075071901 10:119325380-119325402 GAGTGCCACTGGGCTCCCCTGGG + Intronic
1075351243 10:121726781-121726803 GCGCTGCCCTAGGCTCACCTGGG + Intergenic
1075548777 10:123376779-123376801 GAAATGCCCTGGGCTCTCACTGG - Intergenic
1077185682 11:1234428-1234450 GCGTTGCCCTGGGTGCTGCTGGG + Intronic
1078553053 11:12293644-12293666 GAATTTCCCTGGGTGCTCCTTGG - Exonic
1079777653 11:24553895-24553917 GAGTTTCCTTGAGCTCTCTTGGG + Intronic
1081489956 11:43559554-43559576 GAGCTGACGTGGGCTCTCGTGGG - Intronic
1081612385 11:44570385-44570407 GTGTTTCCATGAGCTCTCCTGGG + Intronic
1082815615 11:57506599-57506621 CAGTGGCCCAGGGCTCTCCTGGG - Intronic
1083484515 11:62975044-62975066 GAGTTGCTGTGAGCTCTCCCCGG + Intronic
1083547633 11:63560836-63560858 CAGCTGCCCTGGGCTTGCCTAGG - Intronic
1083693907 11:64429908-64429930 GGCTTAGCCTGGGCTCTCCTTGG + Intergenic
1084547407 11:69821312-69821334 GAGTTTCCCTGGGAACTGCTGGG - Intergenic
1085101184 11:73801379-73801401 GAGCTGGCCTGACCTCTCCTGGG + Intronic
1085261379 11:75207162-75207184 GAGTGGCCATGGGCACTTCTGGG - Intergenic
1086847804 11:91773663-91773685 GAGTTCCCCTGGGAACTGCTGGG + Intergenic
1087254296 11:95937206-95937228 GTGCTGCCCTAGACTCTCCTAGG + Intergenic
1087327327 11:96739741-96739763 GAGTTGAGCTGATCTCTCCTGGG + Intergenic
1088194310 11:107258353-107258375 AAGTTACTCTGGGTTCTCCTTGG + Intergenic
1091204425 11:133809981-133810003 GAGACGCCCTGGCTTCTCCTCGG + Intergenic
1094351423 12:29530184-29530206 AGGTTTCCCTGGGGTCTCCTTGG - Intronic
1097996763 12:65896360-65896382 GATTTGCCCTGGGCTCTGATAGG + Intronic
1098296993 12:69014027-69014049 GAGGTTTCCTGGGGTCTCCTTGG - Intergenic
1100700668 12:97144476-97144498 GAATGGCCCTGCTCTCTCCTAGG + Intergenic
1101726807 12:107394883-107394905 GGGCTGCCGTTGGCTCTCCTGGG - Intronic
1101966617 12:109286596-109286618 GAGCTGCCCTGGTCTCTTCCTGG - Intronic
1102484089 12:113244369-113244391 CATTTGCCCAGGGCTCTGCTTGG + Intronic
1103480934 12:121249262-121249284 GATTTGCCCTGGGACTTCCTAGG - Intronic
1103611400 12:122126410-122126432 GAGCTGGCCTGGCCTCTCCCAGG - Intronic
1104965976 12:132509025-132509047 GCGGTGTCCTCGGCTCTCCTCGG + Intronic
1106304368 13:28496340-28496362 GAGTGGCCGGGGCCTCTCCTTGG - Intergenic
1106681658 13:32014606-32014628 GGCTTGCCCTGAGCTCTTCTTGG + Intergenic
1108162920 13:47661441-47661463 GAGTTGGCCAAGGCTCTGCTGGG - Intergenic
1120854549 14:89201509-89201531 GAGGTGCTCTGGGGTCTCTTGGG - Intronic
1122646681 14:103199105-103199127 TAGTTTCTCTGGGGTCTCCTTGG + Intergenic
1123084748 14:105712259-105712281 GAGCTGCCCTGGGCTGGGCTGGG - Intergenic
1124732567 15:32211689-32211711 AGGTTTCTCTGGGCTCTCCTTGG - Intergenic
1125672078 15:41480905-41480927 GTGTGGGCCTGGGCTCTCTTGGG + Exonic
1126696532 15:51330552-51330574 CTGTTGCCCAGGGCTCTCTTTGG - Intronic
1128155002 15:65386445-65386467 GACTTGCCCTTGGCACTCCCAGG - Intronic
1129207523 15:74045771-74045793 GAGTAGTGCTGGGCACTCCTTGG - Exonic
1129268625 15:74408141-74408163 CAGCTGCCCAGGGCTCTTCTGGG + Intergenic
1129899798 15:79137888-79137910 GAGTTGGCCTCGGCTTCCCTGGG + Intergenic
1132697576 16:1208802-1208824 GTGATGCCCTGGGCTCTGCTGGG - Intronic
1134134959 16:11671844-11671866 GAGTTTCCCGGGGCTCTGCTTGG + Intronic
1134846531 16:17445527-17445549 GAGAGGCCCCGGGCTCACCTGGG + Intronic
1135183015 16:20291704-20291726 GAGGTTTCCTGGGGTCTCCTGGG + Intergenic
1136479358 16:30532304-30532326 CCGCTGCCCTGGGCTCTCCAAGG - Exonic
1137938283 16:52656512-52656534 GAGTCTCCCTGGGCTCTGTTTGG - Intergenic
1138657834 16:58501037-58501059 GAGGTGCCCTGGGCTCCACCTGG - Intronic
1141743978 16:85913650-85913672 CAAATGCCCTGGGCTCTCTTTGG - Intronic
1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG + Intronic
1143508636 17:7383468-7383490 GAGGTGCCGTGGGCTGTCCGAGG - Exonic
1144830101 17:18126472-18126494 GCGCTGCCCTGGGGTCTCTTGGG + Intronic
1145261047 17:21355070-21355092 GAGGGGCCCTGGGCTCGGCTTGG - Intergenic
1147163335 17:38580086-38580108 CTGTTGCCCTGGGCTGCCCTTGG - Intronic
1149315789 17:55437309-55437331 GAGTTGCCACGGGCTTCCCTCGG - Intergenic
1152305551 17:79518479-79518501 GAGTTTCCCTGGGCTTGCTTAGG + Intergenic
1157084961 18:44570640-44570662 GAGTTTCCCTGGGCCATCCCAGG + Intergenic
1159250675 18:65871949-65871971 GGGTTTCACTGGGCTCGCCTAGG + Intronic
1161503865 19:4633433-4633455 GAGCTGGACTGGTCTCTCCTTGG - Intergenic
1161644149 19:5442897-5442919 GAGTTACCCCGGGCCCTGCTGGG + Intergenic
1161725738 19:5927514-5927536 GAGTCGCCCTGGGCACTGCAGGG - Intronic
1162706658 19:12560168-12560190 GGGTCGCTCTGGGCTCTCCAAGG - Intronic
1162878417 19:13638237-13638259 GAGCTCCCCTGTGCTCACCTTGG - Intergenic
1163234552 19:16023030-16023052 GGGCTTCCCTGGGCTCTCCCAGG - Intergenic
1163288501 19:16364106-16364128 GAGCTGTCCTGGGCTCTATTAGG + Intronic
1163372144 19:16907198-16907220 GAGTCACCCAGAGCTCTCCTCGG - Intronic
1166243091 19:41507373-41507395 GAGTCTCCCTGGGCTCTGTTTGG - Intergenic
1166741655 19:45118213-45118235 GAGCTCCCCTGGGCACTCATGGG - Intronic
1167243989 19:48363186-48363208 GAGCTGCCCTGGCGCCTCCTGGG - Intronic
1167269232 19:48498560-48498582 GAGGTGGCCGGGGCGCTCCTGGG + Exonic
1167595802 19:50427557-50427579 CAGGTGCCCTGGCCTCTCCCGGG + Intronic
1167755569 19:51411198-51411220 GAGCTCCTCTTGGCTCTCCTGGG + Exonic
926129812 2:10295776-10295798 GAGTTGCCCATGTCTTTCCTGGG - Intergenic
926304765 2:11629875-11629897 GAGTGGGCCTGGGGTCTTCTGGG + Intronic
927109093 2:19851484-19851506 GAGATGCCCTGGTGCCTCCTTGG - Intergenic
931147360 2:59533818-59533840 GAGAAGCCTTGGGCTCTCCTTGG - Intergenic
931257322 2:60584912-60584934 GCCTTGCCTTGGGCTCCCCTTGG + Intergenic
931434684 2:62236240-62236262 AAGCTGCCCTGGGTTCTCCTGGG + Intergenic
936522153 2:113218149-113218171 GAGGTGCCCTGTGCACCCCTTGG + Exonic
937239143 2:120449227-120449249 AAGGTGCCCTGAGCTCCCCTGGG - Intergenic
937286735 2:120758703-120758725 GAGCTGCCCTTGGGCCTCCTTGG + Intronic
937506349 2:122541531-122541553 GAGTTGCCCTGGGTGCTACAAGG + Intergenic
938575388 2:132598541-132598563 CAGTTGTCCTGGCCTCTCCATGG - Intronic
942500569 2:176586068-176586090 GAGATGGCCTGGGATCACCTGGG - Intergenic
945419167 2:209613838-209613860 GGGTTACCCTGGGCTCGTCTGGG - Intronic
946049680 2:216851940-216851962 GAGTTGGCCTAGGCTGCCCTGGG - Intergenic
946477573 2:220023408-220023430 GGGTTGCCCTGGGCTAGCCTAGG + Intergenic
947836387 2:233179007-233179029 TAGCTGCTCTGGGCTCTTCTGGG - Intronic
948875678 2:240826349-240826371 AAGCTGCCCTGGGCTGCCCTGGG - Intergenic
948953519 2:241270791-241270813 GAGTTGCCTGGCGCTGTCCTGGG - Intronic
1169964300 20:11197662-11197684 GATTTGGCCTGGGCTCTGCTGGG - Intergenic
1169978343 20:11355657-11355679 AAGTAGCCCTGGGCTTTTCTTGG + Intergenic
1170969107 20:21101937-21101959 GAGTAGCTCCGGGCTCTCCACGG + Intergenic
1171965495 20:31526990-31527012 CACATGCCCTGGGTTCTCCTTGG + Intronic
1172621148 20:36319507-36319529 GAGCTGCCCTGGGCTAGGCTAGG - Intronic
1172969554 20:38863391-38863413 GAGTGGTCCTGGGCTCTGCAGGG - Intronic
1173248868 20:41354074-41354096 GACTTGGCCTGGCCTCTCCCTGG + Intronic
1174180397 20:48670697-48670719 GATTTGCCCTTGATTCTCCTAGG + Intronic
1175912296 20:62410717-62410739 GAGCTGCCCTGGGCTCACTGTGG + Exonic
1175926479 20:62474008-62474030 GGGCGCCCCTGGGCTCTCCTGGG + Intronic
1176276916 20:64277929-64277951 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1176276939 20:64278013-64278035 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1178582874 21:33850845-33850867 GAGCTGCACTGGCTTCTCCTGGG - Intronic
1178790483 21:35695146-35695168 GAGCTGCCCCGCACTCTCCTGGG - Intronic
1179557970 21:42192720-42192742 CAGTTACCCTGCTCTCTCCTGGG + Intergenic
1181531076 22:23517858-23517880 GAGATGCCCTCTCCTCTCCTAGG + Intergenic
1184649355 22:45912589-45912611 CACTTGCCCTGGGCTCCCCCTGG - Intergenic
1185148154 22:49150320-49150342 CAGCTGGCCTGGGGTCTCCTGGG - Intergenic
1185333067 22:50260308-50260330 GAGATGCTCTGGACCCTCCTGGG - Intronic
1185375361 22:50480578-50480600 GACTTGCCCTGGGCACACCTAGG - Intergenic
950537155 3:13585263-13585285 GTGTTACCCTGACCTCTCCTAGG + Intronic
952609517 3:35191191-35191213 AATTTGCCCTGGGCTCTGCAGGG + Intergenic
953209163 3:40859038-40859060 GTGTATCCCTGGGCTCTACTTGG - Intergenic
954103809 3:48398342-48398364 ACCTTGCCCTGGCCTCTCCTAGG - Intronic
954424802 3:50437722-50437744 GAGTTGCCCTGGGCTCTCCTGGG - Intronic
954686909 3:52376034-52376056 GAGGAGCCCTGGGCTCTGGTTGG + Intronic
955355212 3:58225389-58225411 GACTTTCCCTGGTTTCTCCTGGG - Intergenic
956468381 3:69541363-69541385 GGGTTGGGCTGGGCGCTCCTGGG - Intronic
961606373 3:128098548-128098570 GAGCTGCCCTGTGCTCTACTAGG + Intronic
961719091 3:128880240-128880262 GAGAGGCGCTGGGCTCACCTGGG - Intronic
961780919 3:129319624-129319646 GTCTTGCCCTGGTCTCTGCTAGG - Intergenic
961826636 3:129602562-129602584 GAGTTGCCATTGGCTCCCCAGGG + Intronic
962532948 3:136300665-136300687 AAGTTGGGCTGGGCTCTCCCAGG + Intronic
966340978 3:178924494-178924516 GAGATGGACTGGTCTCTCCTTGG - Intergenic
966816873 3:183896669-183896691 GTATTGTCCTGGGCTGTCCTTGG - Intergenic
968947230 4:3671424-3671446 GAGATTCCCTTGGCTCTTCTGGG + Intergenic
969453843 4:7289984-7290006 GAGTTGGCCTTGGCACTCCCAGG + Intronic
970855475 4:20646075-20646097 AAGTGGCCCTGGACTCACCTTGG - Intergenic
971261386 4:25059950-25059972 GTTTTGCCCAGGGCTTTCCTGGG - Intergenic
977865426 4:102020541-102020563 GAGTTCCATTGGGCTCTCTTTGG + Intronic
982137192 4:152282777-152282799 GAGGTGACCTGGGCTCTCAGAGG - Intergenic
985525440 5:399108-399130 GAGCTCCCTCGGGCTCTCCTGGG + Intronic
985619518 5:946810-946832 GAGTGGCTCTGGGGTCCCCTTGG + Intergenic
985646409 5:1086760-1086782 GGCTGCCCCTGGGCTCTCCTGGG - Intronic
992007460 5:72491905-72491927 GAGTAGAGCTGGGCTCTCCAGGG - Intronic
992564602 5:77985390-77985412 TTGTTGCCCTGGGCTTTCCTAGG + Intergenic
997658293 5:135571374-135571396 CAGCTGCCACGGGCTCTCCTGGG - Exonic
998056524 5:139082951-139082973 GAGTTGGCCTGCTCTCTCCTGGG - Intronic
999303812 5:150507318-150507340 AGGTTGCCTTGTGCTCTCCTTGG + Intronic
1000858149 5:166425582-166425604 GACTTGCCCTGAGCTCACATTGG - Intergenic
1001246850 5:170111334-170111356 GGGTTGGCTTGGGCTCTCCCAGG - Intergenic
1001632595 5:173187237-173187259 CAGTTGCCCCAGGCTCTGCTAGG - Intergenic
1002784990 6:393445-393467 GCGGTCCCCTGGGCTCGCCTCGG - Intronic
1003182787 6:3806406-3806428 GAGTTCCCCAGGTCTCTCTTAGG - Intergenic
1003535147 6:6969976-6969998 GATTTGCCCTGGGCCTGCCTGGG + Intergenic
1007728661 6:43932514-43932536 GAGATGCCTTGGACTCTGCTTGG + Intergenic
1012979587 6:105815394-105815416 GAGGGGCAGTGGGCTCTCCTGGG + Intergenic
1017723182 6:157258643-157258665 TAGGAGCCCTGGGCTCACCTTGG + Intergenic
1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG + Intergenic
1019363663 7:619218-619240 GATCTGGCCTGGCCTCTCCTTGG - Intronic
1019390477 7:783921-783943 GAGATGCCCTGTGCAGTCCTGGG - Intronic
1019624435 7:2008886-2008908 GAGTGGGCTTGGCCTCTCCTGGG - Intronic
1019925146 7:4186779-4186801 GAGGTGCCTTGGAATCTCCTGGG + Intronic
1021568785 7:22043342-22043364 GAGATGCTCTGGGTTCACCTAGG - Intergenic
1022149204 7:27582353-27582375 GGGCTGCCCTGGTCTCTGCTGGG + Intronic
1022518217 7:30988895-30988917 GCGTGGCCCTTGGCTCTGCTGGG + Intronic
1022891202 7:34701622-34701644 GAATTTCCCTGTACTCTCCTAGG - Intronic
1023080887 7:36525096-36525118 GACCTGACCTGGACTCTCCTGGG + Intronic
1024630442 7:51242893-51242915 CGGTTACCCTGGGCTTTCCTCGG - Intronic
1024962734 7:54994582-54994604 CATTTGCCCAGGGCTCTCCCAGG + Intergenic
1028963768 7:96778718-96778740 GAGCTGCCCTGTGCTCTGCAAGG - Intergenic
1029490807 7:100868862-100868884 CAGTTCCCCAGGGCTCACCTGGG - Exonic
1030143342 7:106327724-106327746 CAGCAGCCCTGAGCTCTCCTGGG + Intergenic
1031304184 7:120103349-120103371 AAGTTTCCCTGGGGTCCCCTTGG + Intergenic
1031426781 7:121615156-121615178 AAGCTGGCCTGGGCTCTCTTTGG + Intergenic
1031959292 7:127974437-127974459 GGGTTGGCCTGGGCTCCCTTTGG + Intronic
1032858539 7:135857483-135857505 GGGTTGCTCAGGGATCTCCTAGG + Intergenic
1034359293 7:150480053-150480075 GAGTTGGCCTGGGCTTTGCCAGG - Intergenic
1034974553 7:155440205-155440227 GTGATGCCCTGGCCTCTCCACGG - Intergenic
1035406845 7:158604262-158604284 GAGGTCCCCTGGGCTCCTCTGGG - Intergenic
1037430562 8:18808772-18808794 GGGTTGCGATGGGCTCTTCTTGG - Intronic
1040303827 8:46201906-46201928 GAAGTCCCCTGGGCTGTCCTGGG + Intergenic
1042722838 8:71843583-71843605 GAGATACCCAGGGCGCTCCTGGG - Intronic
1047398671 8:124527613-124527635 GAGTTTTTCTGGGGTCTCCTTGG + Intronic
1047407026 8:124594211-124594233 GAGAAGCCTTGGGCTTTCCTGGG - Intronic
1047514781 8:125544687-125544709 GACCTGCTCTGGGCTTTCCTGGG + Intergenic
1048122735 8:131599845-131599867 GAGAATCCCTGGGCTTTCCTGGG - Intergenic
1048971058 8:139645204-139645226 GAGGTGCCCTGGGTCTTCCTCGG - Intronic
1049208496 8:141374547-141374569 GACTTGCCCAGGGCTCCCCTGGG - Intergenic
1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG + Intergenic
1049339591 8:142105008-142105030 CATTTGCCCTGGGCTGTCCTGGG + Intergenic
1049446042 8:142632136-142632158 GAGTGCCCCTGGGCCCCCCTGGG - Intergenic
1049518830 8:143077932-143077954 GAGGTGGCCTTGCCTCTCCTGGG + Intergenic
1056887047 9:90453181-90453203 CAGTTGCCCTGAGCACACCTGGG - Intergenic
1057148024 9:92771501-92771523 GTCTTGCCCGGGCCTCTCCTGGG + Intergenic
1060059196 9:120444022-120444044 GAGAGGCCCTAGGGTCTCCTGGG + Intronic
1061111557 9:128575734-128575756 AAGCTTCCCTGGGCTCTCTTGGG + Intronic
1061318402 9:129812462-129812484 TAGGTGCCCTGGGCTGCCCTAGG + Intergenic
1061371822 9:130201703-130201725 GAGTGGCCCTGGAGGCTCCTGGG - Intronic
1061799203 9:133104983-133105005 GACTTGCCCTGGGCCCCCCAGGG + Intronic
1061872968 9:133530393-133530415 CTGCTGCTCTGGGCTCTCCTGGG + Intergenic
1062158964 9:135069388-135069410 GAGTTGGGCTGGGCCTTCCTCGG + Intergenic
1062260813 9:135662440-135662462 GTTTTGCCCAGGCCTCTCCTGGG + Intergenic
1062279716 9:135746560-135746582 GCGTCCCCCTGGGCTCCCCTTGG - Intronic
1062293959 9:135813835-135813857 TGGATGCCCTGAGCTCTCCTTGG - Intronic
1062371769 9:136242939-136242961 AGGTTGCCCTGGGGTCTCCTTGG - Intronic
1185738737 X:2513279-2513301 GTTTTGCCCGGGGCTTTCCTGGG - Intergenic
1186182754 X:6988811-6988833 GTTTTGCCCAGGCCTCTCCTGGG - Intergenic
1186220641 X:7345631-7345653 GTTTTGCCCAGGCCTCTCCTGGG - Intronic
1189180416 X:38999236-38999258 GTGTTGACCTGGGTCCTCCTGGG + Intergenic
1189226890 X:39420543-39420565 GCCCTGCCCTGGGCTCTCCCAGG + Intergenic
1193150316 X:78118128-78118150 GGGTCGCTCTGGGCTCTCCAAGG - Exonic
1200388475 X:155918053-155918075 GAGCTGCGGTGGGCTCTCCCCGG + Intronic
1201416325 Y:13752138-13752160 GAGCTGACCTGGCTTCTCCTGGG + Intergenic
1201633391 Y:16094928-16094950 GTTTTGCCCAGGCCTCTCCTGGG - Intergenic