ID: 954429661

View in Genome Browser
Species Human (GRCh38)
Location 3:50463787-50463809
Sequence CTGTCCCAGGGGGAGAACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954429652_954429661 8 Left 954429652 3:50463756-50463778 CCCAGTGGCCTCCTTGTATGGGA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429653_954429661 7 Left 954429653 3:50463757-50463779 CCAGTGGCCTCCTTGTATGGGAC 0: 1
1: 0
2: 0
3: 10
4: 109
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429655_954429661 -3 Left 954429655 3:50463767-50463789 CCTTGTATGGGACAGACATCCTG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429649_954429661 14 Left 954429649 3:50463750-50463772 CCTCAACCCAGTGGCCTCCTTGT 0: 1
1: 0
2: 3
3: 26
4: 252
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429648_954429661 15 Left 954429648 3:50463749-50463771 CCCTCAACCCAGTGGCCTCCTTG 0: 1
1: 0
2: 1
3: 25
4: 242
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429654_954429661 0 Left 954429654 3:50463764-50463786 CCTCCTTGTATGGGACAGACATC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
954429646_954429661 23 Left 954429646 3:50463741-50463763 CCAGCAAGCCCTCAACCCAGTGG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954429661 Original CRISPR CTGTCCCAGGGGGAGAACGA AGG Intronic
900176425 1:1293397-1293419 CTCGCCCAGGAGGAGAGCGAGGG - Exonic
902413796 1:16227184-16227206 CTCTCCCAGGAGGAGAGGGAAGG + Intergenic
904588586 1:31594318-31594340 CTGGCACAGGGGGACAAAGAAGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905460283 1:38118374-38118396 CTGTCTCAGGGTGAGCAGGATGG + Intergenic
906506008 1:46380156-46380178 CTGTCCAAGGGAGAGAAGAAGGG - Intergenic
913241829 1:116836315-116836337 CTGTCCCTGAGGGAGAATGCTGG + Intergenic
914675512 1:149904724-149904746 CTCTAACAGGGGGAGAAGGATGG + Exonic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
916811673 1:168311371-168311393 CTGGGCCAGTGGGAGAACCATGG - Intronic
918092301 1:181308114-181308136 CAGTCCCAGGAGGAGCAGGAGGG - Intergenic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
922153453 1:223023563-223023585 CTGTCCCAGGGAGAGAATATTGG + Intergenic
923211326 1:231806819-231806841 CTGGCCCTGGGGCAGAGCGAAGG + Intronic
1063714561 10:8514170-8514192 CGGTCCCAGGCGGAGATTGAGGG - Intergenic
1063999752 10:11653750-11653772 CTGTTCCAGGGGAAGTATGATGG - Intergenic
1065773675 10:29100496-29100518 CTGACTCAGGGGCAGAACCAGGG - Intergenic
1068120205 10:52776916-52776938 CTGCCCCAGAGGGAGGACGCTGG - Intergenic
1069331126 10:67294626-67294648 CTGTCTCAGTGGGAGAACTGGGG - Intronic
1069951812 10:72024257-72024279 CTGTGCCAGGGGGAGCACACGGG - Intergenic
1071306573 10:84304321-84304343 CTGTACCAGGAAGAGAAGGATGG - Intergenic
1072670659 10:97426642-97426664 CTGTGCCAGGGGGAGGACCCAGG + Intronic
1075420274 10:122295298-122295320 CAGTCAAAGGGGGAGAAAGAGGG + Intronic
1076028042 10:127133056-127133078 CTGTCTCAGGGGGACATTGATGG + Intronic
1076461269 10:130649068-130649090 CTGACCCAGGGACAGAGCGAAGG + Intergenic
1076512533 10:131022738-131022760 GTGTCCCAGGAGGAGGACCATGG - Intergenic
1077034552 11:488398-488420 CTGCCCCCCGGGGAGAATGAGGG - Intronic
1084402451 11:68952762-68952784 CCCTCCCAGGGGGAGAGTGAGGG - Intergenic
1084665007 11:70571634-70571656 CTGTCCTTGGGGCAGAACCAGGG + Intronic
1084760039 11:71264772-71264794 CTGTGCAAGCGGGAGAACCAGGG - Intergenic
1085385117 11:76153143-76153165 GGGTCCCAGGGTGAGAACCAAGG - Intergenic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1085521176 11:77139689-77139711 CTGGCTCAGAGGGAGAAGGAAGG - Intronic
1086701562 11:89905463-89905485 ATGTCCCAGGGTGTTAACGAAGG + Intergenic
1086704605 11:89939062-89939084 ATGTCCCAGGGTGTTAACGAAGG - Intergenic
1086767065 11:90708937-90708959 CTGCCTCAGAGGGAGAACTAAGG - Intergenic
1089745096 11:120611093-120611115 GAGTCCCAGGGGCTGAACGAAGG - Intronic
1091601865 12:1922614-1922636 CTGTCCTGGGGGGGGAGCGAGGG - Intergenic
1092514786 12:9198939-9198961 CAGTCCCAGAGGGAGCACGCAGG - Intronic
1095683545 12:45005995-45006017 ATGTCCCTGGGGGAGTAAGAAGG - Intergenic
1098172777 12:67763280-67763302 CTGACCCAGAGGGAGAAGAAAGG + Intergenic
1099849776 12:88078397-88078419 CTGTCCTATGGTGAGAATGATGG + Intronic
1101092280 12:101299950-101299972 CTGTCCAAGGGGGAGAAAAAGGG - Intronic
1102459746 12:113093231-113093253 CTGGCCCAGGGCGGGAAAGAAGG + Intronic
1104761378 12:131299188-131299210 CTGTCCCGGGGGGAGAGAGGGGG - Intergenic
1104818397 12:131661604-131661626 CTGTCCCGGGGGGAGAGAGGGGG + Intergenic
1105605274 13:21921429-21921451 CAGTCCCAGCTGGAGAACCAAGG - Intergenic
1105771603 13:23617351-23617373 CTGGGCCAGGGGGAGCACCAGGG + Intronic
1108478327 13:50843043-50843065 CAGCCCCAGTGGGAGAAGGAAGG - Intronic
1109872581 13:68353402-68353424 GTGTCACAGGGCGAGAAAGACGG - Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1117129170 14:52667430-52667452 CGGTCCCAGGGTGGGCACGATGG + Intronic
1118846750 14:69553249-69553271 CTGTCCCAGGAGGGGAATAATGG - Intergenic
1119937775 14:78608784-78608806 CTGCCCCAGGGGTAGCACTATGG - Intronic
1121624531 14:95374610-95374632 CTGTTCCAGGGGGAGAGCACAGG - Intergenic
1125751973 15:42035454-42035476 CATTCCCAGCAGGAGAACGAGGG - Intronic
1128350006 15:66882178-66882200 CTGTCCCAGGGAGAGGAGGCCGG + Intergenic
1128915857 15:71561781-71561803 CCCTCCCAGGTGGAGAAGGAAGG + Intronic
1129189003 15:73926907-73926929 CTGATCCAGTGGGAGAACAACGG + Exonic
1130292319 15:82613870-82613892 CTGTCCCAGGGGGGCATTGAGGG - Intronic
1130444072 15:83982455-83982477 CTGATCCAGTGGGAGAAGGATGG + Exonic
1131389015 15:92032246-92032268 GTGTGGCAGGGGGAGAATGAGGG + Intronic
1131400901 15:92124882-92124904 CTGTCCTAGGGAGAGAAAGGAGG + Intronic
1131558282 15:93418021-93418043 CCCTCCCAGGGGCAGAAGGAAGG + Intergenic
1132679089 16:1132432-1132454 CTGCCCCACGGGGAGCAGGAGGG - Intergenic
1133342130 16:5043648-5043670 CTTTCCCAGTGGGAGAAGGAAGG - Intronic
1133831172 16:9324981-9325003 CAGTCCTAGTGGGAGAACGCTGG + Intergenic
1136228070 16:28872198-28872220 CTGTTCCAGGGGGAGCCAGAGGG + Exonic
1138303653 16:55955115-55955137 CTCTCCCTGGGGCAGAAGGAAGG - Intronic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1139648256 16:68347491-68347513 CTGCCCCAGGGAGGGAATGAGGG + Intronic
1141636273 16:85315539-85315561 CTGTCCCACGGAATGAACGAGGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1144829665 17:18124215-18124237 CTGCCCTAGGGGGTGAACAAAGG - Intronic
1144879157 17:18422100-18422122 CTCTCCCAGGGAGAGAAGGCAGG + Intergenic
1147899538 17:43774982-43775004 CAGCCCCAGGGGGAGGAAGATGG + Intronic
1148231318 17:45936939-45936961 CTCTCCCAGGTGGAGAGAGATGG - Intronic
1151368548 17:73632377-73632399 CTCTCACACGGGGAGAAAGATGG - Intronic
1152282184 17:79391312-79391334 CTGTCTCAGGGGGAGAAAAAGGG + Intronic
1153939755 18:9967910-9967932 CTGCCCTAGGGGGAGTGCGATGG - Intergenic
1160319107 18:77873715-77873737 CTGACACAGGGAGAGAAAGAAGG - Intergenic
1160554710 18:79717787-79717809 CTGTCGGAGGAAGAGAACGAGGG - Intronic
1160837496 19:1131723-1131745 CTACCCCAGGGGCAGAAGGAGGG + Intronic
1161050854 19:2163633-2163655 CCGTCCCAGGAGGAGGACGCCGG - Intronic
1161470750 19:4455782-4455804 CTGCCGCAGGGAGAGAAGGAGGG + Intronic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163661288 19:18579308-18579330 CTCTTCCAGGAGGAGAACGATGG + Intronic
1164155719 19:22595954-22595976 CTGCTCCAGGGGCAGAACGGCGG - Intergenic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1165118886 19:33546381-33546403 GTGTCCCAGAGGGACAATGACGG + Intergenic
1165794702 19:38512055-38512077 CTGTCCCTGGGAGAGGAAGATGG - Exonic
1166193330 19:41190450-41190472 CTCTCCCAGGGGTAGAACAGAGG + Intergenic
1166670032 19:44704150-44704172 CAGGCCCAGGCGGAGAGCGACGG - Exonic
1166760450 19:45221011-45221033 CTGTCTCAGGGAGAGACCCACGG - Intronic
1167245133 19:48368754-48368776 CTTTCCCTGGGGGAGGACAACGG - Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167509503 19:49888589-49888611 CTGCCCGAGGAGGAGGACGAGGG + Exonic
1168321486 19:55512931-55512953 CTGGCCCAGGAGGAGAGAGACGG + Intronic
1168671839 19:58246561-58246583 CTGTCCCAGAGATAGAATGAAGG - Intronic
927172485 2:20381797-20381819 CTGTCCCAGAGGGAGCAGAATGG - Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
931705626 2:64944168-64944190 CTCTCCCATGGTAAGAACGATGG - Intergenic
931808377 2:65829963-65829985 CAGTCCCTGGGGGAGAAAAATGG + Intergenic
932207262 2:69894124-69894146 TTTTCCCAGGCGGAGAGCGAGGG + Intronic
935618524 2:105109381-105109403 CTGTCCCAAGGGGAAAGTGAAGG + Intergenic
935949315 2:108314478-108314500 CTGTCTCAGGGCAAGAAGGAAGG + Intergenic
936520923 2:113211724-113211746 CTCTCCCAGGGGGAAAACAAAGG + Intergenic
937927237 2:127176695-127176717 CTGGCCCATGGGAAGAACGTTGG - Intergenic
940236025 2:151511702-151511724 CTATCCCAGGGTGTGAAGGATGG + Intronic
940873281 2:158878092-158878114 ATGTCCCAGGGTGTGAACCAAGG + Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170854567 20:20039266-20039288 CTGGCCCACCCGGAGAACGAGGG - Intronic
1172356373 20:34283101-34283123 CAGTTCCAGAGGTAGAACGATGG + Intronic
1174178217 20:48658203-48658225 CTGCCCCAGGAGGAGGACTATGG - Exonic
1174613806 20:51820525-51820547 GTGTCCCCAGGGGAGAACCAAGG + Intergenic
1176972325 21:15281090-15281112 CTGTCCCAGGGTGATAACTAGGG - Intergenic
1178185093 21:30209571-30209593 CTGTCTCAGGGGGATAACCTCGG - Intergenic
1180107569 21:45630083-45630105 CTGTACCACGGGGCCAACGAGGG - Intergenic
1180919143 22:19510533-19510555 CTGTCTCAGGTGGCGGACGAGGG - Intronic
1182112202 22:27731722-27731744 CTGTCCCATGGGGCTCACGATGG - Intergenic
1183178912 22:36245385-36245407 CTGGACCAGGGGCAGAACCAGGG + Intergenic
1183272091 22:36868619-36868641 CTAGCCCAGGGGGAGAAGGGTGG - Intronic
1185292092 22:50032272-50032294 CTGTCCCAGATGGAGAAACAGGG + Intronic
1185315715 22:50178351-50178373 CTGTCCCAGGCGGAGGACTGTGG + Exonic
949624897 3:5854175-5854197 TTTTCCCAGGGGGAAAACCAGGG - Intergenic
954380645 3:50217285-50217307 CAGTGCCAGGGGCAGAATGATGG - Exonic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
957303968 3:78431894-78431916 CTAGCCCTGGGGGAGAATGAGGG + Intergenic
960853772 3:122081985-122082007 CTGACTCAGGGTGAGAGCGATGG + Intronic
961514135 3:127422533-127422555 GTGTCCCAGAGGGACAAGGAAGG + Intergenic
966936269 3:184711760-184711782 CAGGCCGAGGGGGAGAAGGATGG - Exonic
971181085 4:24329137-24329159 CTGACCCAGGGTGAGAATGCTGG + Intergenic
975543888 4:75542024-75542046 ATGTCCCAGGGGGATGATGAAGG - Intronic
975990356 4:80253428-80253450 ATCTCCAAGGGGGAGAAAGAGGG + Intergenic
985551560 5:535766-535788 CTGTGCCTGGGGGAGCACGTTGG - Intergenic
986015592 5:3754518-3754540 GTGTCCCAGGAGGAGAACCTGGG + Intergenic
986798540 5:11235772-11235794 CAGTCCCAGGGGAAGAGAGATGG + Intronic
990485313 5:56252557-56252579 CTTTCCCTGAGGGAGAAAGAGGG - Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
996325387 5:122267354-122267376 CTGTAGCAGGGAGAGAACGGTGG + Intergenic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
998159733 5:139806621-139806643 CTGGCCCTGGGGGAGAACAGAGG + Intronic
999202165 5:149824231-149824253 CTTTCCCAGGGAGAGTACCAAGG - Intronic
1000933317 5:167279355-167279377 GAGTCCCAGGAGGAGAAAGAAGG - Intergenic
1003066949 6:2911963-2911985 CTATCACATGGGGAGAATGATGG - Intergenic
1003302471 6:4896606-4896628 ATGTGCCAGAGGGCGAACGAGGG - Intronic
1003874205 6:10422342-10422364 CTATCCCAGGGGGAGAAGCGGGG - Intergenic
1004094100 6:12535647-12535669 CTCTAACAGGGGGAGAAAGAGGG - Intergenic
1004380527 6:15128553-15128575 CTAGCCCAGGGGGAGAATGAGGG - Intergenic
1011310366 6:85974120-85974142 CTCTTCCAGGAGGAGAACAATGG - Intergenic
1013667445 6:112362727-112362749 CTGTCCGGGGAAGAGAACGAGGG + Intergenic
1016387435 6:143542218-143542240 CTCTCCCTGGGGGAGAAGGAAGG - Intronic
1016616297 6:146052455-146052477 CCTTCCCATGGGGAGAAGGATGG + Intronic
1017885998 6:158599862-158599884 CTGGCCCAGGAGGAGCACGCAGG + Intronic
1018081062 6:160259667-160259689 CTTGCCCCGGGGGAGAATGATGG - Intronic
1019174585 6:170153739-170153761 GTGTCCCCGGAGGAGAGCGAGGG + Intergenic
1019289134 7:241475-241497 CTGTGCCAGGGAAAGATCGATGG + Intronic
1023590794 7:41778729-41778751 CTGAGCCAGAGGGAGAAGGAAGG - Intergenic
1025078472 7:55963324-55963346 CAGTCCCAGGGGAAGAAGGGAGG - Intronic
1026879988 7:73901932-73901954 CTGGCACTGGGGGAGAAGGAGGG - Intergenic
1029870932 7:103692181-103692203 CTGTCCCAGTGGGATCACGAAGG + Intronic
1035231490 7:157468579-157468601 CTGTCCCCGTGTGAGAACGCGGG - Intergenic
1035311249 7:157970410-157970432 CAATCCCAGGGGAAGAAAGAAGG + Intronic
1036867919 8:12416846-12416868 CTGTCTCCTGGGGAAAACGAGGG - Intergenic
1038223456 8:25632535-25632557 CTGTCCCAGGCTGAGGAAGATGG + Intergenic
1041385665 8:57299239-57299261 CTGTCCCAGTGGAAGAATCAGGG - Intergenic
1041699884 8:60776516-60776538 CTGTCCCAGGCTGAGAGAGAGGG - Intronic
1044725484 8:95191220-95191242 CTCTCCCAAGGGGAGAACAGAGG + Intergenic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1048844604 8:138594704-138594726 CTACCCCAGGCGCAGAACGACGG + Intronic
1049311195 8:141934808-141934830 CAGCCCCAGGGGGAGAGGGAGGG - Intergenic
1051093964 9:13443726-13443748 CTGTGCCAGAGAGCGAACGAAGG - Intergenic
1053347546 9:37388945-37388967 CTGTCCCAGTGTGAGAAGCACGG - Intergenic
1056306857 9:85299037-85299059 ATGTCCCAGGGTGAGAAAGCTGG + Intergenic
1059433772 9:114264719-114264741 CTGCTCCAGGTGGAGAACCAAGG - Intronic
1060813913 9:126625064-126625086 TTGTCCCACGGAGTGAACGACGG + Intronic
1061857425 9:133449856-133449878 CGGGCCCATGGGGAGGACGATGG + Exonic
1186110077 X:6246399-6246421 CTGTCCAAGGGGGAAAAGGGTGG - Intergenic
1186473976 X:9842861-9842883 CTGTCTTAGGGAGAGAAGGAGGG + Intronic
1187224207 X:17360208-17360230 TTGTCCCAGGGGAAAAAAGAGGG + Intergenic
1190960989 X:55247391-55247413 CTGTCCCAGGGTGGGATCGAGGG + Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1195741187 X:108066256-108066278 CTGCCACATGGGGAGAAAGATGG + Intronic
1200831767 Y:7692678-7692700 CTGCCCCAGGGAGAGAGGGATGG + Intergenic