ID: 954427735

View in Genome Browser
Species Human (GRCh38)
Location 3:50452208-50452230
Sequence GCTGTCTGTGGAATTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954427723_954427735 18 Left 954427723 3:50452167-50452189 CCTCAATGGGGACAGCTCTGATG 0: 1
1: 0
2: 2
3: 15
4: 155
Right 954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 196
954427721_954427735 25 Left 954427721 3:50452160-50452182 CCCTTGGCCTCAATGGGGACAGC 0: 1
1: 0
2: 0
3: 18
4: 194
Right 954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 196
954427722_954427735 24 Left 954427722 3:50452161-50452183 CCTTGGCCTCAATGGGGACAGCT 0: 1
1: 0
2: 2
3: 23
4: 182
Right 954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 196
954427728_954427735 -7 Left 954427728 3:50452192-50452214 CCAGCCCACCTCCAGGGCTGTCT 0: 1
1: 1
2: 4
3: 54
4: 495
Right 954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954427735 Original CRISPR GCTGTCTGTGGAATTGGCTC AGG Intronic
900428375 1:2590766-2590788 GGTGTCTGTGGAGGGGGCTCCGG + Exonic
901828388 1:11877760-11877782 GCTGCCTGCGGAAGTTGCTCTGG - Intergenic
902275166 1:15334425-15334447 GCTTTCTGTGGTTATGGCTCAGG - Intronic
906102685 1:43273163-43273185 GCTGTCTGTGGGCATTGCTCTGG + Exonic
906231591 1:44169369-44169391 GCTGTCAGTGGCAGTGGCCCTGG + Intergenic
907241763 1:53084923-53084945 GCTGTCTGTGGCATAGGCTTTGG - Exonic
907300731 1:53484987-53485009 GCTGTCTGCTGAGCTGGCTCTGG + Intergenic
910602918 1:89050702-89050724 GCTGTCGGTGGCAGTGGCCCCGG - Intergenic
912448419 1:109754791-109754813 ACTGTCTGTGGGAATAGCTCTGG - Intronic
915018844 1:152761014-152761036 GCCGGCAGGGGAATTGGCTCTGG - Exonic
916046849 1:161006182-161006204 GCTGTCTGTGGGATAGGCTGAGG + Intronic
917670293 1:177267431-177267453 GCTTGCTGTGGAGTTGACTCTGG + Intronic
917982214 1:180277095-180277117 GCTTTCTGGGGAGGTGGCTCTGG - Exonic
919920270 1:202163116-202163138 GCTGGCTGGGGAAGTGGGTCTGG + Intergenic
921818823 1:219593743-219593765 GCTTCCTGTGGAGTTGGCTAAGG - Intergenic
921895133 1:220391748-220391770 TTTGTCTGTGGAGTTGGCCCAGG - Intergenic
922823544 1:228501567-228501589 GCTGCCGCTGGACTTGGCTCAGG + Intergenic
1063149071 10:3320549-3320571 GCTGTCTGTGGAATTAGGGTGGG + Intergenic
1065503014 10:26400337-26400359 GCTCCCTGTGGAGTTGGCTGAGG - Intergenic
1065626452 10:27634352-27634374 GCTTTCTGTGGGTTTGGCTGAGG + Intergenic
1065762202 10:28992770-28992792 GTTGTCTTTGGAACTGGCTTAGG + Intergenic
1071302965 10:84270717-84270739 GCTGTCTGTGGCACTGGCCAGGG - Intergenic
1073178931 10:101572442-101572464 AGTTTCTGTGGCATTGGCTCAGG - Intronic
1079350037 11:19684675-19684697 GGTGTCTGTGGGGTTGGCACTGG - Intronic
1079496345 11:21049044-21049066 GCTTCCTGTGGAACTGGCTGAGG - Intronic
1083868252 11:65470479-65470501 GGTGTCTGTGTCCTTGGCTCAGG - Intergenic
1084153071 11:67300137-67300159 GCTGGCTGGGGACTTGCCTCGGG + Intronic
1087291002 11:96320457-96320479 GCTGACTCTGGAAATGGCTCTGG + Intronic
1089349678 11:117815318-117815340 TCTGTCTCTGGACTTGGCTTTGG - Intronic
1091787359 12:3251170-3251192 GCTGTCTTTGGAGATGGCTGGGG + Intronic
1092061822 12:5557415-5557437 GCTTTCTGTGGGATTGGCTGAGG - Intronic
1093527785 12:20122871-20122893 GATGTGAGTGGAAGTGGCTCTGG - Intergenic
1094634924 12:32216834-32216856 GCTGACAGTGGTGTTGGCTCAGG + Intronic
1094734774 12:33222581-33222603 GCTGGAGGTGGTATTGGCTCAGG + Intergenic
1096489499 12:52006169-52006191 GCTTACTGTGGACTTGACTCAGG - Intergenic
1096552898 12:52385239-52385261 GCTGGCAGTGGCATTGGCTATGG - Exonic
1097853212 12:64434563-64434585 GTTTTCTGTGCAATTGGATCTGG - Exonic
1098892422 12:76023202-76023224 GCTGCCTGTGGAATTGGCAGAGG - Intergenic
1099903426 12:88741389-88741411 GTTGTCTATGAAATTGTCTCAGG - Intergenic
1101442818 12:104716159-104716181 GATGTCTGCGACATTGGCTCTGG - Intronic
1102825978 12:115948243-115948265 GCTCTCTGTGGAGATGACTCTGG + Intergenic
1103988897 12:124785191-124785213 GCTGGCTGGGGAATGGGCCCCGG - Intronic
1104287069 12:127433046-127433068 GTTGTCAGTGAAATGGGCTCAGG + Intergenic
1107922161 13:45220430-45220452 GCTGTGTGAGAAATTGGCACAGG + Intronic
1109682969 13:65776815-65776837 GATACCTGTGGAATTGGCTGAGG - Intergenic
1127166443 15:56248852-56248874 CCTCACTGTGGGATTGGCTCTGG - Intronic
1128353327 15:66906639-66906661 CCTGGCCTTGGAATTGGCTCTGG - Intergenic
1130902406 15:88216841-88216863 GTTGACTGTGGAATAGCCTCAGG + Intronic
1131322567 15:91408853-91408875 GCTATGTCTGGAATTGGCTCAGG + Intergenic
1133112184 16:3554685-3554707 GCTGTCTGTGGAATATGGTCTGG + Intronic
1133164775 16:3938867-3938889 GCGGTCTGTGCAATTGGCCCCGG + Intergenic
1134070480 16:11256768-11256790 GCGGTCTCTGGTCTTGGCTCGGG + Intronic
1138738489 16:59280107-59280129 GCTGTCAGTGGCAGTGGCCCCGG - Intergenic
1141715869 16:85726541-85726563 CCTGTCTGTAAAATGGGCTCAGG - Intronic
1142312559 16:89322592-89322614 CCTGTCTTTGGAATTGGAGCTGG - Intronic
1142614611 17:1127142-1127164 GCTGAATGGGGCATTGGCTCAGG - Intronic
1143744940 17:8986068-8986090 GTTGTAAGTGGAATTTGCTCAGG + Intergenic
1144717622 17:17445423-17445445 GCTGTCTGTGGGAGGGGCCCAGG - Intergenic
1145774914 17:27520993-27521015 GCAGTCTGTGGAATGGGGCCCGG + Intronic
1146401791 17:32505346-32505368 TCTGTCTGTGGAATTGTATTCGG - Intronic
1149102499 17:52922893-52922915 GCTGGCTTAGGACTTGGCTCAGG - Intergenic
1149617556 17:58013967-58013989 GATGTCTATGGTATTGGCTTTGG - Intergenic
1150361633 17:64540160-64540182 GCAGTCTGTGGGATTGGCAAGGG - Intronic
1151947223 17:77326238-77326260 GCTCCCTGTGGACTTGGCGCTGG + Intronic
1152408230 17:80109366-80109388 TCTGGCTGTGGGACTGGCTCAGG - Intergenic
1154036115 18:10804026-10804048 GCTGTCTAGGGAACTGCCTCAGG - Intronic
1155054911 18:22173988-22174010 CCTGTGTGTGGAATGGGATCGGG + Intronic
1155438946 18:25841720-25841742 GCTTTAGGTAGAATTGGCTCAGG - Intergenic
1156136052 18:34039353-34039375 GCTGCCTGTGGAATTTGCAGGGG - Intronic
1156760099 18:40578325-40578347 GCTGTCTGTAGTATTTTCTCAGG - Intergenic
1157099751 18:44718732-44718754 GCTGTCTGTAGTTCTGGCTCTGG + Intronic
1158539867 18:58343295-58343317 GCTGTCTTTGGTATTGGTGCTGG + Intronic
1159920020 18:74219814-74219836 GCTGTCTGTGGCACTGTCCCAGG - Intergenic
1160936518 19:1598740-1598762 GCTGGCTGCGGAAGTGGCCCAGG + Intronic
1161083288 19:2322016-2322038 GCTGTCTGTGGAGCTGCCACTGG - Intronic
1161687052 19:5708092-5708114 GCTGTTGGTGGCATTGGCTGGGG - Intronic
1164282800 19:23783682-23783704 GCTCTCTGTGGGAAGGGCTCAGG - Intronic
1164293636 19:23889637-23889659 GCCCTCTGTGGAAGGGGCTCAGG - Intergenic
1164937988 19:32229805-32229827 GCTGTCTCTGGGATGGGCTGTGG - Intergenic
1165295050 19:34919997-34920019 GCTTCCTGTGGGATTGGCTGAGG - Intergenic
1166792261 19:45405226-45405248 CCTGTCTGTGAAATGGACTCTGG - Intronic
1167983927 19:53299388-53299410 GCTGTCTGTGCAGTCGCCTCGGG + Intergenic
925703872 2:6665753-6665775 GCTGCCAGTGGGCTTGGCTCAGG - Intergenic
926934001 2:18068308-18068330 GCAGTGTGTGGAAATGGATCGGG + Intronic
927173029 2:20386505-20386527 GCTGGCTGTATGATTGGCTCTGG + Intergenic
928242189 2:29596286-29596308 CCTGTCTGTGAAAATGACTCTGG + Intronic
931044602 2:58336700-58336722 GTGGCCTCTGGAATTGGCTCAGG - Intergenic
934663117 2:96153648-96153670 GCTGTCTGAGAAATGGACTCGGG - Intergenic
935367932 2:102314369-102314391 TGAGTCTGTGGGATTGGCTCTGG + Intronic
936071966 2:109377046-109377068 GCTGCCTTTGGATTTGGCTTGGG + Intronic
942543173 2:177035728-177035750 GCTGCCTGTGCACTTGGCTCAGG + Intergenic
943855857 2:192789275-192789297 GCTGTCTTTGAAATGGGCTAGGG + Intergenic
945472315 2:210241162-210241184 GCTCCCTGTGGGATTGGCTGAGG - Intergenic
948187210 2:236030827-236030849 CCTGACTGTGAAATTGGTTCTGG - Intronic
1169701718 20:8454414-8454436 GCTATGTGGGGAATTGACTCTGG + Intronic
1169745710 20:8940568-8940590 GCTGTCAGTGGACTTAGCTAGGG + Intronic
1170395664 20:15922639-15922661 GCAGTCAGTGAAATTTGCTCAGG - Intronic
1172763297 20:37336792-37336814 GCTGTCTGTGGCCTTGGCTCAGG + Intergenic
1173739537 20:45388414-45388436 GCTCTATGTGGAATCGGATCCGG - Intronic
1175279688 20:57794767-57794789 GCCGCCTGTGGAGTTGGCTGAGG + Intergenic
1176121538 20:63456351-63456373 GCTGGCTGTGGGACTGACTCGGG - Intronic
1177043836 21:16145720-16145742 GCTGGAGGTGGTATTGGCTCGGG + Intergenic
1179292368 21:40029832-40029854 ACTGCCTGAGGACTTGGCTCAGG + Intronic
1179816305 21:43908505-43908527 CCTGTCTGTGAAATGGGCACAGG + Intronic
1180936921 22:19631968-19631990 TCTGTCTTTGTAACTGGCTCTGG + Intergenic
1182301328 22:29338891-29338913 CTCGGCTGTGGAATTGGCTCAGG - Intronic
1183426348 22:37741412-37741434 GATGTTTGTGAAACTGGCTCAGG - Intronic
950239041 3:11351411-11351433 GCTGTCTGTGCAAATGCCTGAGG + Intronic
950243147 3:11389814-11389836 GGTGTCTTTGTAATTGACTCTGG + Intronic
950479474 3:13235625-13235647 GCTGCCTGTGGACATTGCTCTGG + Intergenic
951686829 3:25353847-25353869 GCTGTCTGTGGAATTCTTTTAGG + Intronic
952160601 3:30689569-30689591 TCTGTCTGCTGAAGTGGCTCTGG - Intronic
952431914 3:33232041-33232063 GTTGTGTGGGGACTTGGCTCTGG - Intergenic
953205439 3:40823675-40823697 GCTTTCTGTGGAATTGGCTGGGG - Intergenic
953758781 3:45670451-45670473 GCTCTGTGTGGCATTGGCTGGGG + Intronic
954046874 3:47939122-47939144 GGTGGCTTTGGAATTGGATCAGG - Intronic
954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG + Intronic
954448224 3:50557874-50557896 GCCGTCTGAGGAAATGCCTCTGG - Intergenic
957306055 3:78460131-78460153 GCTGTCTTTGGGGATGGCTCTGG + Intergenic
958034483 3:88153427-88153449 TCTGTCTTTGTAACTGGCTCTGG - Exonic
958332568 3:92508846-92508868 GTTGTCTGTGGAATTTGCAAGGG + Intergenic
959421662 3:106136044-106136066 GCTGGTTGTGGTCTTGGCTCGGG - Intergenic
960753472 3:120982594-120982616 GCTCTCTGTCGAAGTGGCTTTGG + Intronic
961192048 3:124970215-124970237 GCTGCCTATGGAAGTGTCTCGGG + Exonic
962144995 3:132831576-132831598 GCTGACTGTGGAAATGCCTGTGG - Intergenic
963771532 3:149391159-149391181 GCTGTCTGTGGGGTTGGCCGAGG + Intergenic
965835050 3:172842143-172842165 GCTGGCTGTGGAAATGGTTTTGG - Intergenic
966438651 3:179918862-179918884 GCTGTCTGTGGATGTGTCACAGG - Intronic
967980279 3:195061305-195061327 GCTCTCTGTGGGACTGGCTGAGG + Intergenic
969340755 4:6539411-6539433 CCAGTCTGTGGACTTTGCTCTGG + Intronic
973683891 4:53349862-53349884 GGTTTCTGTGGAAGTGGCACAGG + Intronic
974879607 4:67738463-67738485 TCTGTCTTAGGAATTGCCTCAGG - Intergenic
975446527 4:74471915-74471937 GCTGTCTGAGAAATGGGCTGTGG + Intergenic
976195367 4:82526953-82526975 GCTGACAGTGGAATCGGTTCTGG - Intronic
976681982 4:87767759-87767781 GCTCCCTGTGGAATCGGCTGAGG + Intergenic
977397981 4:96494848-96494870 GCTGTCAGTGGAAGTGTCCCTGG - Intergenic
981365846 4:143902291-143902313 GCTGTCTATTTAATTGGCACAGG - Intronic
982206693 4:153001903-153001925 GTGGCCTGTGGAATTGGCACTGG + Intergenic
983909856 4:173225899-173225921 GCTCTCTGTGGGGTTGGTTCAGG - Intronic
985864460 5:2503330-2503352 GCTGTGTGTGGCATTGCCTCCGG - Intergenic
986076274 5:4340937-4340959 GCTGCCTGTGGATTTTACTCAGG - Intergenic
986563944 5:9091789-9091811 GTTGTCATTGGAATTGGCTGAGG - Intronic
987474027 5:18368823-18368845 CCTGCCAGTGGCATTGGCTCTGG - Intergenic
992826555 5:80554887-80554909 GATGTTTGGGGAATGGGCTCTGG + Intergenic
995432299 5:112094161-112094183 ACTGTCTGTGGATTTGTTTCTGG - Intergenic
995824043 5:116272825-116272847 GATGTCTGTGGTGTTGGCTCTGG + Intronic
998890630 5:146742034-146742056 TCTGTCTGTGTAATGGGCTCTGG + Intronic
999336256 5:150719623-150719645 GCTGTGTGTGTATTTGGCACAGG - Intronic
999728545 5:154457591-154457613 GCTTTCTGTGGAATGGGGACAGG + Exonic
1001138560 5:169123495-169123517 GATGTCTGTGGCATTGGCTATGG - Intronic
1002067118 5:176657377-176657399 GCTGTGTGAGGCAGTGGCTCAGG - Intronic
1003418051 6:5930511-5930533 GCTCTCTGTGGAATTAACTGTGG + Intergenic
1004422964 6:15488017-15488039 GCAGTCTGTGGAACTGGGTGTGG + Intronic
1009566859 6:65320915-65320937 GCTTCCTGTGGAGTTGGCTAAGG + Intronic
1017024552 6:150169984-150170006 GCTGTATGGGGACTGGGCTCTGG + Intronic
1017625940 6:156348790-156348812 GCTATCAGTGGAATGGGCTTTGG + Intergenic
1017881476 6:158565498-158565520 GCTGTCTGTGGCTCTGGCTTTGG - Intronic
1019169895 6:170127401-170127423 GGTGTCTGGGGGATTGGCTGGGG - Intergenic
1019615419 7:1957377-1957399 GGTGTCGGTGGAGTGGGCTCTGG - Intronic
1021793541 7:24229871-24229893 GCTGTCTGAGCAATTGGTACAGG + Intergenic
1022426935 7:30278020-30278042 GCTGTATGTTGAATTTGCACAGG - Intergenic
1022671707 7:32462088-32462110 GTTGCCTGTGGAATGGGTTCTGG - Intergenic
1023294490 7:38700791-38700813 GAAGTCTTTGGAACTGGCTCTGG - Intergenic
1023718804 7:43072172-43072194 GCTGGCTTAGGAATGGGCTCAGG - Intergenic
1025119727 7:56291048-56291070 GTTTTCTGTGCAATTGGATCTGG - Intergenic
1027590659 7:80114678-80114700 GCTGTATTTGGAAGTGGTTCTGG + Intergenic
1027934615 7:84587104-84587126 ACTGTCTGTAGGATTGGCCCTGG + Intergenic
1031616658 7:123889596-123889618 GCTGTCTTTGGAGGTGGTTCTGG + Intergenic
1033742444 7:144285173-144285195 GGTGCCTGTGGAGTTGGCTGGGG + Intergenic
1033751458 7:144364441-144364463 GGTGCCTGTGGAGTTGGCTGGGG - Exonic
1034557255 7:151858093-151858115 GCTGACTGTGGAAGAGGCTGGGG - Intronic
1036010244 8:4713736-4713758 CCTGTCCGTGGAGTTGCCTCAGG - Intronic
1037567879 8:20132777-20132799 GCTGTCTGGGTAAGTGACTCTGG + Intergenic
1038044210 8:23752561-23752583 TCTGTGTGTGGATTTGGGTCTGG - Intergenic
1039909861 8:41817874-41817896 GCTGTCTTTGGGAGTGGCCCTGG - Intronic
1044154229 8:88823638-88823660 ACTGTCTGTGGAAGTGGCCCTGG - Intergenic
1045963429 8:107996170-107996192 GCTGTGTGAGGAAATGGCTATGG + Intronic
1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG + Intergenic
1047021185 8:120776448-120776470 GGAGTCTGTAGAAATGGCTCAGG - Intronic
1047173681 8:122520095-122520117 GCTGTCTCTGGCAATGGCTATGG - Intergenic
1047269086 8:123337761-123337783 GCTGTCAGTGATCTTGGCTCAGG + Exonic
1048008944 8:130441425-130441447 GCTGTATCTGGCATGGGCTCCGG - Intronic
1048661445 8:136607131-136607153 GCTGCCTGTGGAGTTGGCTGAGG - Intergenic
1049004613 8:139846804-139846826 GCTGTCTGTGGAGGAGGCCCAGG + Intronic
1049342712 8:142121838-142121860 GCTGCCCGTGGGATTGGCTTTGG - Intergenic
1049666762 8:143847789-143847811 GCTGTCTGTGGAACCTCCTCTGG + Intergenic
1051621002 9:19049433-19049455 GCTGTCAGTGGCAACGGCTCGGG - Exonic
1057903501 9:98967199-98967221 GCTTTCTGTGAAACTGGCCCTGG + Intronic
1059437551 9:114285687-114285709 GCTTCCTGTGGAATCGGCTGGGG - Intronic
1062105255 9:134751598-134751620 GTTTTCTGTAGACTTGGCTCCGG + Intronic
1062255374 9:135618337-135618359 GCTGGCTGGGCACTTGGCTCAGG - Intergenic
1062343353 9:136103596-136103618 GGTGCCTGTGGAACTGGCTCAGG + Intergenic
1185766583 X:2730500-2730522 CCTTTCTGAAGAATTGGCTCAGG + Intronic
1185947694 X:4396078-4396100 CTTGTCTGTGAAAATGGCTCAGG + Intergenic
1186720127 X:12295292-12295314 GCTGACTGTTGAATTGCATCAGG + Intronic
1187079490 X:15971948-15971970 ACTGTCTTTGGGAGTGGCTCTGG - Intergenic
1188527187 X:31099414-31099436 GCTCCCTGTGGAATTGGATGAGG - Intronic
1189725744 X:43966681-43966703 GCTGGCTGTGGTATGGCCTCAGG + Intronic
1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193536747 X:82726722-82726744 GCTGTCTCTGTAAGTGACTCAGG - Intergenic
1194088224 X:89555042-89555064 ATTGTCTTTGGAAGTGGCTCTGG + Intergenic
1195743637 X:108091790-108091812 GTTGCCGGTGGAATTGGCCCAGG + Exonic
1199673347 X:150164697-150164719 CCTGTCTGTGGAAATGCATCAGG - Intergenic
1200549275 Y:4558599-4558621 GCAGTCTGGGGTATTGCCTCAGG + Intergenic
1200858379 Y:7963562-7963584 GATTTCTGTGGGAATGGCTCAGG + Intergenic
1201893378 Y:18967580-18967602 GCAGTCTATGGAAATGGCACTGG - Intergenic
1202195568 Y:22296117-22296139 GACGTCTGGGGAATTGGCTTTGG + Intergenic
1202260827 Y:22968620-22968642 GATGTCTGTGGGAATGGCACAGG - Intergenic
1202270804 Y:23072419-23072441 GATGTCTGCGGAAATGGCGCAGG - Intergenic
1202295222 Y:23348263-23348285 GATGTCTGCGGAAATGGCGCAGG + Intergenic
1202413815 Y:24602361-24602383 GATGTCTGTGGGAATGGCACAGG - Intergenic
1202423799 Y:24706163-24706185 GATGTCTGCGGAAATGGCGCAGG - Intergenic
1202446990 Y:24963922-24963944 GATGTCTGCGGAAATGGCGCAGG + Intergenic
1202456970 Y:25067725-25067747 GATGTCTGTGGGAATGGCACAGG + Intergenic