ID: 954428711

View in Genome Browser
Species Human (GRCh38)
Location 3:50457857-50457879
Sequence GTGATGATGGGGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 545}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954428700_954428711 20 Left 954428700 3:50457814-50457836 CCCTCCTACTCCCTCAGCTTCAG 0: 1
1: 1
2: 4
3: 67
4: 1052
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545
954428702_954428711 16 Left 954428702 3:50457818-50457840 CCTACTCCCTCAGCTTCAGAAGA 0: 1
1: 0
2: 2
3: 49
4: 434
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545
954428703_954428711 10 Left 954428703 3:50457824-50457846 CCCTCAGCTTCAGAAGAAGCTCA 0: 1
1: 0
2: 1
3: 24
4: 254
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545
954428701_954428711 19 Left 954428701 3:50457815-50457837 CCTCCTACTCCCTCAGCTTCAGA 0: 1
1: 0
2: 5
3: 47
4: 413
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545
954428704_954428711 9 Left 954428704 3:50457825-50457847 CCTCAGCTTCAGAAGAAGCTCAA 0: 1
1: 0
2: 0
3: 28
4: 344
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545
954428699_954428711 23 Left 954428699 3:50457811-50457833 CCACCCTCCTACTCCCTCAGCTT 0: 1
1: 0
2: 8
3: 81
4: 867
Right 954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954428711 Original CRISPR GTGATGATGGGGACTGAGGA GGG Intronic
900140149 1:1136437-1136459 GTGAGGGTGGGGACTGGGGACGG + Intergenic
900984526 1:6065741-6065763 TTGAGGGTGGGGACAGAGGAAGG + Intronic
901036189 1:6337661-6337683 GGGATGATGGGGAGAGAGGCAGG - Intronic
901963587 1:12847562-12847584 GTGAAGATGGAGTCTGAGGGGGG - Exonic
901984311 1:13062030-13062052 GTGAAGATGGAGTCTGAGGGGGG + Exonic
901997499 1:13164740-13164762 GTGAAGATGGAGTCTGAGGGGGG - Exonic
902512099 1:16972123-16972145 GTGATGATGGGGATAAAGAATGG + Intronic
903240720 1:21980975-21980997 GTGATGATGGGGAAGGAGGGAGG + Intronic
903244460 1:22005598-22005620 GTGATGATGGGGAAGGAGGGAGG + Intronic
904292733 1:29498211-29498233 CTGCTGTTGGGCACTGAGGAGGG + Intergenic
904401849 1:30262104-30262126 GAGATGATGGGCACTGGGGAGGG - Intergenic
904680844 1:32228139-32228161 GTGGTCTTGGGGACAGAGGACGG + Intronic
905171282 1:36111203-36111225 GTGATGAGGGTGGCTGGGGAGGG - Intronic
906516089 1:46439621-46439643 GGGATGGTGGGAATTGAGGAGGG + Intergenic
907786997 1:57622250-57622272 GAGATGAAGGGGACTGTGCAAGG + Intronic
907818560 1:57944280-57944302 GAAAGGATGGGGAATGAGGAGGG - Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908428725 1:64035145-64035167 ATGATGATGGAGACTCATGAGGG - Intronic
909614059 1:77587144-77587166 GTGTTGCTGGGGATGGAGGATGG + Intronic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
911018585 1:93363168-93363190 GTTAAGATGGGGAAAGAGGAGGG - Exonic
911653018 1:100411091-100411113 GTGAGGATGGGGAGTGGAGAAGG - Intronic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
912714598 1:111974078-111974100 GGGAAGATGGGGACTGGAGAGGG - Intronic
913140698 1:115938643-115938665 TTGAAGATGGGGCCTGTGGAAGG + Intergenic
913203726 1:116517000-116517022 GTGATGAAAGGAACAGAGGAAGG + Intronic
913466730 1:119150596-119150618 GTGATGATGGAAACAGAGGTTGG + Intergenic
916501446 1:165390835-165390857 GTGATCATGGGGGCAGAGAATGG - Intergenic
916737257 1:167618762-167618784 ATGTTGCTGGGTACTGAGGAAGG - Intergenic
916748532 1:167703312-167703334 GTCATGCTCGGGGCTGAGGAGGG - Intronic
917484673 1:175444845-175444867 GAGAGTATGGGGACAGAGGAAGG + Intronic
918446531 1:184622715-184622737 CAGATGATGGGCACTGTGGACGG - Exonic
919194668 1:194267861-194267883 TAGATAATGGAGACTGAGGACGG + Intergenic
919279303 1:195466540-195466562 GTGATTAGGGAGACTAAGGAGGG - Intergenic
919535358 1:198780432-198780454 GTAATCATGGGCAGTGAGGAAGG - Intergenic
919794478 1:201313066-201313088 GTTATTATGGGGGCTGGGGAGGG + Intronic
919923343 1:202178966-202178988 GTTAAGATGGGGACTGAGACTGG + Intergenic
920704308 1:208240606-208240628 GTGGTGATTGGGGCTGAGGGGGG + Intronic
921289792 1:213646748-213646770 GTCATCATGGGGGCTGGGGAAGG + Intergenic
921512639 1:216050966-216050988 GGGAGGATAAGGACTGAGGAAGG - Intronic
921883825 1:220283716-220283738 GTGATGGTGGGGAGGGAGGAAGG - Intergenic
922152845 1:223020213-223020235 CTGATGATGAGGAGTGAGGTGGG + Intergenic
923224350 1:231925320-231925342 GTGATGCTGTGCACTCAGGAAGG + Intronic
924330321 1:242935031-242935053 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
924451201 1:244180708-244180730 ATTATGATGAGGACGGAGGAAGG - Intergenic
1063893934 10:10659518-10659540 CTTATTATGGGGAGTGAGGAAGG + Intergenic
1063937867 10:11097817-11097839 GTGATGATGGTGACAAAGGTTGG - Intronic
1064680767 10:17809102-17809124 GTGATGGTGAGGAGTCAGGAAGG - Intergenic
1065038799 10:21669237-21669259 GAGATGATGGGGGCTGGGGATGG + Intronic
1065539277 10:26744675-26744697 GTGTTCATGGGGACTGAGCGCGG - Intronic
1065848652 10:29767904-29767926 GAGATGCTGGGGACTCAGGAAGG - Intergenic
1065898318 10:30183625-30183647 GAGATGATGGTGTCTGAAGAGGG - Intergenic
1066049132 10:31618988-31619010 GTGATGGATGGGCCTGAGGACGG - Intergenic
1067789059 10:49273810-49273832 GTGAAGATGGGGACGGAGATTGG + Intergenic
1068281578 10:54878072-54878094 GCTACGAGGGGGACTGAGGAAGG - Intronic
1069515640 10:69074659-69074681 CTGAGGCTGGAGACTGAGGATGG + Intergenic
1069604290 10:69730059-69730081 GTGATGATGGCAACTGAGGTGGG + Intergenic
1069801272 10:71083420-71083442 GGGATGCTGGGGAGTGAAGATGG - Intergenic
1069819340 10:71217838-71217860 GTGGAGATGGGGACTGGGGGTGG - Intronic
1070162837 10:73876149-73876171 GTGATGGTGGGGACAGGAGAAGG - Intergenic
1070166841 10:73905384-73905406 GTGATGGTGGGGAATGTGGCAGG - Intergenic
1070644696 10:78193618-78193640 GTGATGATGGGAAAAGAGAAGGG + Intergenic
1071511674 10:86266187-86266209 GTGATGATGGGTTATCAGGAGGG - Intronic
1072019832 10:91387336-91387358 GTGATTAAGGGGACTTGGGAAGG + Intergenic
1072308099 10:94127623-94127645 GTGATGATGAGGATTGTGGCAGG - Intronic
1072348236 10:94530115-94530137 GTGCTGATGGGGTTTGAGGAAGG - Intronic
1072841210 10:98776006-98776028 ATGGTTGTGGGGACTGAGGAGGG - Intronic
1073432394 10:103494631-103494653 GCGATGATGGTGATGGAGGATGG + Intronic
1073454685 10:103629450-103629472 GTAATTATGGGAACTCAGGAAGG + Intronic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074779586 10:116791679-116791701 GGGAAAATGGGGGCTGAGGAGGG - Intergenic
1075260774 10:120962349-120962371 GTGATAATGGGGACCGAGTTTGG + Intergenic
1075793386 10:125101989-125102011 GACATTATGGGGACTGACGAGGG - Intronic
1076087093 10:127642813-127642835 GTGATGATGGAGACAGAGTTTGG - Intergenic
1076433591 10:130424498-130424520 GTGAGGATGGAGACAGAGGCTGG + Intergenic
1076478724 10:130769964-130769986 GACATGAAGGGGACAGAGGAGGG + Intergenic
1076546300 10:131247681-131247703 TGGATGATGGGGACAGAGAAGGG - Intronic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1077484055 11:2830802-2830824 CTGATGATGGGGAGAGGGGAAGG - Intronic
1077587439 11:3464538-3464560 GAGATGATGGCGGCTGAGGCTGG - Intergenic
1077925910 11:6682073-6682095 GTGATCATGGGTACTGATTAAGG + Exonic
1078472968 11:11606505-11606527 GTGATGATTCGGATAGAGGAGGG - Intronic
1078925808 11:15873923-15873945 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1080215650 11:29836981-29837003 ATGGTGATGGCGACTGATGATGG - Intergenic
1081794836 11:45812045-45812067 GTGATGTTAGGGACTGGGGGAGG - Exonic
1081877920 11:46423008-46423030 GTAATGATGGGAATTAAGGAAGG + Intronic
1081998099 11:47377564-47377586 GTGAGAATGGGGGCTGAGGCTGG - Intronic
1083616096 11:64027382-64027404 GGGATGGTGGTGGCTGAGGATGG + Intronic
1083749536 11:64753726-64753748 GTGGGGCTGGGGACTGGGGATGG - Intronic
1083931819 11:65850382-65850404 AGGATGATGGGGGCTGAGGAGGG + Intronic
1084095674 11:66909580-66909602 GTGCTGATGGAGACTCAGGCAGG - Intronic
1084201291 11:67560157-67560179 TCCATGATGGAGACTGAGGAGGG + Intergenic
1084657772 11:70529003-70529025 GTGATGATGGGGGCAGATCATGG + Intronic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1084829553 11:71758405-71758427 GAGATGATGGTGGCTGAGGCTGG + Intergenic
1085047792 11:73363430-73363452 GTGTGGCTGGGCACTGAGGATGG + Exonic
1086066567 11:82751370-82751392 GTGATAATGAGGACTTGGGAGGG - Intergenic
1086788563 11:91004537-91004559 GTGATGATGGAGTATGAGAATGG + Intergenic
1087717301 11:101623264-101623286 GTGAAGATAGGGGTTGAGGATGG - Intronic
1088119452 11:106350963-106350985 TTGATGATGGGGGATGAGGCAGG + Intergenic
1088695423 11:112362115-112362137 GTGATGCTGGGGGGTGAGCAGGG + Intergenic
1088706342 11:112467730-112467752 GTTTTGATTGGGGCTGAGGAGGG + Intergenic
1089339861 11:117750008-117750030 GTGATGAAAGGCACTGAGAAGGG + Intronic
1089565813 11:119370990-119371012 GTCATGATTGGGGCTGAGGGTGG + Intronic
1089768557 11:120786113-120786135 ATGATGATGGGGCCAGAGCAAGG - Intronic
1090009176 11:123030767-123030789 GTCATGATTGGGCCTGAGGGTGG - Intergenic
1090352211 11:126114805-126114827 GGGATGATGGGGGCAGAGGTGGG + Intergenic
1090465588 11:126930431-126930453 GAGATGATGGGGATTGAGCATGG - Intronic
1090643260 11:128747057-128747079 GTGATGGTGCCGCCTGAGGATGG - Intronic
1091263001 11:134248693-134248715 GTGAGGATGCTGACTGAGAAAGG + Intronic
1091343060 11:134835041-134835063 GCCATGTTGGGGGCTGAGGAGGG - Intergenic
1091912728 12:4244931-4244953 GGGGTGATGGGGAAGGAGGAGGG - Intergenic
1091941149 12:4483703-4483725 GTGGTGATGGGGATGGGGGAGGG - Intergenic
1094293050 12:28873547-28873569 GGGATGAAAGGGACTGAGTAGGG + Intergenic
1094372075 12:29749811-29749833 GTGATGATGGGGAGAGGGAAAGG - Intronic
1094494090 12:30978710-30978732 GTGATGAGGGAAGCTGAGGAAGG + Intronic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1095391642 12:41714326-41714348 GTGGTGATGGGGAATGCTGAAGG - Intergenic
1096746286 12:53729483-53729505 GGCAAGATGGGGACTGGGGAGGG + Intergenic
1096790120 12:54039260-54039282 GTGCTGTTGGGGGATGAGGAGGG + Intronic
1097034331 12:56112872-56112894 ATGAAGCTGGGGACTGAGGTGGG + Exonic
1097693562 12:62756305-62756327 GTGTTGTGGGGGACTGAGTATGG - Intronic
1098114185 12:67157001-67157023 GAGAAGATTGGGACTGGGGAGGG + Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1100333158 12:93604769-93604791 GCTACGATGGGGGCTGAGGAGGG - Intergenic
1101008670 12:100427500-100427522 AGGAAGATGAGGACTGAGGATGG + Intergenic
1101565498 12:105901225-105901247 GTGAGGAGGGGAACAGAGGAGGG + Intergenic
1101616638 12:106344204-106344226 GGGAAAATGGGGACTGAAGAAGG - Intronic
1101681227 12:106967771-106967793 GTGAGGATGGATACAGAGGAAGG + Intronic
1101808737 12:108089882-108089904 GTGATGATGTTGGCAGAGGAAGG + Intergenic
1102481961 12:113229954-113229976 ATGATGCTGTGGACTGAGGCAGG - Intronic
1103275729 12:119710361-119710383 GTGTTGGTGGGCACCGAGGAAGG - Exonic
1103339727 12:120215080-120215102 GTGATGAGGGGGAGTGGGCAGGG - Intronic
1104074723 12:125378961-125378983 CAGATGCTGGGGACTGAGGGGGG - Intronic
1104728810 12:131094033-131094055 CTGAGGCTGGGGACTGAGGCTGG - Intronic
1104932972 12:132349855-132349877 GTGATAATGGTGACTGATGATGG - Intergenic
1105278560 13:18950114-18950136 ATGGTGATGGGGACAGAGGTGGG - Intergenic
1105900984 13:24752937-24752959 GAGATGATGGGGGCTAACGAGGG - Intergenic
1105929236 13:25036739-25036761 GTGGTAATGGGGACTCAGGATGG + Intergenic
1107015299 13:35703888-35703910 GTGAGGGTGGGAAGTGAGGAGGG + Intergenic
1107174110 13:37380001-37380023 GAGCTGATGGCGACTGAGAATGG - Intergenic
1107665012 13:42679602-42679624 GTGAGGCTGGGGACAGAGAAGGG + Intergenic
1107913099 13:45123918-45123940 GTGTGGTTGGGGACTGAGTATGG + Intronic
1109229042 13:59733767-59733789 GTGGTGATGGGTGCTGAAGAGGG - Intronic
1111309445 13:86463213-86463235 GTTATGAGGGGGGCTGAGGGAGG + Intergenic
1112105911 13:96239030-96239052 GCAATGATATGGACTGAGGAAGG + Intronic
1112341636 13:98557433-98557455 GTGATGATGGTGATGGAGGGAGG - Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112762178 13:102703760-102703782 GTGATTATGGGGCCTGAGTCAGG + Intergenic
1113040828 13:106102234-106102256 GTGTTCAGGGGGTCTGAGGAAGG - Intergenic
1113270504 13:108668601-108668623 TTGATGTTGGAGACGGAGGAGGG - Intronic
1113286195 13:108851832-108851854 GTCATGGAGGGGACTGAGCATGG - Intronic
1113850402 13:113414421-113414443 GGGAGGCTGGGGACTGAGGGAGG - Intergenic
1114282956 14:21211476-21211498 GTGAAGATGGAGTCTGAGGGGGG - Exonic
1116997057 14:51335318-51335340 GGGATGATGGGAACTGGGAAAGG + Intergenic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118338008 14:64870979-64871001 ATGATGATGGGGAGGGATGATGG + Intronic
1119477492 14:74939508-74939530 CTGCTTATGGAGACTGAGGAAGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119852346 14:77875054-77875076 GTGCTGAGGGGGTCTGAGGCTGG + Intronic
1121091733 14:91187661-91187683 GTGATGAGGGAGACTCTGGAGGG - Intronic
1121241333 14:92432066-92432088 GTGTGGATGGGTACGGAGGATGG + Intronic
1121328173 14:93033931-93033953 GTGGGACTGGGGACTGAGGATGG + Intronic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122145821 14:99688350-99688372 GAGGTGATGGGGACTGAAGCAGG - Intronic
1122252922 14:100452978-100453000 GTGGTGCTGGGGAGAGAGGATGG + Intronic
1122297980 14:100716176-100716198 GTGTTTATGGGCATTGAGGAAGG + Intergenic
1122868139 14:104619139-104619161 GAGATGATGGGGAAAGAGCAGGG - Intergenic
1123192055 14:106580873-106580895 CTGATTAAGGGGCCTGAGGATGG - Intergenic
1123220791 14:106853550-106853572 CTGATTATGGGGCCTGAGGATGG - Intergenic
1123914916 15:25014353-25014375 GTAAAGATTGGGAATGAGGAAGG + Intergenic
1125021900 15:34994299-34994321 TTGCAGATGGGGACTGAGAAAGG - Intergenic
1126436885 15:48645824-48645846 GTGATGAGGGCGACGAAGGAGGG - Exonic
1126498551 15:49319594-49319616 TTGAAGATGAGCACTGAGGAAGG - Exonic
1126634354 15:50766568-50766590 GTGAAGATGGGGAGACAGGAAGG - Intergenic
1126774329 15:52086972-52086994 GTGATAGTGGTGACTGAGAAAGG - Intergenic
1126778508 15:52119304-52119326 GTGATGAGAGGGAGGGAGGAGGG + Exonic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1128682398 15:69661569-69661591 CTGATGGTGGTGACAGAGGAGGG + Intergenic
1128719043 15:69932563-69932585 GTGAAGATGGGGTCTGGGTATGG + Intergenic
1131383291 15:91981970-91981992 GTGGTGCTGGGGACAGAAGAAGG - Intronic
1131525672 15:93150714-93150736 GTGATGTTGGGGGCAGAAGAGGG - Intergenic
1132350565 15:101137247-101137269 GATGTGATGGGGACTGAGCAGGG + Intergenic
1132553972 16:564693-564715 GTGATGCTGTGGCCTGAGGACGG + Exonic
1133001766 16:2855521-2855543 GGGCAGATGGGGACAGAGGATGG - Intronic
1133278399 16:4651617-4651639 GAAAGGGTGGGGACTGAGGAAGG + Intronic
1134362206 16:13542078-13542100 GTGAAGATGGGGGCAGAGGTTGG + Intergenic
1134689603 16:16182617-16182639 AGGATGATGGGGACAGAGGTGGG + Intronic
1135292021 16:21248027-21248049 CTGCTGATGGGGACTGAGTTTGG + Intronic
1135956439 16:26960163-26960185 GTGATGAGGGGGGTAGAGGATGG - Intergenic
1136012190 16:27371157-27371179 GAGAGGATGGGGATTGGGGAAGG - Intergenic
1136109240 16:28054269-28054291 CCGATGGTGGGGACTGGGGATGG - Intronic
1136626900 16:31466848-31466870 GTGGTGATGGGGATTGAGTTGGG + Exonic
1137335828 16:47547716-47547738 CTGTTTATGGGTACTGAGGATGG - Intronic
1137470050 16:48746081-48746103 GTGATGATGGCCATTGAGCAGGG - Intergenic
1137482010 16:48859683-48859705 GTGAGTATGGGGACTTAGGGAGG - Intergenic
1137684159 16:50374220-50374242 GAGATGATGGGGACTGTGTCTGG + Intergenic
1137874683 16:51984626-51984648 GTGATGAGGGGTGGTGAGGAAGG + Intergenic
1138538150 16:57670940-57670962 GTGGTGCTGGGGGCTGAGGCGGG - Intronic
1139087274 16:63602547-63602569 GTGAAGATGGGGATGGAGGTGGG + Intergenic
1140723896 16:77794903-77794925 TTGCTGATGAGGACTGGGGATGG + Intronic
1141494065 16:84394734-84394756 GTGATGATGGAGGCAGAGGCTGG - Intronic
1141528579 16:84629651-84629673 GTGATGCTGGGGTCTGCGGTGGG - Intergenic
1141650928 16:85392807-85392829 GTGAAGATGGAGCCTGAGGCTGG + Intergenic
1141676325 16:85519570-85519592 ATGATGATGGAGACTGGTGATGG - Intergenic
1141676334 16:85519625-85519647 ATGATGATGGAGACTGGTGATGG - Intergenic
1142119215 16:88377647-88377669 GGGAGGATGGGGAGTGAGGAAGG - Intergenic
1142503021 17:344254-344276 GTGGTGATGGTGACTGATGGAGG - Intronic
1143065632 17:4244971-4244993 GGGATGGTGGGGACAGAAGAGGG - Intronic
1143302270 17:5919321-5919343 GAAAGGCTGGGGACTGAGGAAGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143789066 17:9278984-9279006 GTGATGATGGGGATTAGAGAGGG - Intronic
1144004970 17:11091384-11091406 GTGGTGCTGGGGGCTGAGGAGGG + Intergenic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1144777534 17:17792396-17792418 GCCATGCTGGGGACTGAGGAGGG - Intronic
1145995873 17:29104644-29104666 GTGATGAGTGTGAATGAGGATGG + Intronic
1146058564 17:29593127-29593149 GGGATGATGGGGAGAGAGGAAGG - Intronic
1146841303 17:36156972-36156994 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1146853554 17:36244609-36244631 GAGAAGACGGGGACTGTGGAAGG + Intronic
1146869463 17:36368501-36368523 GAGAAGACGGGGACTGTGGAAGG + Intronic
1146946580 17:36877627-36877649 GTGATGGAGGGGAGTGAGCAAGG + Intergenic
1147072338 17:37969125-37969147 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1147083862 17:38048662-38048684 GAGAAGACGGGGACTGTGGAAGG + Intronic
1147099808 17:38172629-38172651 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1148227223 17:45907288-45907310 GGGAAGATGGACACTGAGGAAGG - Intronic
1148439242 17:47703097-47703119 GAGAAGATGGGGACTCAGTATGG + Intronic
1148648135 17:49230798-49230820 GTGACGTTGGGGACTGCGGTGGG - Intergenic
1149525368 17:57351366-57351388 GTGTTGATGAGGACTGGGGAGGG - Intronic
1149688178 17:58550907-58550929 GTGAGGCTGGAGACTGAGCAGGG - Intergenic
1149997677 17:61413206-61413228 GAGGTGGTGGGGACTGGGGAGGG + Exonic
1150082816 17:62255919-62255941 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1150653955 17:67027430-67027452 GCACTGATGGGGACTGAGCAGGG + Intronic
1150814342 17:68380830-68380852 GAGATGATTGAGACTGAGGGAGG + Intronic
1150820608 17:68431351-68431373 AGGATGCTGGGGACTGAGCATGG + Intronic
1151502000 17:74496163-74496185 GGGATGATGGGTTATGAGGAAGG + Intergenic
1151540878 17:74764034-74764056 GTGATGGTGGGGGATGGGGAGGG - Intronic
1151681367 17:75624501-75624523 GTGATGAGGGGGAGGGAGGCTGG - Intergenic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1152465316 17:80463004-80463026 GTGATGATGGAGTCAGAGGCTGG - Intergenic
1152632652 17:81417460-81417482 GCCATGGTGGGGACTGAGGGTGG - Intronic
1152829198 17:82486695-82486717 GTGGAGCTGGGGCCTGAGGAAGG + Intronic
1153129356 18:1836824-1836846 ATGATGATGGGAAGTGGGGATGG + Intergenic
1153534722 18:6088548-6088570 GCGATGATGGGGAGTGAGTGGGG + Intronic
1155072237 18:22326772-22326794 GTGATGATGGAGACAGAGACTGG + Intergenic
1155229314 18:23757465-23757487 GTGAGGGTGGGGGCTGGGGAGGG - Intronic
1155994287 18:32313425-32313447 GTTATGATGTGGTCTAAGGAGGG + Intronic
1156511358 18:37639658-37639680 GTAATGATGGAGACAGAAGAGGG + Intergenic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157726210 18:49966056-49966078 GCCCTGATGGGGGCTGAGGATGG + Intronic
1158015421 18:52777387-52777409 GTGATTATGGAGACTGAGATTGG - Intronic
1158258721 18:55585523-55585545 GTGATAATGGGGGCTGGGGTGGG - Intronic
1158349375 18:56549452-56549474 GTGATGATGCGATCTAAGGAAGG + Intergenic
1158425865 18:57339175-57339197 GTGATGATGGAGGCAGAGGTTGG - Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1160367703 18:78342676-78342698 GAGGTGGTGGGGAGTGAGGAGGG - Intergenic
1160676372 19:393535-393557 GTGATGATGGGGAAGGATGACGG + Intergenic
1160676392 19:393616-393638 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676437 19:393793-393815 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676471 19:393948-393970 GTGGTGATGGGGAAGGATGATGG + Intergenic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161226660 19:3150114-3150136 GTGGTGCTGGGGAGGGAGGACGG - Exonic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1162174770 19:8822902-8822924 GTTGTGTTGGGGACAGAGGAAGG - Intronic
1163118553 19:15202097-15202119 GTGGGGGTGGGGGCTGAGGAAGG - Intergenic
1163191797 19:15682316-15682338 CTGATGTTTGGGACTGGGGAGGG + Intronic
1163201416 19:15772208-15772230 CTGATGTTTGGGACTGGGGAGGG - Intergenic
1163582313 19:18146021-18146043 GTGATGTTGGGGGCTGAAGAAGG - Intronic
1163766425 19:19165857-19165879 GTCAAGGTGGGGCCTGAGGAAGG - Intronic
1164601573 19:29566670-29566692 GGTGTGATGGGCACTGAGGAGGG + Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1165026537 19:32966611-32966633 GGCCTGATGGGGACTGGGGATGG - Intronic
1165053780 19:33160691-33160713 GACATGATGGGGACAGAGGCGGG + Intronic
1165097723 19:33418748-33418770 GTCATGCTGGGGCCTGGGGAAGG - Intronic
1165698331 19:37918184-37918206 GTGAGCAGGGGGACTAAGGAAGG + Intronic
1165783243 19:38446050-38446072 GTGATGGTTGGGTCTGAGGCTGG - Intronic
1166292112 19:41869866-41869888 GTGCTGGTGGGGTCAGAGGAGGG + Intronic
1166702333 19:44889267-44889289 GACATGAAGGGGAATGAGGAAGG + Intergenic
1167374719 19:49104529-49104551 GTGATGATGGGGACACGGGGCGG + Intronic
1167423046 19:49415015-49415037 GAGTGGATGGGGACTGGGGAGGG - Intronic
1167487312 19:49770214-49770236 TTGATGATGGGGGTTGGGGAAGG + Intronic
1167742752 19:51334168-51334190 GTGAGCAAGGGGACTGGGGAAGG - Intronic
1167797073 19:51716487-51716509 GAGATTATGATGACTGAGGATGG - Intronic
1168020774 19:53607167-53607189 CAGATGATGGGGAGTGGGGATGG - Intergenic
1168281637 19:55308971-55308993 GAGAGGCTGGGGCCTGAGGAGGG + Intronic
1168302275 19:55412517-55412539 GTGATGATGGGCATTTAGGTTGG - Intergenic
1168322459 19:55518264-55518286 GTGATGACAGGGGTTGAGGAAGG - Exonic
925033472 2:669938-669960 GAGCTGATGTGGACTGAGGTGGG + Intronic
925120115 2:1411748-1411770 GTGATGATGGAAACTGAGACTGG - Intronic
925905129 2:8535552-8535574 GAGAGGAAGGGGGCTGAGGAGGG + Intergenic
926132386 2:10312090-10312112 GTGATGATGGTGATGGAGAATGG - Intronic
926306814 2:11643230-11643252 GAGCTGATGGGGAGTGAGCAAGG - Intergenic
927458482 2:23277506-23277528 GTGATGATGAGGGCAGAGGTTGG + Intergenic
927561467 2:24076867-24076889 GAGGTGGTGGGGCCTGAGGAGGG + Intronic
927561541 2:24077097-24077119 GAGGTGGTGGGGCCTGAGGAGGG + Intronic
927598772 2:24421930-24421952 GGGATCATGGGGACTCAGGTAGG - Intergenic
927640735 2:24843937-24843959 GTGATGATGGCGTCTGGTGAAGG + Intronic
927874290 2:26644416-26644438 GTGATGAGGAGCACTGAGGCTGG - Intergenic
928095652 2:28403445-28403467 CTGATGATGGGAAGGGAGGAGGG + Intronic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929879953 2:45826894-45826916 GTGATGATGGTGGCTGGGAAGGG - Intronic
930058023 2:47266817-47266839 GTGTAGATGGGGTCTGAGGATGG + Intergenic
930095730 2:47564733-47564755 CTGATGCTGGGTGCTGAGGATGG + Intronic
930263798 2:49176620-49176642 GAGAGAATGGGGACTGAGGTTGG + Intergenic
932326168 2:70863296-70863318 GTGAAGATGGGGGCAGAGGCTGG - Intergenic
932498051 2:72157072-72157094 GTGATGATATGTACTGAGGTGGG + Intergenic
932832836 2:75007465-75007487 GTGATGCTTGGGGCTGTGGAAGG + Intergenic
932871152 2:75399686-75399708 TTGTTGATGGGCACTGAGGTTGG - Intergenic
933387721 2:81632765-81632787 GTTATGATAGGGACTCAGGGGGG + Intergenic
934057461 2:88263707-88263729 GTGAAGATGGGGACAGGGGTTGG - Intergenic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935798547 2:106669572-106669594 GAGAGTGTGGGGACTGAGGAAGG - Intergenic
935944323 2:108271680-108271702 GTGCACATGGGGGCTGAGGATGG + Intergenic
936005673 2:108884912-108884934 CTGCTGATGGGGAGTGGGGAGGG - Intronic
936480406 2:112880081-112880103 GTGGTGATGGGGAGTCAAGAGGG + Intergenic
937075796 2:119105508-119105530 GTGATGATGTGGAGAGAGGCAGG - Intergenic
937790727 2:125958199-125958221 GTGGTTATGGGGGGTGAGGATGG - Intergenic
938022461 2:127917371-127917393 GTGATGAAGGTTAGTGAGGAAGG - Intergenic
938556571 2:132430132-132430154 GTGATCATGGGTTCTGATGACGG + Intronic
939348574 2:141001461-141001483 GTGAGGTGGGGGACGGAGGAGGG - Intronic
940128455 2:150354425-150354447 GTGAAGATGAGGGCTGAGAATGG + Intergenic
940889881 2:159025005-159025027 TTAATGATGGGGATAGAGGATGG - Intronic
941712541 2:168729408-168729430 GAGGTGATGGGAAGTGAGGATGG - Intronic
941851270 2:170184319-170184341 GTGGTGATGGGGAGTAGGGATGG - Intronic
942046281 2:172101170-172101192 GTGATGATGGTGACAGCGGGAGG + Intronic
942426014 2:175861816-175861838 GAGATGCTGGGGGCTGGGGAAGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943601297 2:189924041-189924063 GTGAAGATGGAGTCTGAGGGGGG + Intronic
945373384 2:209049493-209049515 TTGATGATGGTGAATGATGATGG + Intergenic
946057834 2:216917169-216917191 GAGATGATGGTGGCTGAGGTAGG + Intergenic
946341795 2:219074145-219074167 GGGATGATGGGGGCAGTGGATGG + Intergenic
947186606 2:227460945-227460967 GTGATGATGGAGGCAGAGGTGGG - Intergenic
947575425 2:231269988-231270010 GTGATGGTGGGGCCTGTCGATGG + Intronic
948320806 2:237067510-237067532 ATGATGATAGGGGCAGAGGATGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948856542 2:240732878-240732900 GGGATGAGGGGGAATGAGGGAGG + Intronic
948856581 2:240733003-240733025 GGGATGAGGGGGAATGAGGGAGG + Intronic
948856591 2:240733024-240733046 GGGATGAGGGGGAATGAGGGGGG + Intronic
948863099 2:240762386-240762408 ATGATGATGGGGAATGGGGCTGG - Intronic
1169026521 20:2376205-2376227 CTCTTGATGGGGAGTGAGGATGG - Intergenic
1169074014 20:2750594-2750616 GCGATGGTGGGGACTGCGGTGGG - Intronic
1169210941 20:3766029-3766051 ATGAGAATGGGGACTGAAGAAGG - Intronic
1169253186 20:4075912-4075934 GGGATGGTGGGGAGAGAGGAGGG - Intergenic
1169490864 20:6070465-6070487 GTGATGATGGAGACAGAGACAGG - Intergenic
1170072205 20:12381239-12381261 GTGAAGCTGGGGACTGAGGTGGG + Intergenic
1170520445 20:17179759-17179781 GTGGTGGTGGGGGCTGTGGAAGG - Intergenic
1171398663 20:24857570-24857592 GTGAAGATGGTGGCCGAGGAGGG + Intergenic
1171423896 20:25037562-25037584 GTGCTGATGGGGGCTGGGGAAGG + Intronic
1172083021 20:32357921-32357943 GTGCGGGTGGGGAGTGAGGATGG - Intergenic
1172612460 20:36262045-36262067 CTGCTGATGGGCAGTGAGGATGG + Intronic
1172644019 20:36458797-36458819 GTGATGATGGTGGCTTAGGCAGG + Intronic
1172981659 20:38947386-38947408 GTGTTGAGGGTGAGTGAGGATGG + Intronic
1173200831 20:40953996-40954018 GTGCTAATGGTGACTGAGCAGGG - Intergenic
1173370675 20:42432137-42432159 GGGAAGGTGGGAACTGAGGATGG - Intronic
1173870934 20:46341718-46341740 GTGGGGATGGGGGCTGAGGGAGG + Intergenic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1173979615 20:47213187-47213209 GTGATGAGGAGGACTAAGGAAGG + Intronic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1174287031 20:49481100-49481122 GGGCTGTAGGGGACTGAGGAAGG - Intronic
1174541507 20:51293288-51293310 ATGATGATCAGGATTGAGGATGG - Intergenic
1175170237 20:57075095-57075117 GTGATGATGGAAACTGAGATTGG + Intergenic
1175515252 20:59565974-59565996 GGGATGATGCCCACTGAGGAGGG - Intergenic
1175604176 20:60298870-60298892 GTGCTGATGGGGGATGAGGCTGG - Intergenic
1175854681 20:62114067-62114089 GTGATTTGGGAGACTGAGGAAGG + Intergenic
1176247870 20:64105774-64105796 ATGATGATGGGGGGTGATGATGG + Intergenic
1176309053 21:5140157-5140179 GTGATGGTGGTTACTGAGGGCGG + Intronic
1177214430 21:18110043-18110065 CTGAGGATGGGGACTGAGATGGG + Intronic
1177410149 21:20719035-20719057 TTTATGATGGAGACTGTGGATGG + Intergenic
1178675961 21:34631841-34631863 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1178687046 21:34720178-34720200 GTGGTGGTGGGTACTGGGGATGG - Intergenic
1179179942 21:39036451-39036473 GTGAAGATGGGGACAGAGACTGG + Intergenic
1179787060 21:43735907-43735929 GTGCTGCTGGGGAGTGAGGCTGG + Intronic
1179848008 21:44121876-44121898 GTGATGGTGGTTACTGAGGGCGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182266621 22:29120521-29120543 GTGATGATGGAAACGGAGGAGGG + Intronic
1182266636 22:29120606-29120628 GTGATGAAGGAAACGGAGGAAGG + Intronic
1182617247 22:31595686-31595708 GTGCTGAGGGAGACTGAGCATGG + Intronic
1183271171 22:36863445-36863467 GGGGTGGTGGGGGCTGAGGAAGG - Intronic
1183272850 22:36872785-36872807 GTGAGGATGGAGATTGAGGGTGG + Intronic
1183512843 22:38245912-38245934 GTGAGGATGGGGACGGAGTGGGG - Intronic
1183593223 22:38793899-38793921 GTGAGGGTGGGGGTTGAGGATGG + Intronic
1183747187 22:39698648-39698670 GAGATGATGGGGAGTGATGGGGG - Intergenic
1184389489 22:44195088-44195110 CTGAGAATGGGGGCTGAGGAAGG + Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184463255 22:44652465-44652487 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463267 22:44652859-44652881 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463279 22:44653216-44653238 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1185398777 22:50605474-50605496 GTGATGGCAGGGACTGAGGCTGG - Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950011585 3:9727971-9727993 ATGATGACAGGGAGTGAGGAGGG + Intronic
950283133 3:11723952-11723974 CTGAGGATGGGTACAGAGGAGGG + Intergenic
951514010 3:23537637-23537659 GTGATGTTGGAGAATGAAGAAGG - Intronic
951581642 3:24171045-24171067 GAGATGATTGGCACTGATGATGG - Intronic
952439008 3:33304264-33304286 TTTATGGTGGGGAATGAGGAGGG - Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
955568706 3:60278505-60278527 GTGGTGATGAGGTCTCAGGAAGG - Intronic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955923756 3:63985682-63985704 GTGAGGAGGGGCAGTGAGGATGG - Intronic
957058724 3:75464142-75464164 GAGATGATGGCGGCTGAGGCTGG - Intergenic
958153675 3:89725425-89725447 CTGCTGATGGGGACAGAGGTGGG - Intergenic
959273306 3:104242140-104242162 GTGATGTATGGGATTGAGGAAGG + Intergenic
959659167 3:108846110-108846132 CTCATGATGTGGACTGAGCACGG + Intronic
960822857 3:121752861-121752883 GGGATGGTGGGGAAAGAGGAAGG + Intergenic
961027123 3:123568233-123568255 GGCAAGATGGGGACTGAGGGTGG - Intronic
961294724 3:125875558-125875580 GAGATGATGGCGGCTGAGGCTGG + Intergenic
961378671 3:126483170-126483192 GTGATGATGGGGAGACAGGTGGG - Intronic
961398235 3:126613350-126613372 GGGAAGATGGGGATGGAGGAGGG - Intronic
961891241 3:130131922-130131944 GAGATGATGGCGGCTGAGGCTGG - Intergenic
961903347 3:130236808-130236830 GTAATGATGGTGTCGGAGGAGGG - Intergenic
964492277 3:157249639-157249661 GGCATGATGGAGACAGAGGAGGG - Intergenic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
965517948 3:169642234-169642256 GTGCAGATGGTGACTGGGGAAGG + Intronic
965960419 3:174422716-174422738 GAGATGTTTGGGGCTGAGGAGGG + Intergenic
968148718 3:196320585-196320607 GGGATCCAGGGGACTGAGGAGGG + Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968955860 4:3718910-3718932 GAGAGGATGGTGACTGTGGAAGG - Intergenic
969002630 4:3994363-3994385 GAGATGATGGCGGCTGAGGCTGG - Intergenic
969307151 4:6332356-6332378 GTGAGGAGGGGGCCTGAGGGAGG + Intronic
969333407 4:6492963-6492985 GTGAGGAGGGAGACTGGGGAGGG - Intronic
969389390 4:6879639-6879661 GTAATGACTGTGACTGAGGAGGG + Intronic
969751390 4:9114165-9114187 GAGATGATGGCGGCTGAGGCTGG + Intergenic
969811298 4:9650449-9650471 GAGATGATGGCGGCTGAGGCTGG + Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970418459 4:15882382-15882404 GTTATGATGAGGACTGAGAGAGG + Intergenic
971099344 4:23445884-23445906 GCCATGATAGGGAGTGAGGATGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972337405 4:38119731-38119753 GTCATGAAGAGGAGTGAGGATGG + Intronic
972444701 4:39132143-39132165 CTGATAATGGGGAGTGAGGTAGG - Intergenic
972600153 4:40565002-40565024 GTGAACGTGGGGACTGAGCAGGG + Intronic
975241142 4:72060754-72060776 ATGATGAAGGGGACTCAGGTGGG - Intronic
977125309 4:93158431-93158453 GTGATGCTGGGGAAAGAGAAAGG + Intronic
979218597 4:118194717-118194739 GAGATGAAGGAGACTGAGAATGG - Intronic
980544740 4:134244450-134244472 AGGCTGAGGGGGACTGAGGACGG + Intergenic
981158907 4:141473581-141473603 GTCATGATGTGAAATGAGGATGG - Intergenic
981903701 4:149895281-149895303 GGAATGCTGGGGACAGAGGACGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
984825880 4:183924320-183924342 GTGATGATGGGGGCTGAGTAAGG + Intronic
985519608 5:367413-367435 GTCATGATGGGCGGTGAGGAAGG - Intronic
985704314 5:1391698-1391720 GTGACGATGGGGACGGTGGGAGG + Intergenic
986222058 5:5776706-5776728 ATGATGGTGGGGAGAGAGGAGGG - Intergenic
986797161 5:11223452-11223474 GGGAAGATGGGGCCTAAGGATGG - Intronic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989295391 5:39819528-39819550 CTTATTATGGGGACTGGGGAGGG - Intergenic
991727563 5:69551117-69551139 CTGATGATGGGTACTGAGACTGG + Intronic
991867394 5:71076757-71076779 CTGATGATGGGTACTGAGACTGG - Intergenic
992097818 5:73379494-73379516 ATGAAGTTGGGGACTGAGGGTGG + Intergenic
992260206 5:74962179-74962201 GGGATGGTGGGGACTGGGGATGG + Intergenic
993180308 5:84544024-84544046 GTGAAGATGGGGACAGAGATTGG - Intergenic
993433309 5:87859587-87859609 GTCTTAATGGGGAGTGAGGAGGG - Intergenic
994720508 5:103374295-103374317 GGGAGGATGGGGGCTGAGTAGGG + Intergenic
996110590 5:119562098-119562120 GGGTTGATGGGGACTTAGGTTGG - Intronic
996399463 5:123045946-123045968 GGGATGATGGAGGCTGAGGTGGG + Intergenic
996540905 5:124629429-124629451 GGGATGGTGGGGGCTGGGGATGG + Intergenic
999329536 5:150663025-150663047 GAAATGATGGAGTCTGAGGAAGG - Intronic
999496082 5:152099736-152099758 GGGTTGTTGGGGACTAAGGAAGG - Intergenic
1000055600 5:157603439-157603461 GTGATGCTGAGGGCAGAGGAAGG + Intergenic
1001261194 5:170230843-170230865 GTGATGATGGGCACTGGGGTTGG - Intergenic
1001823333 5:174726230-174726252 GTGAGGGTGGGGGCTGTGGAGGG + Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002633696 5:180596810-180596832 GGGAGGACGGGGGCTGAGGAGGG - Intergenic
1002633892 5:180597785-180597807 GTGAGGAAGGAGGCTGAGGAAGG + Intergenic
1002782581 6:378989-379011 GAGCTGCTGGGGAGTGAGGACGG - Intergenic
1003136729 6:3439938-3439960 GGGATGATGGGGATGGAGGCAGG + Intronic
1003235044 6:4288059-4288081 GTGACTTTGGGGACTAAGGAAGG + Intergenic
1003631742 6:7793797-7793819 GGAATCATGGCGACTGAGGATGG - Intronic
1003891830 6:10570594-10570616 GTGAAGATTGGGTCTAAGGAAGG - Intronic
1004038131 6:11944435-11944457 GTGGTGATGGGGAATGAGACTGG + Intergenic
1005387918 6:25304272-25304294 GTGAGGGTGGGGATAGAGGATGG + Intronic
1005482444 6:26267577-26267599 GTGACTATGGGGAATGAGCAGGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006719028 6:36138290-36138312 GTGATGGTGGGGTCGCAGGAAGG + Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007472399 6:42099371-42099393 CTGATGATGGGGCATGAGCATGG + Intergenic
1007475402 6:42116475-42116497 GGGATGGTGAGGACTGAGGAAGG - Intronic
1007707260 6:43798494-43798516 GTGATGGTGGGCACAGTGGAGGG - Intergenic
1008205872 6:48655620-48655642 GTGCTTTTGGAGACTGAGGAGGG - Intergenic
1008588056 6:52966728-52966750 GTTATTGTGGGGCCTGAGGATGG + Intergenic
1009231132 6:61062234-61062256 GTGACCATGGGGGCTGAGGTAGG + Intergenic
1010377158 6:75184275-75184297 GTGAAATTGGGGACTGAGGCGGG - Intronic
1011675446 6:89728717-89728739 GTGATTAGGGAGACTGAGGCAGG + Intronic
1012643298 6:101649827-101649849 CTGATGCTGTGGGCTGAGGAAGG + Intronic
1013688882 6:112616697-112616719 ATGAAGCTGGGGACTGAGGTGGG - Intergenic
1014298728 6:119653051-119653073 ATTATGATGGGGAGTGGGGAAGG + Intergenic
1015641160 6:135334249-135334271 GTGATGATGGGGCCTTTGGGAGG + Intronic
1018055404 6:160047989-160048011 CTGATGATGGGGAGTGATGCTGG + Intronic
1018151578 6:160944778-160944800 GTGATGATGTTCACTGATGAAGG + Intergenic
1018698044 6:166405890-166405912 GTGGTGATGGGGAGAGAGGCAGG + Intergenic
1018967152 6:168497833-168497855 GTGATGATGGGGGGTGCTGAAGG + Intronic
1019034263 6:169041431-169041453 GTGATGATGGAGGCTGAGCTGGG - Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019332410 7:466876-466898 GGGATGATGGTGAGGGAGGAGGG - Intergenic
1019771330 7:2885422-2885444 GTTTTGATGGGGACTGTGGCTGG + Intergenic
1020279408 7:6642792-6642814 GAGATGAAGGGGGCTGAGGTGGG + Intronic
1020321576 7:6942485-6942507 GAGATGATGGCGGCTGAGGCTGG - Intergenic
1022127540 7:27372755-27372777 GTTCTGATGGGGACAGAGGCAGG - Intergenic
1022341074 7:29468765-29468787 GGTATGATGGGGAGTGAGAAAGG - Intronic
1022536260 7:31100493-31100515 GAGAAGTTGGGGACTGAGGAAGG - Intronic
1023364995 7:39455057-39455079 ATGATTATGGAGACTGAGCAAGG - Intronic
1024163855 7:46709967-46709989 GTGATTTTGGGGACTGAGGTAGG - Intronic
1024203462 7:47130505-47130527 GCTATAATGGGGACTGAGGCAGG - Intergenic
1026033250 7:66813394-66813416 GTGTTGGTGGGGGCTGAGGGGGG + Intergenic
1026053726 7:66967414-66967436 ATGATGATGGCGGCTGAGGAGGG + Intergenic
1026764839 7:73154165-73154187 GGGGTGATGGGGACTGCGAAGGG - Intergenic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1027041312 7:74963935-74963957 GGGGTGATGGGGACTGCGAAGGG - Intergenic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027082328 7:75238441-75238463 GGGGTGATGGGGACTGCGAAGGG + Intergenic
1027875843 7:83766997-83767019 GTGATGATGGAGTCTGATGTAGG - Intergenic
1028344547 7:89763266-89763288 GTGACTATGGGAACAGAGGAAGG - Intergenic
1028729065 7:94124121-94124143 GTCATGATGAGGTCTGAGAAGGG + Intergenic
1030856634 7:114565688-114565710 ATGGTGGTGTGGACTGAGGAAGG - Intronic
1031188830 7:118519802-118519824 GTGATGATGGGAAGGGAGGTTGG - Intergenic
1033429499 7:141276162-141276184 GCAGTGATGGGAACTGAGGAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034277550 7:149830319-149830341 GTGACTAAGGGGACTGTGGAGGG - Intergenic
1034757319 7:153634778-153634800 CTCATGGTGGGGAATGAGGAGGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036374598 8:8189579-8189601 GAGATGATGGCGGCTGAGGCTGG + Intergenic
1036752625 8:11452985-11453007 GTGATGAAGGGGACAGAGGGGGG - Intronic
1036854944 8:12233568-12233590 GAGATGATGGCGGCTGAGGCTGG - Intergenic
1036876303 8:12476056-12476078 GAGATGATGGCGGCTGAGGCTGG - Intergenic
1037055005 8:14429268-14429290 GTGAGGCTGGGGTTTGAGGAGGG + Intronic
1038353408 8:26803093-26803115 GTGAAGATGGGAAATGGGGATGG + Intronic
1038912023 8:31975364-31975386 GTGAGGATGGGAACTGGGGAAGG + Intronic
1039573166 8:38603044-38603066 GTGATGATGGAGGCAGAGGTTGG + Intergenic
1039617320 8:38966420-38966442 ATGATGCTGGAGACAGAGGAAGG + Intronic
1040592106 8:48803049-48803071 GTGATCAAGGGTACTGTGGAGGG - Intergenic
1040736665 8:50516281-50516303 TTGATGATGGGGCCTTTGGATGG - Intronic
1041282415 8:56224373-56224395 GAGATGAGGGGGAATTAGGAGGG - Intergenic
1041469139 8:58189623-58189645 ATGATGATGGAGACTTAGGCTGG + Intronic
1042575375 8:70212396-70212418 GTGATGAAGGGGACTGAAATGGG + Intronic
1043352285 8:79376159-79376181 ATGATGATTAGGACTAAGGAAGG - Intergenic
1043560487 8:81488027-81488049 GAGATGATGGGGGCTGGGCAAGG + Intergenic
1045025579 8:98083627-98083649 GTGAGGAGGGGAAATGAGGAGGG - Intronic
1045411780 8:101927450-101927472 GTGATGAAGGTGTCTGAGCAAGG + Intronic
1045509503 8:102803782-102803804 GGGATGAGGGGGAGTGAGGATGG + Intergenic
1045843843 8:106610183-106610205 GTGTTGGTGGGGACTTGGGAGGG - Intronic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1047967644 8:130058267-130058289 CTGATGATGGGGGGAGAGGAAGG - Intronic
1048296440 8:133218052-133218074 GTGAAGGAGGGGACAGAGGAAGG - Intronic
1048361626 8:133701994-133702016 GTGATGGTGGGGAGGGGGGAAGG + Intergenic
1051256226 9:15216692-15216714 TTGATGAGGGGGACAGAGGTAGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1052859230 9:33426715-33426737 GAGATGATGGGGACTGAGATAGG + Intergenic
1053289143 9:36868539-36868561 GTGAGGATGGGGAGGGAGAAAGG + Intronic
1053420809 9:37976489-37976511 GTAATTGTGGGGGCTGAGGAGGG - Intronic
1055511970 9:77004034-77004056 GAGATGATGGGAACAGAGGAAGG - Intergenic
1055980179 9:81993303-81993325 GAGATGAAGGTGGCTGAGGAGGG - Exonic
1056085422 9:83144167-83144189 GTAAGGATGGGGACAGGGGAAGG + Intergenic
1056363474 9:85881409-85881431 GTGATGGTGAGGACAGGGGATGG - Intergenic
1057274398 9:93668608-93668630 GTGGAGATGGGGACAGAGGTGGG + Intronic
1057319796 9:94002040-94002062 GTGAACATGGAGTCTGAGGATGG - Intergenic
1058912577 9:109534337-109534359 GTGGTGATGGTGACTGGGGCCGG + Intergenic
1059437344 9:114284676-114284698 GTGAGAATGAGGACTCAGGAAGG - Intronic
1059490015 9:114659146-114659168 GAGATGCTGGTGACTGAGGCTGG - Intergenic
1059711159 9:116868828-116868850 ATGATGATGGGGACAGAGGCAGG - Intronic
1059989954 9:119855503-119855525 GTGATGATGGGGATTATGGGAGG + Intergenic
1060188797 9:121579443-121579465 GGGATGGTGGGGACTGCAGAGGG - Intronic
1060265708 9:122110444-122110466 GTGAGGATGGGGTTTGAAGAGGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060444049 9:123671053-123671075 GGGATGATGGCCACAGAGGAGGG + Intronic
1062170406 9:135131853-135131875 TTCATGATGGGGCCTGAGCAGGG - Intergenic
1062509470 9:136897017-136897039 CTGATGTTGAGGACAGAGGAAGG - Intronic
1185758338 X:2670168-2670190 GTGATGCTTGGGACTCAGGCTGG - Intergenic
1185844691 X:3427029-3427051 GTGATGATGGTGAGTTATGATGG + Intergenic
1186480027 X:9889638-9889660 GGGATGGTGGGGACTGTGGCGGG + Intronic
1187323300 X:18261613-18261635 TTGATGATGGGGATGGAGAAGGG - Intronic
1189206755 X:39246523-39246545 GTGCTGATGGGAACTTAAGATGG + Intergenic
1189660541 X:43292266-43292288 GTGATGATGGAAACAGAGGTTGG + Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1192189342 X:68981222-68981244 GAGATGCTGGAGGCTGAGGAGGG - Intergenic
1192238632 X:69312634-69312656 GTGATGATGGGGGCGGAAAAGGG - Intergenic
1192360689 X:70436863-70436885 GTAAGGAAGGGGCCTGAGGAGGG + Intergenic
1193312670 X:80025962-80025984 GAGATGCTGGCGACTGGGGATGG + Intronic
1193384691 X:80856496-80856518 GTCATGATGGGAAGTGAGGGAGG - Intergenic
1193592138 X:83402544-83402566 GTGGTGGTGGGGAGTGGGGATGG + Intergenic
1195888624 X:109668609-109668631 GTGATGCTGAGGAGTGGGGATGG - Intronic
1196636886 X:118012464-118012486 GTGATGATGGGTCCAGAGGTTGG - Intronic
1196950127 X:120868599-120868621 ATGAAGCTGGGGACTGAGGTGGG - Intergenic
1197010553 X:121556931-121556953 GGGATGAGGGGAAGTGAGGATGG + Intergenic
1197655363 X:129110908-129110930 ATGATGATGGGGAGTGGGGCGGG + Intergenic
1198388235 X:136147992-136148014 GGGATGGTGGGGAGTGAGGAGGG + Intronic
1198642700 X:138774287-138774309 ATGATGATGATGACTGATGATGG + Intronic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200142919 X:153910677-153910699 GTGAGGCTGGGGCCTGAGGCTGG - Intronic
1201227684 Y:11834166-11834188 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1202272598 Y:23085754-23085776 GTGATGGCGGGGACTGAGGGGGG + Intergenic
1202293428 Y:23334928-23334950 GTGATGGCGGGGACTGAGGGGGG - Intergenic
1202425595 Y:24719498-24719520 GTGATGGCGGGGACTGAGGGGGG + Intergenic
1202445194 Y:24950587-24950609 GTGATGGCGGGGACTGAGGGGGG - Intergenic