ID: 954426357

View in Genome Browser
Species Human (GRCh38)
Location 3:50445275-50445297
Sequence CCTGGTTCAGAGTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954426357_954426363 -1 Left 954426357 3:50445275-50445297 CCCACAGTGGACTCTGAACCAGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 954426363 3:50445297-50445319 GGTCCCAGGAGAGCCCAGCTAGG 0: 1
1: 0
2: 7
3: 42
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954426357 Original CRISPR CCTGGTTCAGAGTCCACTGT GGG (reversed) Intronic