ID: 954431143

View in Genome Browser
Species Human (GRCh38)
Location 3:50471441-50471463
Sequence CAGAAGAGGAAGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1711
Summary {0: 1, 1: 0, 2: 13, 3: 206, 4: 1491}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954431143_954431148 2 Left 954431143 3:50471441-50471463 CCAGCTTCCTTCTTCCTCTTCTG 0: 1
1: 0
2: 13
3: 206
4: 1491
Right 954431148 3:50471466-50471488 CCAGCCCCTCTTAGGTTCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
954431143_954431146 -6 Left 954431143 3:50471441-50471463 CCAGCTTCCTTCTTCCTCTTCTG 0: 1
1: 0
2: 13
3: 206
4: 1491
Right 954431146 3:50471458-50471480 CTTCTGCTCCAGCCCCTCTTAGG 0: 1
1: 0
2: 3
3: 51
4: 297
954431143_954431154 20 Left 954431143 3:50471441-50471463 CCAGCTTCCTTCTTCCTCTTCTG 0: 1
1: 0
2: 13
3: 206
4: 1491
Right 954431154 3:50471484-50471506 TGAGGTTCCCTGGCACTTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 110
954431143_954431152 10 Left 954431143 3:50471441-50471463 CCAGCTTCCTTCTTCCTCTTCTG 0: 1
1: 0
2: 13
3: 206
4: 1491
Right 954431152 3:50471474-50471496 TCTTAGGTTCTGAGGTTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 182
954431143_954431153 19 Left 954431143 3:50471441-50471463 CCAGCTTCCTTCTTCCTCTTCTG 0: 1
1: 0
2: 13
3: 206
4: 1491
Right 954431153 3:50471483-50471505 CTGAGGTTCCCTGGCACTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954431143 Original CRISPR CAGAAGAGGAAGAAGGAAGC TGG (reversed) Intronic
900274612 1:1816138-1816160 AGGGAGAGGAGGAAGGAAGCAGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900496890 1:2979784-2979806 CAGAGGTGGAAGCAGGAGGCTGG - Intergenic
900502748 1:3014506-3014528 GGGAAGGGGAAGGAGGAAGCTGG + Intergenic
900537564 1:3186385-3186407 GCCAAGAGGAAGATGGAAGCCGG + Exonic
900597429 1:3488494-3488516 CAGAAGAGAAAGAAGCCAGGAGG - Intergenic
901035143 1:6331887-6331909 CAGAAGAGACGGCAGGAAGCAGG + Intronic
901185288 1:7368955-7368977 CAGAAGCAGAAGGAGGAAGGTGG - Intronic
901269733 1:7942513-7942535 CAGAAGCAGAAGAAGGCAGACGG + Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901644360 1:10708803-10708825 GGGAAGAGGAAGAGGGAAGGTGG + Intronic
902242236 1:15096712-15096734 CACATGGGGAAGAAGGAAGAGGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902700019 1:18165867-18165889 CAGAAGAGAACAAAGGAAGGAGG - Intronic
902795943 1:18800378-18800400 CGGAACAGGAGGAAGGAAGAAGG - Intergenic
903052365 1:20611299-20611321 CAGAAGAGTAAGAAGGATGGTGG + Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903418611 1:23201920-23201942 CAGATGAGGAAGAAGGGCCCAGG - Intergenic
903451946 1:23459677-23459699 CAGAAGAGGAAGAGTGGTGCTGG + Intronic
903455627 1:23484620-23484642 CAGCAGAGGAGGGAGGAAGAGGG - Intergenic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903553663 1:24177489-24177511 CACGGGAGAAAGAAGGAAGCTGG + Intronic
903740662 1:25556628-25556650 CAGAAGGGGAAGCAGAAAGCAGG - Intronic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903857819 1:26346985-26347007 GAGAAAAGGAAGAAGGCAGAAGG + Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904170652 1:28590237-28590259 CAGAAGAGGAAGCAGGGATCAGG + Intronic
904274017 1:29368692-29368714 CAGAAGAAGAGAAAGGAAACAGG + Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904684197 1:32248762-32248784 CAGCAGAGGAAACAGGATGCTGG - Exonic
904901917 1:33864480-33864502 CAGAAGAGTAGGAAGGATGATGG - Exonic
904920316 1:34002942-34002964 CAGGAGAGGAAGCCGAAAGCAGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905137839 1:35813780-35813802 AGGAAGAGGAAGAAGGAAGAAGG + Intronic
905385602 1:37601689-37601711 CAGAAGAGCAAGAGGGATGGAGG - Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905511193 1:38521791-38521813 CAGTAGAGGCCAAAGGAAGCCGG + Intergenic
905575815 1:39043800-39043822 AAAAAGAGGAAGAAGAAAGGAGG + Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905948314 1:41922786-41922808 TAAAAAAGGAAGAAGGAAGGAGG + Intronic
906120078 1:43383719-43383741 CAGAACAGAAAAAAGGCAGCTGG + Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906639321 1:47432250-47432272 GAGAAGAGCAGGCAGGAAGCAGG + Intergenic
906794803 1:48688349-48688371 GAGATGAGGAAGCAGGAAGGAGG - Intronic
907110526 1:51922588-51922610 CAGTAGAGGTGCAAGGAAGCTGG - Intronic
907789692 1:57650123-57650145 AAGACGAAGAAGAAGGAATCCGG - Intronic
908114935 1:60931397-60931419 CAGAGGAGGAAGCAAGGAGCGGG - Intronic
908640026 1:66212311-66212333 CAAAAGAGTAAGAAGGAAAGTGG - Intronic
909043211 1:70678224-70678246 CTGAGGAGGAAGAGGGAAACAGG + Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
909344818 1:74572695-74572717 CAGGAGAGGCAGAGGCAAGCCGG - Exonic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
910798862 1:91125268-91125290 CAGAAGAGAAAGCTGGAAGACGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911214028 1:95172555-95172577 GTGATGAGGAAGAAGGAAGGAGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911888879 1:103341572-103341594 ATGAAGAGGAGGAAGAAAGCAGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912681489 1:111732022-111732044 CTGAAGGGCAAGAAGGCAGCTGG + Intronic
912745678 1:112243636-112243658 AAGAAGAGCATGAAGGAAGGAGG + Intergenic
912753891 1:112308515-112308537 GAGAAGAGGAAGAGAAAAGCTGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913260115 1:116990066-116990088 CAACAGAGGAAGAAGGGAACTGG + Exonic
913332507 1:117679132-117679154 TAGAGAAGGAAGAAGAAAGCAGG - Intergenic
914320636 1:146556266-146556288 GAGAATAGTAAGAGGGAAGCTGG - Intergenic
914873172 1:151492401-151492423 CAGAGAAGGAAGACTGAAGCAGG - Intergenic
915247464 1:154566952-154566974 CAGATGAGGTTGAAGTAAGCAGG + Intergenic
915695864 1:157740393-157740415 CAGATGCTGAAGGAGGAAGCTGG - Intergenic
915789639 1:158654273-158654295 CAGAAGAGGAACAAGCAAAGAGG + Intronic
915838805 1:159199312-159199334 GAGAAAAGAAAGAAGGAAACAGG + Intronic
916206203 1:162318638-162318660 AAGAAGAAGAAGAAGAAAGGGGG - Intronic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916882338 1:169032051-169032073 GAGAAGAAGAAGAAGAAAGAAGG - Intergenic
916899266 1:169202939-169202961 GAGAAGAGAAAGGAAGAAGCTGG + Intronic
917176697 1:172243468-172243490 CTGAAGAGGAGGTAGGAACCAGG + Intronic
917235521 1:172888062-172888084 CAGAAGATGAAGCGGGGAGCTGG + Intergenic
917537503 1:175884955-175884977 AAGGAGAGGTAGATGGAAGCAGG - Intergenic
917616732 1:176753469-176753491 GAGCAGAGGAAGAAGAAGGCTGG - Intronic
917690379 1:177462366-177462388 CAGAAGGGGAAGAATGGAGCAGG - Intergenic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
917834639 1:178931628-178931650 AAAAAGAGGAAGAAGAAAGGGGG + Intergenic
917849902 1:179052838-179052860 CAGGATAGGAAGAAGGGAGTTGG - Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
918086304 1:181248025-181248047 CAGAAGAGGCAGAAGCATACTGG - Intergenic
918251951 1:182710693-182710715 CACAAGAGGAGGAGGGATGCAGG + Intergenic
918447721 1:184631614-184631636 CAGAAGAGCAGGAAGAAGGCAGG + Intergenic
919104418 1:193131186-193131208 CAGAAGGGAAAGAGGGAATCAGG - Intronic
919232529 1:194792438-194792460 CAGGAGAGAAAGAAAGAAGGAGG + Intergenic
919434832 1:197544977-197544999 AGGAAGGGGAAGAAGGAAGAAGG + Intronic
919553833 1:199026996-199027018 AATAAGAGGAGGAAGGAAGGTGG - Intergenic
919846142 1:201643416-201643438 AAAAAGAGAAAGAAGGAAGGAGG - Intronic
919862944 1:201754328-201754350 CAGAGGAGGAAGAAGGAATCTGG + Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920232731 1:204481223-204481245 CAGAAGAGAAGAGAGGAAGCTGG + Intronic
920674233 1:208028263-208028285 CAGAAGAGAAATAGGGAGGCAGG - Intronic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921990638 1:221362440-221362462 TAGAAGAGGAACAAAGAAGGAGG - Intergenic
922010154 1:221575365-221575387 AGGAAGAGGAAGAAAGAAGGTGG + Intergenic
922168776 1:223137822-223137844 CATAAAAGAAAGAAGGAAGGAGG - Intronic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922428293 1:225520868-225520890 AAGAAAAGAAAGGAGGAAGCGGG + Intronic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922738528 1:228002972-228002994 CTGAGGAGGAAGACAGAAGCGGG + Intergenic
923051334 1:230393142-230393164 AAGAAGAGGAGGAAGGAAAAAGG + Intronic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923595979 1:235361173-235361195 AAGAAGAGGAAGCAGGGAGCCGG - Intergenic
923622305 1:235588695-235588717 AAGAAGAGGATGAAGGGAGGGGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923927458 1:238649060-238649082 CAGAAGGTGAAAAAAGAAGCAGG + Intergenic
923999813 1:239538064-239538086 CAGAAGAGAAAAAAGGAAGAAGG + Intronic
924067250 1:240236609-240236631 CAGAAGGTGAAGAGGGGAGCAGG + Intronic
924427954 1:243970983-243971005 CAGAAGAGGACCAAACAAGCAGG - Intergenic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924666489 1:246078456-246078478 CAGAAGTGGAACAAGAAGGCCGG - Intronic
924680364 1:246224882-246224904 CAGAAGCAGAAAAAGGAAGGTGG + Intronic
924691104 1:246351736-246351758 TAGAAGCGGGGGAAGGAAGCTGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063330682 10:5155929-5155951 GAGAAGAGGCAGAATGAAGGTGG - Intergenic
1063426342 10:5953005-5953027 GAGAAGAGGTGCAAGGAAGCGGG - Exonic
1063718631 10:8555888-8555910 CAGTCGAGGAACATGGAAGCAGG - Intergenic
1063917246 10:10895920-10895942 TGGAAGGGGAAGAAGGAGGCTGG + Intergenic
1063945426 10:11171520-11171542 ATGAACAGGAAGAAGGAAACAGG + Intronic
1064278405 10:13928833-13928855 AGGGAGAGGAAAAAGGAAGCTGG - Intronic
1064310172 10:14205434-14205456 CAGAAGATCAGTAAGGAAGCTGG - Intronic
1064322255 10:14316528-14316550 AAGAAGAAGAAGAAGAAACCAGG + Intronic
1064347076 10:14541822-14541844 CAGAAGAGCTAGGAGAAAGCTGG + Intronic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064868820 10:19914025-19914047 AAGAAGGGAAGGAAGGAAGCAGG + Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1065228502 10:23572147-23572169 CAGAAGAGAAAAAAGGAAAAAGG + Intergenic
1065281098 10:24139507-24139529 GAAAAGAGTAAGAATGAAGCAGG - Intronic
1065885481 10:30073158-30073180 CAGAAGAGGAAGAAGTACGTAGG + Intronic
1066130062 10:32384510-32384532 CTGAACAGAAAGAAGAAAGCTGG + Intergenic
1066402679 10:35090590-35090612 CAGCAGCGGAAGAAGGAGACCGG - Intronic
1066650211 10:37647975-37647997 CAGAAATGGAAGGAGGGAGCAGG + Intergenic
1066789195 10:39044214-39044236 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067516081 10:46945946-46945968 TAGAGGAGGCAGAAGGAATCTGG + Intronic
1067555202 10:47264806-47264828 CTGAAGAGGAAGGACGAAGCCGG + Intergenic
1067646167 10:48105864-48105886 TAGAGGAGGCAGAAGGAATCTGG - Intergenic
1067902329 10:50255235-50255257 AAGAAGAAGAAGTAGGAAGGGGG + Intergenic
1068113469 10:52709511-52709533 AAGAAGAAGAAGAAGAAACCAGG - Intergenic
1068165016 10:53319086-53319108 ATGAAGAGGAAGAAGGAAAAAGG + Intergenic
1068225910 10:54107020-54107042 TAGATGAGAAAGAAGGAAGAAGG - Intronic
1068331951 10:55582449-55582471 CAGAAGAGTAAAAAGGAATTGGG + Intronic
1068553818 10:58435574-58435596 GGGAAGAGGAAGAATGAATCAGG + Intergenic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1068909560 10:62364447-62364469 CTGAAGAGGAAGAGCAAAGCTGG + Intergenic
1069219081 10:65860709-65860731 CAGAAGAAGAAGAAAGAAACAGG + Intergenic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1069304769 10:66955716-66955738 CAGAAGAGGAAGAACAATGGAGG - Intronic
1069718480 10:70535436-70535458 AAGAGGGGGAAGGAGGAAGCGGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070402421 10:76065349-76065371 CACAATAGAAAGAAGGAAGGTGG + Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070631036 10:78084857-78084879 CAGAAGAGGAAAATGGGACCAGG - Intergenic
1070650203 10:78229843-78229865 CAGAGGGGGAAGAAGATAGCAGG - Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071729369 10:88232573-88232595 AAGAAGTGGAAGTAAGAAGCTGG - Intergenic
1071885439 10:89944695-89944717 CAGATGAGGAAGAAAGAAAAGGG - Intergenic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1072022531 10:91417074-91417096 CAGAAGATGAATGAGGAAGTAGG + Intronic
1072453520 10:95557877-95557899 CAGACGAGAAAGTAGGAGGCTGG - Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072927246 10:99626870-99626892 CAAAAGTGGAATAAGGAATCTGG - Intergenic
1073004700 10:100314422-100314444 GAGAAGAGAGAGAAGGAAGCAGG + Intronic
1073122887 10:101132891-101132913 CAGCAGAGGAAGGCGGGAGCGGG - Intronic
1073354473 10:102843094-102843116 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073638301 10:105221900-105221922 AAGAAGAGAAAGAAGGAGGGAGG + Intronic
1073718943 10:106143036-106143058 CAGAAGATGCTGAAGGCAGCTGG - Intergenic
1073891177 10:108103686-108103708 TAGAAGAGGGAGAGAGAAGCAGG - Intergenic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1073959633 10:108911927-108911949 GTGGAGAGGAAGAAGGGAGCAGG - Intergenic
1074284299 10:112083510-112083532 CAGAAGAGGAAAATGGGAGGGGG - Intergenic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074732161 10:116390746-116390768 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1074885752 10:117691880-117691902 GAGTGGAGGAAGGAGGAAGCAGG - Intergenic
1074964322 10:118475424-118475446 CCAAAGAGAAAGAAGGATGCTGG - Intergenic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075651540 10:124130739-124130761 CAGAAGAGGAAGGAGACAGCAGG - Intergenic
1075699442 10:124459718-124459740 CATAAGGGAAAGAGGGAAGCAGG - Intergenic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1075888199 10:125920978-125921000 CCGGAGAGGAAGCAGGAAGGTGG - Intronic
1076023690 10:127094630-127094652 CAGCAGAGGAAGAAAGATGCAGG - Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1076699297 10:132262238-132262260 CACATGAGGAAGAATGAAGCTGG + Intronic
1076805524 10:132856598-132856620 CAGGAGATGAAGAAGGCACCAGG - Intronic
1076924115 10:133473127-133473149 CAAAAGAGGAACAAGAAAGAGGG - Intergenic
1077167599 11:1150743-1150765 GGGAAGATGAAGATGGAAGCAGG + Intergenic
1077202030 11:1313567-1313589 CAGATGAAGAAGAATGAAACTGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077973470 11:7221133-7221155 CAAAGGAGTAAGAAGGAAACTGG - Intergenic
1078077136 11:8172415-8172437 AAGAAGAGGAAGAAGCAATTTGG + Intergenic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078254665 11:9647591-9647613 CAGAAAAGGAAGAAAAAAGCTGG + Intergenic
1078308003 11:10210343-10210365 GAGAAGAGGAAGAAAGGAGGAGG + Intronic
1078522279 11:12073116-12073138 TAGAAGTGGAAGAGGGAGGCAGG + Intergenic
1078524158 11:12087835-12087857 AAGAGGAGGAAGAAGTTAGCTGG - Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1078862522 11:15263259-15263281 CAGAAGAGGAGGAGAGAATCAGG + Intergenic
1079141350 11:17812070-17812092 CAGAAGGGGCAGGAGGCAGCTGG + Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080325019 11:31061565-31061587 AAGAAGAAGAAGAAGGCACCTGG + Intronic
1080456976 11:32427287-32427309 GAGAAGAGGAAGCACGGAGCGGG + Intronic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080884132 11:36349854-36349876 CACAAGAGGAAAATGGAACCTGG + Intronic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1082743394 11:56936250-56936272 CAGAAGAGAGATAAGAAAGCAGG + Intergenic
1082809210 11:57468423-57468445 CAGAAGAGGCAGAAGACAGATGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083144117 11:60745734-60745756 CAGAAAAGGAAGAAGATAGAGGG + Intergenic
1083179398 11:60974539-60974561 TAGAAAGGGAAGAAGGAGGCTGG - Intronic
1083894744 11:65614222-65614244 GGGAGGAGGAAGAAGGGAGCGGG - Exonic
1084366584 11:68705199-68705221 CAGAAGACGAAGCAGGGAGGAGG - Intergenic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084869929 11:72091513-72091535 CAGAAGAGAGTGAAGAAAGCTGG + Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085034561 11:73292277-73292299 GAAAAGAAGAAGAGGGAAGCGGG + Intronic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085264050 11:75225915-75225937 CAGAAATGGAAGAAGAGAGCAGG - Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085405556 11:76259746-76259768 AGGAAGAGGAAGAAGGAATCTGG + Intergenic
1085440624 11:76559360-76559382 TAGAAGAGGAAGAAGCAGGTAGG + Intergenic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085752955 11:79177960-79177982 AAGAAGAGCAAAGAGGAAGCAGG + Intronic
1085807655 11:79651032-79651054 AGGAAGAAGAAGAAGGAAGGAGG - Intergenic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1085918464 11:80921626-80921648 CAGAAGAGAACAAAGGAAGGAGG - Intergenic
1085925827 11:81019336-81019358 AGGGAGAGGAAGAAGGAAGGAGG - Intergenic
1086101718 11:83107296-83107318 AGGAAGAGGAAGAAATAAGCTGG - Intergenic
1086159560 11:83706582-83706604 GAGAAGAGGAAAGAGGAAGCAGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086269558 11:85045080-85045102 CCCAAGAGGAAGAAGGGTGCAGG - Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086506470 11:87509747-87509769 AAGAAAAGGAAGAAGGGAGGGGG - Intergenic
1086507574 11:87521946-87521968 CAGAAGAGGAAGACAGAAGAAGG + Intergenic
1086511987 11:87568689-87568711 CAGATGTAGAAGAATGAAGCTGG + Intergenic
1087681104 11:101219339-101219361 CAGAAGAGGCAGAAGTATACTGG + Intergenic
1087732074 11:101790223-101790245 AAGAAGAGGAAGAAGGAGAAAGG + Intronic
1087812690 11:102625156-102625178 CAGAGGAGCAAGAAGGAATTGGG + Intronic
1087827376 11:102781307-102781329 AAGAAGAGGAAGAGGGTAGGAGG - Intergenic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1088288402 11:108210457-108210479 CAGAAGGTGAAGGGGGAAGCTGG - Intronic
1088963643 11:114696034-114696056 AAGAAGAAGAAGAAGAAATCAGG + Intronic
1089055912 11:115584666-115584688 GAGAAGAGGAAGAAGTAATGAGG + Intergenic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089148738 11:116348456-116348478 TAAAAGAGGAAACAGGAAGCAGG - Intergenic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089290930 11:117437631-117437653 CAGTAGAGGAGGAAGGGAGCTGG + Intronic
1089391475 11:118104850-118104872 AAGAGGAGGAAGGAGGAAGGAGG - Intronic
1089513669 11:119018019-119018041 GACAAGAAGAAGAAGGACGCTGG - Exonic
1089636922 11:119820797-119820819 CAGAAGAGGAAGATCTGAGCTGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089742136 11:120591825-120591847 AAGAAGAGGAGGAGGGATGCAGG - Intronic
1089798376 11:121002379-121002401 GAGAAGAAGAAGAAGGGAGGGGG + Intergenic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090146605 11:124330340-124330362 CAGAACAGGAAGAGTGAAGGTGG - Intergenic
1090394416 11:126409230-126409252 CAGAAGAGAGAGACAGAAGCGGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090497730 11:127230978-127231000 CAGACAAGGAAGCAGGAAGTTGG + Intergenic
1090507316 11:127331415-127331437 AAGAGGAGGAAGAAGGAAAAAGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1091467527 12:698217-698239 CAGAAGAGGACAAAGGAAGGAGG - Intergenic
1091618305 12:2066712-2066734 CAGATGGGGAAGAAGGCAGTAGG + Intronic
1091647119 12:2282288-2282310 AAGAAGAAGAGGGAGGAAGCAGG - Intronic
1091680210 12:2521624-2521646 CAGGAGAGGAAAGAGGAAGGCGG - Intronic
1091753269 12:3035837-3035859 AAGAAGAAGAAGAAGAAAACAGG + Intronic
1091788791 12:3259225-3259247 AAGAAGAGCAAGAAGGAACTTGG - Intronic
1091843690 12:3638358-3638380 CAGAAGAGGAGCCAGGAACCGGG - Exonic
1091896780 12:4111260-4111282 AAGAAGAAGATGTAGGAAGCTGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092276033 12:7061551-7061573 CAATAGAGGAAGAAGAAAACTGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092998247 12:13971481-13971503 CAGAGGAGGAAGAGGGTAGGAGG - Intronic
1093039821 12:14365348-14365370 TAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1093042470 12:14399383-14399405 CAGAAGAGAAAGAATTAAACTGG - Intronic
1093164582 12:15789884-15789906 CAGAGGAGGAAGACGAAGGCTGG - Intronic
1093212247 12:16321855-16321877 CATAAGCAGAAGAAGGAAACAGG - Intergenic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093755277 12:22845558-22845580 AAGAAGAGGAAGAGGAAAGAAGG - Intergenic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1093850545 12:24031526-24031548 CAGAGGTGGATGAAGGAGGCTGG + Intergenic
1093993183 12:25612958-25612980 TAGAAGAGGAAGAAGGCAATGGG + Intronic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1094622463 12:32093215-32093237 CAGAAGAGGCTTAAGGCAGCAGG + Intergenic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094745863 12:33343475-33343497 AGGAAGAAGAAGAAGAAAGCAGG - Intergenic
1095133387 12:38569045-38569067 ACAAAGAGGAAGAAGGAAGGAGG - Intergenic
1095636066 12:44435063-44435085 CAGAAGGTGAAGAGGGGAGCAGG - Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096311417 12:50524565-50524587 AAAAAAAGGAAGAGGGAAGCGGG - Intronic
1096333743 12:50737260-50737282 CAGAAGAGGGAGATTGAAACTGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096596432 12:52698839-52698861 CAGAGGAGGAAGCAGGATTCTGG - Intronic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096720321 12:53516593-53516615 AGGAAGAGGAAAAAGGAAACGGG + Exonic
1096879420 12:54655332-54655354 CAGAACAGGAAGAAGGGAAGTGG - Intergenic
1096889268 12:54750336-54750358 AAGAAGAAGAAGAAGAAAGTAGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097092317 12:56516585-56516607 CAAAAGAAGAAGAAGAAATCTGG + Intergenic
1097098720 12:56570989-56571011 CAGAAGAGGATTAAGGTTGCTGG + Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097613592 12:61857702-61857724 AAGAAGAGAAGGAAGGAAGGAGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098472618 12:70862973-70862995 CATAAAAGGAAGAAGGAAACTGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098558157 12:71842511-71842533 GTGAAGAGGAAGAAGCAAGAAGG + Intronic
1098891879 12:76017698-76017720 GAGAAAAGAAAGAAGGAACCCGG + Intergenic
1098896831 12:76072319-76072341 AAAAACAGGAAGAACGAAGCAGG + Intronic
1098986956 12:77022933-77022955 CAGAAGAGTAAGAGGGAAAATGG - Exonic
1099145262 12:79035569-79035591 CAGAAGAGGAGGAAGGCATGAGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099497463 12:83368306-83368328 GAGAAGATGCAGAAGTAAGCAGG - Intergenic
1099645212 12:85344409-85344431 CGGAAGAGAAACAAGGAAGATGG + Intergenic
1099959205 12:89380472-89380494 TAGAAGGGAGAGAAGGAAGCAGG - Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100877269 12:98975301-98975323 AGGAAAAGGAAGAAGGAAGGAGG - Intronic
1101035865 12:100705828-100705850 CAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1101128731 12:101666470-101666492 GAGAAGAGGAGAAAGGAGGCTGG - Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101905948 12:108826619-108826641 CAGAAGAGAAGCCAGGAAGCCGG - Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102194436 12:111014534-111014556 AAGAAGAAGAAGAAGAAAGGGGG + Intergenic
1102201651 12:111061509-111061531 GAAAAGAGGAAGAAGGAGACTGG + Intronic
1102282333 12:111628185-111628207 TAGAAAAGGGAGAAAGAAGCTGG + Intergenic
1102413788 12:112743022-112743044 CAGAAGAGGAAGTAGGACACGGG - Intronic
1102544195 12:113642759-113642781 AAGAAGGGAAAGAAGGAAGGAGG - Intergenic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1103022983 12:117551286-117551308 AGGAATAGGAAGAAGGAAGGAGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103091023 12:118098170-118098192 CAGAAGGGGTAGAAAGAAGAGGG + Intronic
1103155417 12:118680552-118680574 GGATAGAGGAAGAAGGAAGCTGG - Intergenic
1103555475 12:121763793-121763815 CCCAGGAGGAAGGAGGAAGCAGG - Intronic
1104110612 12:125700763-125700785 CAGAAGAGGAGGAGGGAGTCGGG + Intergenic
1104124483 12:125833209-125833231 CAGATGACAAAGAAGAAAGCTGG - Intergenic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104688772 12:130808318-130808340 CAGGAGAGGAAGGAGGAAAGGGG - Intronic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1104777701 12:131400971-131400993 CAGAAGAGGATGAAGGGGGCGGG - Intergenic
1104782811 12:131432657-131432679 AGGAAGAGGAGGAAGGGAGCAGG + Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105806050 13:23952103-23952125 CAGAAGTGGCAGGAGGCAGCAGG - Intergenic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106333016 13:28756483-28756505 CAGCAGAGGAAAGAGGAGGCTGG + Intergenic
1106566640 13:30890678-30890700 CAGAAGGGAAGCAAGGAAGCAGG - Intergenic
1106655921 13:31745945-31745967 CAGCAGAGCAACAAGGATGCTGG + Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106788032 13:33126584-33126606 TACAAGAGGAAGAAGAAATCTGG + Intronic
1107005490 13:35604911-35604933 CAGCTGAGGAAGAAGGGAGCAGG - Intronic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107448930 13:40491448-40491470 TAGAAGGGGAAGGAGGAAGAAGG - Intergenic
1107526109 13:41233280-41233302 GAGTAGAGGAAGTAGGAAGAGGG + Intronic
1107566920 13:41614371-41614393 CCGCAGAGGAAAAAGGAAGACGG + Intronic
1107909025 13:45087807-45087829 CATGTGAGGATGAAGGAAGCAGG - Intergenic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108584973 13:51863233-51863255 AAGGAGAGGGAGAAGCAAGCTGG + Intronic
1108722035 13:53142041-53142063 TACAAGAGGAAGAAGGCAGCAGG - Intergenic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109411339 13:61973295-61973317 GAGAAGAGGAAGGAAGAAACTGG + Intergenic
1109585097 13:64390062-64390084 CAGATGATGAAGAAAGAACCAGG + Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1109770622 13:66967034-66967056 AAGAAAAGGAACAAGGAAGGAGG + Intronic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110010891 13:70332028-70332050 CAGGGGAGAAAGATGGAAGCCGG - Intergenic
1110278721 13:73668001-73668023 CGGAAGATAAAGAAGGAAGCAGG - Intergenic
1110311736 13:74057834-74057856 ATGAAGAGTAAGAAGGAAGGAGG + Intronic
1110649910 13:77932151-77932173 CGGAAGAGGAAGATGAAAGAGGG + Intergenic
1110880510 13:80566561-80566583 CAGAAGAGGAAAAAGGCAAAAGG - Intergenic
1111182412 13:84686584-84686606 CACAGGAGAAAGAAGGAGGCTGG - Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111732033 13:92088352-92088374 GAAAAGGAGAAGAAGGAAGCTGG + Intronic
1112254166 13:97813987-97814009 CATATGAGGAAGAATGAAACTGG + Intergenic
1112254177 13:97814068-97814090 CATATGAGGAAGAATGAAACTGG + Intergenic
1113166288 13:107447220-107447242 GAGAAGGGGAAGAAAGAAGAAGG - Intronic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113346390 13:109482526-109482548 GGGAAGAGGGAGAGGGAAGCAGG + Intergenic
1113499229 13:110760176-110760198 CAGAGGAGGAAGCAGCAGGCAGG + Intergenic
1113771040 13:112909130-112909152 CAGAAGCGGATGAGGCAAGCAGG - Intronic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114552614 14:23542057-23542079 GAGAAGAGGAGGGAGGAAGAAGG + Intronic
1114612331 14:24051272-24051294 GAGATGAGAGAGAAGGAAGCTGG + Intergenic
1114742969 14:25117209-25117231 CAGAAGAGAGAAAAGTAAGCAGG + Intergenic
1114799475 14:25757020-25757042 CAGTAGAGAAAGAAGAAAGTTGG - Intergenic
1114979682 14:28147423-28147445 CAGTATAGGAGGATGGAAGCAGG - Intergenic
1115248531 14:31321114-31321136 AAAAAGAGGAAGAAGAAAGGGGG - Intronic
1115305850 14:31932850-31932872 AAGGAAAGGAAGAACGAAGCTGG - Intergenic
1115498293 14:34027463-34027485 GAGAGGAGGAAGAAGGGAGGGGG + Intronic
1115520832 14:34231536-34231558 CACAGGAGGAAGCAGGCAGCGGG + Intronic
1115535564 14:34369724-34369746 AAGAAGAGGAAGAAAGAAAAAGG - Intronic
1115614499 14:35081026-35081048 AAGAAGAAGAAGAAGAAAACAGG + Exonic
1116388145 14:44358424-44358446 AAGCTGAGGAAGAAAGAAGCTGG + Intergenic
1116966934 14:51024790-51024812 AAAAAGAGGAAGAAGGAACAAGG + Intronic
1117211706 14:53507525-53507547 CAGAATAGGAAGCAGAGAGCTGG + Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117270227 14:54136081-54136103 GAGCAGAGGAGAAAGGAAGCAGG + Intergenic
1117830109 14:59741713-59741735 CAGGGGAGGAAGAGGGAAGTGGG - Intronic
1118033386 14:61839927-61839949 CAGAAGAGGAAGAAGGGAAAGGG + Intergenic
1118309436 14:64681849-64681871 CCCAAGAGGAAGAGGGAGGCTGG + Intergenic
1118319786 14:64746494-64746516 CAGAGGAGGATGAAGCCAGCGGG - Exonic
1118350396 14:64969636-64969658 CAGAAGCGGAGGAAGAAATCTGG + Intronic
1118567633 14:67159743-67159765 AAAAAGAGGAAGAAGGAACTAGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1119382548 14:74238541-74238563 AGGGAGAGGAAGGAGGAAGCGGG - Intergenic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120882783 14:89427276-89427298 CACAAGAGGAGGAAGGAAAAGGG + Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121642876 14:95497857-95497879 AAAAAGATGAAGAATGAAGCCGG + Intergenic
1121735700 14:96216641-96216663 GAGAAGAGGAAGAAAGAAGGAGG + Intronic
1121926094 14:97928604-97928626 CAGAAGATGAAGAAGGGAACAGG + Intronic
1122009094 14:98731015-98731037 CCAAAGAGCAAGAAGGAAGCTGG - Intergenic
1122102445 14:99424329-99424351 AAGAGCAGGAAGAACGAAGCAGG + Intronic
1122219158 14:100224642-100224664 GAGGAAAGGAAGTAGGAAGCAGG + Intergenic
1122895460 14:104754482-104754504 AAGAAGAGGAAGATGGAAATGGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123130487 14:105981745-105981767 AAGAAGAGGAAGCAGGAGGGAGG - Intergenic
1123670517 15:22652104-22652126 GAAAAGGAGAAGAAGGAAGCTGG + Intergenic
1123838047 15:24216330-24216352 CAGAAGAGAACAAAGGAAGGAGG - Intergenic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1124526499 15:30458541-30458563 GAAAAGGAGAAGAAGGAAGCTGG + Intergenic
1124622491 15:31282122-31282144 AAGAAGAGGAAGAGAGAGGCTGG - Intergenic
1124772155 15:32549142-32549164 GAAAAGGAGAAGAAGGAAGCTGG - Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125339198 15:38657884-38657906 CAGATGAGGAAGCAGGCTGCAGG + Intergenic
1125341622 15:38681420-38681442 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1125378889 15:39065068-39065090 CAGAAGAGGAGACAGGAAGGTGG - Intergenic
1125454694 15:39845087-39845109 CAGAGGAGGAAGAAGAATTCTGG + Intronic
1125703851 15:41713422-41713444 GGGAGGAGGAAGAAGGAATCAGG + Exonic
1125780067 15:42257346-42257368 CAAGAGAGGAAGAAGGAAAGAGG - Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126195852 15:45930423-45930445 CAGAAGAGGAAAGAGAAAGAAGG - Intergenic
1126274067 15:46855699-46855721 CAGAAGAGGAAGGAAGTAGTGGG + Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127054463 15:55117248-55117270 CAGAGGAGGAAGAAAGGAACAGG - Intergenic
1127122101 15:55780573-55780595 CAGAAGAAGAAGAAGAAAGGAGG + Intergenic
1127165659 15:56243405-56243427 AGGAGGAGGAGGAAGGAAGCTGG + Intergenic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127530813 15:59841770-59841792 TAGCAGAGGATAAAGGAAGCCGG + Intergenic
1127642561 15:60929708-60929730 CAGAAGTTGAAGAGCGAAGCGGG - Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127862187 15:63003660-63003682 CCGATGAGTGAGAAGGAAGCAGG + Intergenic
1127950019 15:63795869-63795891 CAGAGGAGAATCAAGGAAGCAGG + Intronic
1127999120 15:64174537-64174559 CAGAAGAGAATGAAGGCAGGTGG + Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128095567 15:64951515-64951537 GGGAAGAGGAAGAAGAAAACAGG - Intronic
1128095574 15:64951676-64951698 AAGAAGAGGAAGAAGAAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128143585 15:65319175-65319197 AAGAAGAGGAAAAAGAAAGAAGG - Intergenic
1128257251 15:66206339-66206361 AAGAAGAAGAAAAAGAAAGCAGG + Intronic
1128511388 15:68315978-68316000 AAGAAGAGGAAGAGGGAGGGGGG - Intronic
1128595350 15:68941583-68941605 CAGAAGAGGAAGAGGTAATGTGG - Intronic
1128619826 15:69139322-69139344 CTGAAGATGAAGCAAGAAGCAGG - Intergenic
1128871843 15:71165101-71165123 CAGAAGAGGAAGAAGGCCGAAGG + Intronic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1129653457 15:77507525-77507547 CAGTAGAGGGACAAGGAAGTGGG + Intergenic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1130148782 15:81295233-81295255 GAGAAGAGAAAGAAGGAAAGAGG - Intronic
1130541457 15:84823275-84823297 CAAAAAAGCAAGAAGGAAGTAGG - Intronic
1130869002 15:87955611-87955633 GAGAAGAGGATGAAGAGAGCTGG + Intronic
1130881778 15:88061641-88061663 CAGATGAAGAAGCAGGAAGTGGG - Intronic
1130987237 15:88852474-88852496 CAGAAGAGGGAAATGGAAGGAGG - Intronic
1131025222 15:89135873-89135895 CAGAACAGGAAGAAGGCCGAAGG + Intronic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131040014 15:89255836-89255858 CATAAGTGGAAGGAGGAAGAAGG + Intronic
1131139772 15:89967750-89967772 AAGAAGAAGAAGAAAGCAGCCGG + Intergenic
1131225010 15:90617197-90617219 CAGAAGAGGAAGAGGCCAGGAGG - Intronic
1131315695 15:91334944-91334966 CATGAGAGGAAGAAGCAAGTTGG - Intergenic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131369773 15:91870009-91870031 CAGAATTGCAAGCAGGAAGCTGG - Intronic
1131897187 15:97046376-97046398 CAGAAGAGAAGGTAGGAAGTGGG + Intergenic
1131955385 15:97729782-97729804 TAGATGAGGGAGGAGGAAGCAGG - Intergenic
1132282660 15:100633635-100633657 AAGGAAAGGAAGAAGGAAGGAGG + Intronic
1132335179 15:101043730-101043752 CAGACGAGAAAGAAGGTAGTTGG - Intronic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132647945 16:1007702-1007724 CAGGAGTGGGAGAAGGATGCGGG - Intergenic
1133368863 16:5232908-5232930 AAGAAGAAGAAGAAGGAAATGGG - Intergenic
1133436427 16:5784123-5784145 GTGAAGAGGAAGCAGGCAGCCGG + Intergenic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1134127995 16:11629608-11629630 AAGAAGAGGAAGGAAGGAGCCGG - Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134375223 16:13665935-13665957 AAGAAGAGGAAGAGGGGAACAGG + Intergenic
1134404697 16:13946154-13946176 CAGAAGTGAAAGATGGAGGCAGG - Intronic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135186039 16:20316819-20316841 AAGGAGAGAAGGAAGGAAGCAGG - Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135777646 16:25270970-25270992 AAGAAAAGGAAGAAGCTAGCAGG - Intergenic
1135963423 16:27016405-27016427 AAGAAGAAGAAGGAGGAAGTGGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136360282 16:29775013-29775035 AAGAAGAGGCAGAAGGAAAAAGG + Intergenic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137716803 16:50603161-50603183 CAGAAGGGGAAAATGGAGGCCGG + Intronic
1137919959 16:52477237-52477259 CAGAAGAAAAGGAAGAAAGCTGG + Intronic
1138491722 16:57381029-57381051 ATGAAGGGGAAGAAGGAAGTTGG + Intronic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138649914 16:58454067-58454089 CAAAAGTGGAAGAGGGAGGCAGG - Intergenic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1138739863 16:59295534-59295556 AAGAAAGGAAAGAAGGAAGCAGG + Intergenic
1139280936 16:65769905-65769927 GAGAAGAGGAAGGAAGAAACTGG + Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139531296 16:67543950-67543972 CAGCAGAGGAAGGAGGGACCTGG - Intronic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1139601271 16:67988922-67988944 AAGAAAAGGAAGAAAGAAGGAGG + Intronic
1139605167 16:68013104-68013126 AAGAGGAGGAAGAAAGAGGCTGG + Intronic
1140012897 16:71153839-71153861 GAGAATAGTAAGAGGGAAGCTGG + Intronic
1140266950 16:73429103-73429125 CAAAAGATGAAAAAGGAAGGAGG - Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141503421 16:84460153-84460175 CAGAAGTGGGACCAGGAAGCTGG + Intronic
1141678980 16:85532980-85533002 CAGAACAGGAGGTAGGGAGCGGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142441293 16:90099584-90099606 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
1142542408 17:670521-670543 AAAAAGAGAAAGAAGAAAGCAGG - Intronic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142561300 17:811090-811112 CAGAAGAGGAAGAAAGAAGGAGG + Intronic
1143171068 17:4930703-4930725 AAGAAGAAGAAGAAGAAAGGAGG + Intergenic
1143243322 17:5462335-5462357 CAGAAGAGGAGAAAGGAACTCGG - Exonic
1143391519 17:6561619-6561641 AAGAGGAGGAAGAGGGAAGGAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143528371 17:7485194-7485216 CAGAAGAGGAGGAAGCTACCCGG - Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1144291208 17:13828246-13828268 CAGAAGATGAAGTAGGAATTAGG - Intergenic
1144684842 17:17219184-17219206 TAGAAGAGGAATCAGAAAGCTGG - Exonic
1145291066 17:21546222-21546244 CAGGAGGGGAGGGAGGAAGCGGG - Intronic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145815153 17:27789848-27789870 GATAAGAGGAAGAGGGAAGATGG - Intronic
1145839609 17:27983549-27983571 CAGTTCAGGAAGAAAGAAGCAGG + Intergenic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146238359 17:31188800-31188822 CACAGGAGGAAGATGGAGGCTGG - Intronic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146430029 17:32784315-32784337 CACATGGGGAAGAAGGAACCAGG - Intronic
1146645970 17:34577982-34578004 AGGAAGAGGAGGAAGGAAGCAGG - Intronic
1146804656 17:35855627-35855649 GAGAAGAGGAAGAAGTGGGCAGG + Intronic
1146962242 17:36992342-36992364 GAGAAGAGGAAAAAAGAATCAGG - Intronic
1146987315 17:37232497-37232519 AGGGAGAGGAAGAAGGAAGGGGG + Intronic
1147228671 17:39001455-39001477 AAAAAAAGGAAGAAAGAAGCAGG - Intergenic
1147264650 17:39227383-39227405 CAGAAGGGGCAGAAGGAAAGAGG - Intergenic
1147312871 17:39605419-39605441 CAAAAGAAAAAGAAGGGAGCCGG + Exonic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147460068 17:40562689-40562711 AAGATGAGGAGGAAGGACGCAGG - Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147535251 17:41316518-41316540 AAGAAAAGAAAGAAGAAAGCAGG + Intergenic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147621956 17:41873973-41873995 GAGATGGGGAAGAGGGAAGCAGG + Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147834002 17:43317150-43317172 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1147908920 17:43842921-43842943 GAGAAAAGGAAGAAGAGAGCCGG - Intergenic
1147961644 17:44171112-44171134 CAGAAGAGGAGGGAGAAAGAAGG + Intronic
1148182951 17:45620216-45620238 CAGAAGGGGAAGAGGGATGCAGG - Intergenic
1148265906 17:46225475-46225497 CAGAAGGGGGAGAGGGATGCTGG + Intergenic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148641383 17:49190313-49190335 GAGAAGTGGAAGTAGGAAGGTGG + Intergenic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148785816 17:50145755-50145777 CAGAAGAGGAGGAGGGGAGCAGG + Intronic
1148836397 17:50467992-50468014 CAGGAAGGGAAGAAGGAACCAGG + Intronic
1148888113 17:50788207-50788229 GAGAAGAGGAAGAAGGGAAGTGG + Intergenic
1149107116 17:52982691-52982713 AGGAAGAGGAAGAGGGAAGAAGG - Intergenic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149394080 17:56221074-56221096 CAGAAGGTGAAGGGGGAAGCAGG + Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1149797902 17:59538387-59538409 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150244580 17:63664811-63664833 AAAAAGAGGAAGGAGGAAGGTGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150423613 17:65058955-65058977 AAGAAGAAGAAGGAGGAAGGAGG + Intergenic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150475752 17:65473323-65473345 CTGAAGAGAAAGAAGGAATGGGG - Intergenic
1150605574 17:66687784-66687806 GAGAAGGGGAAGAAGGAAGGAGG + Intronic
1150622027 17:66814796-66814818 CCCAGGAGGAAGGAGGAAGCGGG + Intergenic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150810283 17:68350841-68350863 GAGAAGAGATAGAAGGAAGGAGG + Intronic
1151236907 17:72727349-72727371 CAGAACAGAAAGAAGCAAGCTGG + Intronic
1151450145 17:74193813-74193835 CAGAAAGGTAAGAAGGAAGTGGG + Intergenic
1151522977 17:74643921-74643943 TAGAAGAGAGAGAAGGAAGGTGG + Intergenic
1152084061 17:78206649-78206671 AAGAAGATGAAGGAGGAAGGAGG - Intronic
1152334737 17:79694212-79694234 TAGAAGTGGAAGACGGAGGCGGG + Intergenic
1152337590 17:79707230-79707252 CAGGGGAGGAAGAAGGGAGGAGG - Intergenic
1152463645 17:80454187-80454209 CAGGAGGGGAAGGTGGAAGCGGG + Intergenic
1152487553 17:80604035-80604057 CAGAAGAGGGTTAAGAAAGCAGG - Intronic
1152574920 17:81135776-81135798 CACACGAGGAAGAGGGAACCAGG + Intronic
1152594128 17:81230009-81230031 GAAAACAGGAAGAAAGAAGCTGG + Intronic
1152629116 17:81401872-81401894 CAGAAGGGGGAGAATGCAGCTGG - Intronic
1152632806 17:81418101-81418123 CAGAAGAGGCAACAGTAAGCAGG + Intronic
1153794772 18:8611478-8611500 CAGAAGAGGAGAGAGGAAGAAGG + Intronic
1153809793 18:8741980-8742002 CTGAATAGGATCAAGGAAGCAGG - Intronic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1153861141 18:9208677-9208699 AAGAAGACAAAAAAGGAAGCTGG + Exonic
1154031403 18:10756870-10756892 GAGATGAGGAGGAAGGATGCAGG + Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154991892 18:21605365-21605387 CAGAAAAGGAACAAGGAAATGGG - Intergenic
1155081189 18:22411607-22411629 CAGGAGAGCTAGAAGGAAGCTGG - Intergenic
1155161395 18:23198612-23198634 TAAAAGCGGAAGAAGGAGGCAGG + Intronic
1155276424 18:24192282-24192304 GAGAAGAGGAGGACGGAAACAGG + Intronic
1155315836 18:24569172-24569194 CAGAAGAGGCAGAAGCCAGTAGG - Intergenic
1155365571 18:25046271-25046293 CAGGAGATGAAGAAGGAATCTGG + Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1155499503 18:26472751-26472773 AGGAAGAGGAATCAGGAAGCTGG - Intronic
1155792816 18:29995898-29995920 AAGAAGAGGAAAAAGCAAACAGG + Intergenic
1156048042 18:32898826-32898848 CTGTACAGGAAGAAAGAAGCTGG - Intergenic
1156327101 18:36084747-36084769 TACATGAGGAAGAATGAAGCTGG + Intergenic
1156372254 18:36482094-36482116 GATAAGAGGAAGAGGGAAGGAGG + Intronic
1156482411 18:37444670-37444692 CAGAGGAGGAAGGAGGGAGGTGG + Intronic
1156671801 18:39479592-39479614 CAGAAGTTGATGATGGAAGCAGG - Intergenic
1157085196 18:44573400-44573422 AGGAAGGGGAAGAAGGAAGACGG + Intergenic
1157117396 18:44874938-44874960 CAGAAAAGGAAGGCTGAAGCAGG + Intronic
1157134035 18:45036705-45036727 GAGAATAGGAGGAAGGAAGGAGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157909162 18:51598851-51598873 CAGAAGATGAGGAAGAAAACTGG + Intergenic
1158252797 18:55508077-55508099 CAGCAGTGGAAAAAGGCAGCCGG + Intronic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158412859 18:57223031-57223053 AAAAAGAGGAAGAAAGAAGGAGG + Intergenic
1158787051 18:60726667-60726689 CAGATGTGGAAGAATGAAACTGG - Intergenic
1159191214 18:65045320-65045342 CAGAAGAGGAAGAGTGATGGAGG - Intergenic
1159468276 18:68813611-68813633 GAGAAGAGGATAAAGGAGGCCGG + Intronic
1159503128 18:69299116-69299138 CAGCAGTGGGAGAAGAAAGCAGG - Intergenic
1159517545 18:69476699-69476721 GAGAAGAGGTAGCAGGAAGCAGG + Intronic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159938823 18:74389975-74389997 AAGAAGAGGAAGAAGAAGACAGG - Intergenic
1159965158 18:74587878-74587900 CAGAAGAGTAAGCAGAGAGCAGG - Intergenic
1160019922 18:75172495-75172517 GAGAGTAGGAGGAAGGAAGCGGG + Intergenic
1160355171 18:78221629-78221651 CAGATGAGGAAGGAGGGAGGGGG - Intergenic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160853089 19:1203509-1203531 CAAAACAGGAAGAAGGCAGATGG - Intronic
1161042821 19:2119071-2119093 CAGAAGAGGAAAAAGGACAACGG + Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161701162 19:5796349-5796371 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162105375 19:8366837-8366859 CAAGAGAGGAAGGAGGAAGAGGG - Intronic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1162304737 19:9865143-9865165 GAGAAGAAGAAGAAGGGAGGTGG - Intronic
1162363950 19:10236588-10236610 CAGTGGAGGAGGAAGGAAACAGG + Intergenic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162504011 19:11071713-11071735 AAGAAGAAGAAGAAGAAAGGGGG + Intergenic
1162799817 19:13104276-13104298 CAGATGGGGATGAAGGGAGCAGG + Intergenic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163235651 19:16029028-16029050 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163703957 19:18801524-18801546 AAGAAGAAGAAGAAGGGAGGGGG - Intergenic
1163973087 19:20819458-20819480 CAGAGGAGAATGAAGGAAGGAGG + Intronic
1164289620 19:23855686-23855708 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1164324783 19:24181516-24181538 CAGAAGAGGAAGAGGAAAGGAGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165218796 19:34297517-34297539 CGGTAGAGGAACTAGGAAGCTGG + Intronic
1165481223 19:36065676-36065698 CGGCAGAGGGAGAAGAAAGCAGG + Intronic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1165731856 19:38151036-38151058 GAGAGGAGGCAGAAGGAATCTGG - Intronic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166183523 19:41124696-41124718 CTGGAGAGGAAGCGGGAAGCGGG - Intronic
1166224864 19:41388598-41388620 TAGAGGAGGAAAAAGGAAGCAGG - Intronic
1166430889 19:42726833-42726855 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166437704 19:42783125-42783147 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166443905 19:42842168-42842190 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166451347 19:42904836-42904858 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166456652 19:42946923-42946945 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166463587 19:43012832-43012854 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166469739 19:43069409-43069431 TTGAGGAGGAAGAATGAAGCTGG + Intronic
1166480873 19:43172927-43172949 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166486401 19:43217417-43217439 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166490455 19:43256049-43256071 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166493516 19:43280844-43280866 TTGAAAAGGAAAAAGGAAGCTGG + Intergenic
1166746378 19:45143773-45143795 CAGAAGCTGAATGAGGAAGCAGG - Intronic
1166975648 19:46603573-46603595 AAGATGAGGGATAAGGAAGCAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167627620 19:50603156-50603178 AAGAAGAGGAAGGAGGAAGATGG - Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925617233 2:5755193-5755215 CAGAAGAAGAGAAAGAAAGCAGG + Intergenic
925649282 2:6072070-6072092 CATTAGTGAAAGAAGGAAGCGGG - Intergenic
925802830 2:7618290-7618312 CAAAGGTGGAAGGAGGAAGCAGG + Intergenic
926156502 2:10457282-10457304 CACAGGAGAAAGATGGAAGCTGG + Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926987843 2:18643445-18643467 AAGAGGGAGAAGAAGGAAGCAGG + Intergenic
927031495 2:19124814-19124836 CATAAGTGGAAGAGGGAGGCAGG - Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927269896 2:21195426-21195448 AAGAAAGGGAAGAAGGAAGGGGG - Intergenic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
927834159 2:26378524-26378546 CAGCAGAGGAACTAGAAAGCAGG - Intronic
927946338 2:27137365-27137387 GAGAAAAGGCCGAAGGAAGCAGG - Exonic
927983086 2:27387350-27387372 GAGAAAAGGAAGAAAGAATCAGG + Intronic
928093269 2:28389553-28389575 GGGAAGGGGAAGAGGGAAGCTGG - Intergenic
928131476 2:28654759-28654781 AAGAAGAGGGAGAAAGCAGCCGG + Intergenic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
928461724 2:31480519-31480541 CAGATGCGGAAGATTGAAGCTGG - Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
928875800 2:36037624-36037646 CAGCAGAGGAAAATGGATGCTGG - Intergenic
929390743 2:41465783-41465805 AAAAAGGGGTAGAAGGAAGCTGG - Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929616615 2:43314793-43314815 CAGAAGAGGAAAAAGAACACAGG + Intronic
930068665 2:47347703-47347725 GAGAGGAGGTACAAGGAAGCTGG - Intronic
930110632 2:47675803-47675825 CAGATGGGGAAGAAGGAAGGAGG + Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930806737 2:55497901-55497923 CAGCAGAGGAGGGAGGAAGAGGG + Intergenic
930879800 2:56258209-56258231 AAGATGAAGAAGAATGAAGCTGG + Intronic
931464378 2:62473854-62473876 CAGAAGAGAAAGGAGGAAGTAGG + Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931553032 2:63468237-63468259 AAGATGATGAAGAAGGGAGCAGG - Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931671717 2:64653829-64653851 CGGAGGAGGAAGCAGGAGGCGGG + Exonic
931762810 2:65432131-65432153 CAGAAGGGGAAGCAGGGCGCGGG + Exonic
931831991 2:66062326-66062348 CAGAAGAAGAATACAGAAGCAGG + Intergenic
931853284 2:66275411-66275433 CTGAAGTGTAAGAAGCAAGCTGG - Intergenic
931922615 2:67037567-67037589 TAGAAGAGAAAGAAGGAACAGGG + Intergenic
931982287 2:67706902-67706924 CAGAGAGGGAAGAAGAAAGCAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932073551 2:68643726-68643748 GAGCAGAGGAGGAAGGGAGCGGG + Exonic
932110016 2:68990252-68990274 CAGAAGCTGAAGAAGCAAGGAGG - Intergenic
932149592 2:69357567-69357589 AAAAAGAGGAAGCAGGAAGATGG - Intronic
932775939 2:74528491-74528513 TAGAAGAGGAAGGAGAAAGTAGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933563582 2:83920587-83920609 CATAAGAGGAAGAATTATGCAGG - Intergenic
933580861 2:84125568-84125590 AAGAAGAAGAAGAAGGAAAGTGG + Intergenic
933636132 2:84710866-84710888 AAGAAGAGGAAGAAGAAGGGAGG + Intronic
933648088 2:84828426-84828448 GAGGAGGGGAAGAAGGAAACAGG + Intronic
933805440 2:85995631-85995653 CAGAAGAGGCAGGAGTCAGCTGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934155153 2:89192405-89192427 CAGATGACTAAAAAGGAAGCAGG + Intergenic
934212161 2:89990322-89990344 CAGATGACTAAAAAGGAAGCAGG - Intergenic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935451154 2:103210966-103210988 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
935719334 2:105966481-105966503 AAGGAGGGAAAGAAGGAAGCAGG + Intergenic
936076488 2:109404835-109404857 CGGATGAGGAAGGAGGATGCTGG - Intronic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936600059 2:113887209-113887231 CAAAAGAGAGAGAGGGAAGCGGG + Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936731308 2:115384621-115384643 AAGAAGAGGAAGAAGAAAGAAGG + Intronic
936760726 2:115778019-115778041 CAGAGCAGGAAGGAGCAAGCAGG - Intronic
936919091 2:117669547-117669569 CAGGAGAGGAATGAGGATGCAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937345967 2:121125485-121125507 GAGAAGGAGAAGAAGGAAGGAGG + Intergenic
937669973 2:124528125-124528147 CAGAACTGGAAGAATGAAGGAGG - Intronic
937811122 2:126200584-126200606 CAGAATAGGAAGACTGATGCAGG - Intergenic
937821150 2:126312502-126312524 CAGAAGTGGAAGAAGCAAAGAGG + Intergenic
938800533 2:134759530-134759552 CAGAACAGAAGGAAGGAAGGGGG + Intergenic
939028305 2:137040379-137040401 AAGAAGAGGAAGAAAGAAAGAGG - Intronic
939183071 2:138826439-138826461 CAGGAGAGCAGGAAGGGAGCAGG - Intergenic
939272489 2:139958747-139958769 CAAAAGAAGAAGAAGAAAGAAGG + Intergenic
939835205 2:147121493-147121515 AAGAAGATGAAGAAGAAAACTGG + Intergenic
940280568 2:151984892-151984914 CATAAGAAGAAACAGGAAGCTGG - Intronic
940331514 2:152480092-152480114 CTGAAGAGGTAGCAGGTAGCTGG - Intronic
940416042 2:153421204-153421226 GAGAAGAGGATGCAGGAAGAGGG + Intergenic
940554776 2:155209907-155209929 CAGAAAGGAAGGAAGGAAGCAGG + Intergenic
940751074 2:157628326-157628348 CGGAAGAGGGAAAAGGCAGCAGG - Intronic
940857326 2:158739631-158739653 CAGAAGGGGAAGAATGAAAGGGG + Intergenic
940890817 2:159033639-159033661 CAGAAGAGCAGGTAGCAAGCAGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941697899 2:168573011-168573033 GAGAAGAGGAAGGAGGAGGCAGG + Intronic
941778220 2:169415682-169415704 CAGAAGAGGAGGAAAGCAGAAGG - Intergenic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942425744 2:175858703-175858725 GAGCAGATGAAGACGGAAGCGGG - Intergenic
942466194 2:176209583-176209605 AAGAAGAGGAAAATGGAGGCCGG - Intergenic
942538758 2:176993710-176993732 TAGAAGAGGATGAAGAAAACCGG - Intergenic
942542959 2:177033723-177033745 TAGAGGAGGAAGGAGGAAGTTGG - Intergenic
942941745 2:181626748-181626770 CAGAAGAGGATAAAAGATGCAGG + Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943180934 2:184540308-184540330 GAGAAGAGAAAGAAGGGAGAGGG + Intergenic
943687272 2:190831673-190831695 AAAAAGAAGAAGAAGAAAGCCGG + Intergenic
943982553 2:194573014-194573036 CAGAAGATTAAGAATGAAGGAGG + Intergenic
944046106 2:195413824-195413846 GAGAAGAGGAAAAAGGAAAAAGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944140437 2:196450357-196450379 GATGAGAGGAAGAAGAAAGCTGG + Intronic
944356543 2:198796018-198796040 CAGATTAGGAACAAGGAATCAGG - Intergenic
944593577 2:201240627-201240649 CAGAAGATTAATAAGGAAACAGG + Intronic
944936820 2:204578217-204578239 CTGAAGAGTAACAAGGAAGCAGG + Intronic
945337649 2:208611904-208611926 CACATGTGGAAGAATGAAGCTGG - Intronic
945532052 2:210967683-210967705 CAGAAGTGGCAGCAGGAAACAGG - Intergenic
946218028 2:218201038-218201060 CAGAAGAGGAAAAAGGCTGAAGG - Intergenic
946224230 2:218254389-218254411 GAGAAGAGAAGGAAGGAAGAAGG + Intergenic
946346489 2:219115169-219115191 AAGAAGAAGAAGAAGAAAGGGGG + Intronic
946537951 2:220651746-220651768 CTGAGAGGGAAGAAGGAAGCCGG + Intergenic
946648447 2:221866006-221866028 TAAAAGAGAAAGCAGGAAGCTGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947274349 2:228373393-228373415 CAGAAGGTGAAAGAGGAAGCAGG + Intergenic
947348792 2:229221336-229221358 CAGAAGTGGAGGAAGGAACCAGG - Intronic
947510995 2:230754325-230754347 AAGAAGAGGAAGGAAGAAGAAGG - Intronic
947808852 2:232987452-232987474 AAGAAGAGGAAGAAGAAGGGAGG + Intronic
948077654 2:235178485-235178507 AAGAAGAGGAAGGAGGAAAGAGG + Intergenic
948661287 2:239508110-239508132 CAGAAGAGGAAGCAGAAAGGGGG - Intergenic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168829319 20:835916-835938 CTGAAGGGAAAGAAAGAAGCAGG + Intronic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1168897024 20:1330845-1330867 TAGAAGAGGGAGGAGGAAGCAGG + Intronic
1169007002 20:2215974-2215996 CTGAAGAGAAAGAAGAAAGGGGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170371496 20:15653938-15653960 AAGCAGAGGAGGAAGCAAGCAGG + Intronic
1170479816 20:16754660-16754682 CACAAGAGGAAGATGAAAGCCGG - Intronic
1171287946 20:23957637-23957659 CAGAAGTGGAAGAAGGCATGAGG - Intergenic
1171368092 20:24640418-24640440 GAAAAAAGGAAGAAGGAAGGAGG + Intronic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172782854 20:37447538-37447560 CATAGGAGGAAGAAGGGAACAGG - Intergenic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1172837974 20:37885159-37885181 CAGAAGAGGCAGAACCTAGCAGG - Intergenic
1172928639 20:38564905-38564927 AAGAAGAAGAAGAAGGGAGGAGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1172974457 20:38895763-38895785 GAGGAGAGAAAGAAGGAAGTTGG - Intronic
1172974463 20:38895790-38895812 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974469 20:38895817-38895839 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974514 20:38895979-38896001 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1173189632 20:40866147-40866169 CTGGAGTGGAAGAAGGAAGGAGG - Intergenic
1173397738 20:42696259-42696281 GAGAAGAGGGAGGAGGAAGGGGG - Intronic
1173649914 20:44656620-44656642 CAGCAGAGGAGCGAGGAAGCTGG + Intergenic
1174166089 20:48584517-48584539 GGGAAGCAGAAGAAGGAAGCAGG - Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174397995 20:50259790-50259812 CAGGAGAGGAAGAAAGGAGGAGG - Intergenic
1174507024 20:51023396-51023418 CAGACGGGGAAGAAGGCAACGGG - Intergenic
1174722290 20:52825817-52825839 CAGAAAAGGAGGAATGAAGGTGG + Intergenic
1174835121 20:53849706-53849728 GAGAGGAGGAAGAAGCAAGAGGG - Intergenic
1174960499 20:55151679-55151701 AGGAGGAGGAAGAAGGAAGGAGG - Intergenic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175233154 20:57488711-57488733 CAGAACAGGAAGAAGGCCGAAGG + Intergenic
1175310395 20:58007714-58007736 AAGAAGAGGAAGAGGGAATAGGG + Intergenic
1175417483 20:58811393-58811415 CAGAAGAGGAAGAGAGGAGTAGG - Intergenic
1175529702 20:59666069-59666091 CACAACAGGCAGATGGAAGCTGG - Intronic
1175541433 20:59750542-59750564 GAAAGGAGGAAGGAGGAAGCAGG + Intronic
1175588621 20:60168781-60168803 GGGCAGAGGAAGAAGGAAGCTGG + Intergenic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1175718254 20:61269698-61269720 CAGAAGAGGAGGAGGAGAGCAGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175971242 20:62687737-62687759 CAGCAGAGGTACAGGGAAGCCGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176781489 21:13200325-13200347 AAGAAGGAGAAGAAGGAAACAGG - Intergenic
1177076847 21:16586671-16586693 TAGAACAGGAAGAAGTCAGCAGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177423254 21:20889816-20889838 GAGAAGAGGAAGAAGGAAGTGGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1177831967 21:26149071-26149093 CAGGAGAGGGTGAAAGAAGCTGG + Intronic
1178191526 21:30287543-30287565 AGGGAGAGGAAGAAGGAAGGAGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178846056 21:36175096-36175118 AAGAAGAAGAAGAAGAAATCTGG - Intronic
1178991224 21:37358336-37358358 CAGCAGGGGCAGAAGGGAGCTGG - Intergenic
1179049336 21:37875386-37875408 AAGAAGGGGGAGGAGGAAGCAGG - Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179642049 21:42754153-42754175 AAGAAGAGGAAAAAGCAAGAAGG - Intronic
1179777128 21:43672217-43672239 CGGAAGTGGGAGAAGGAAGCAGG + Intronic
1180060483 21:45382526-45382548 CTGAGGAGGAAGAAGGAAACAGG + Intergenic
1180070852 21:45435251-45435273 GAGAAGAGGAAGAAGGGGGTGGG + Intronic
1180220764 21:46356459-46356481 CAGAAGAGGAAAAAAGCAGAAGG - Intronic
1180232023 21:46432414-46432436 TTGAAGAGGAAGAACGAAGTTGG - Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180624235 22:17183426-17183448 CAAAAGAGGAAGAAGGAAAGCGG - Intronic
1180856341 22:19048221-19048243 CAGAATGGGAAGGAGGCAGCTGG + Intronic
1180991096 22:19936702-19936724 CAGAAGAGGCAGAAGCATACTGG - Intronic
1181041846 22:20196047-20196069 CAGATGAGCATGGAGGAAGCGGG - Intergenic
1181179374 22:21056041-21056063 CAGAAGAGGGAGGAGTCAGCAGG - Intronic
1181408848 22:22704105-22704127 GAGAAGCAGACGAAGGAAGCTGG + Intergenic
1181528067 22:23501443-23501465 CAGAAGGCGAGAAAGGAAGCAGG + Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1181898217 22:26129856-26129878 AAGAAGACAAAGAAGGAAGGAGG - Intergenic
1181951985 22:26560820-26560842 CAGAACAGGAAGAAGGCCGAAGG - Intronic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182866322 22:33607496-33607518 AGGAAGAGCAACAAGGAAGCTGG + Intronic
1182877672 22:33706388-33706410 CAGAGGAGGAAACAGGAAGGGGG + Intronic
1183217759 22:36492161-36492183 CAGATGAGGAAGAGGACAGCGGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183520708 22:38294726-38294748 CACCAGAGGAAGGAGAAAGCAGG + Intronic
1183807594 22:40224702-40224724 AAGGAGAGAAAGAAGAAAGCTGG - Intronic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184142766 22:42588024-42588046 AAAAAGAGGAAGAAGGAACAGGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184287868 22:43482088-43482110 GAGAAGAGGAAGAACTCAGCTGG + Intronic
1184319614 22:43730348-43730370 CATAAGAGAAAAAATGAAGCAGG + Intronic
1184606968 22:45579805-45579827 AAGAGGAGGGAGAAGGAAGTAGG - Intronic
1184682596 22:46080147-46080169 CGGGAGAGGGAGGAGGAAGCCGG - Intronic
1184799519 22:46751271-46751293 GGGAGGAGGAAGGAGGAAGCAGG - Intergenic
1184929021 22:47666749-47666771 CAGAAGAAGAAGAAAAAAGGAGG - Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
949417042 3:3826196-3826218 CACAAGAGGAAGAAAAAAGAAGG + Intronic
949432414 3:3991831-3991853 AAGAAGAGAAGGAAGGAAGGAGG + Intronic
950122750 3:10492678-10492700 CCCCAGAGGGAGAAGGAAGCGGG - Intronic
950216435 3:11163084-11163106 CAGAAGGGCAAGAAGGCAGTGGG - Intronic
950358200 3:12429419-12429441 CTCAAGAGGAAGGAGGAGGCTGG + Intronic
950786707 3:15443026-15443048 CAGAAGTGGAGAATGGAAGCAGG - Intronic
950907553 3:16552956-16552978 AAGAAGGGAAAGAAGGAAGAAGG + Intergenic
951073638 3:18363212-18363234 CCTAAGAGGAACAAGCAAGCAGG + Intronic
951108948 3:18778270-18778292 AAGAAGAGGGAGAAGAAAGGTGG + Intergenic
951161174 3:19424405-19424427 CACATGTGGAAGAAGGAAACTGG + Intronic
951242081 3:20298518-20298540 GAGGAGAGGAAGAAAGCAGCAGG - Intergenic
951412534 3:22382113-22382135 CAGAAGAGGAAGAAGGCCGAAGG - Intergenic
951431950 3:22618420-22618442 AAGAAGAGGAAGAAAAAAGGAGG + Intergenic
951523439 3:23630558-23630580 GAGGAGAGGAGAAAGGAAGCTGG + Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951640101 3:24827281-24827303 AAGAAGGGAAAGAAGGAGGCAGG - Intergenic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
951721734 3:25706750-25706772 CAGAAGAGGAACCAGAATGCAGG + Intergenic
951954356 3:28238481-28238503 AAGAAGAGGCAGAAGCAAGGAGG + Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952559460 3:34573799-34573821 AAGAAGAAGAAGGAGGAAGTAGG - Intergenic
952562480 3:34611405-34611427 CAGGAGAGAATGAAGGAAGGAGG - Intergenic
952576115 3:34775955-34775977 CAGGAGAAGAAAAAGGAATCAGG + Intergenic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952766346 3:36957294-36957316 ATGAAGGGGAAGAAGGAAGGGGG - Intergenic
953124979 3:40083425-40083447 GAGAAGGGGAAAAAGGAAGAAGG - Intronic
953381155 3:42473768-42473790 CCTGAGAGGAAGACGGAAGCTGG + Intergenic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
953896584 3:46807845-46807867 CTGATGAGGAAGAAGAAAGAAGG + Intronic
954317965 3:49811548-49811570 CAGAAGAGGAAGCAGAAGCCTGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954454465 3:50590235-50590257 AAGAAAAGGAAGAAGGGAGGAGG + Intergenic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
955016027 3:55070196-55070218 AAGAAGAGGCAGAAGGAAAGTGG + Intronic
955025524 3:55163923-55163945 CAGAAGAAGAGGAAGGCAGGAGG - Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955273425 3:57524795-57524817 CAAAGGGGGAAAAAGGAAGCAGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955497960 3:59556134-59556156 CAGAACAGGAAGCTGGAAGAAGG - Intergenic
955641402 3:61089386-61089408 CACTGGAGGAAGAAGGAATCGGG - Intronic
955889771 3:63637440-63637462 CAGGAGAGAGAGAAGAAAGCAGG - Intergenic
956179373 3:66502762-66502784 CAGAAGGGGAAGAAGGAAAAAGG - Intergenic
956381224 3:68666533-68666555 TAGAAGAGAAAGAAGGTAGGGGG - Intergenic
956587443 3:70879395-70879417 GAGAGGAGGAAGGAAGAAGCTGG - Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956788274 3:72660811-72660833 CAGAAGAGGAAGTGAGAAGTTGG - Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957175556 3:76803425-76803447 CAAAAGAGGAGGAAGGATGGAGG + Intronic
957540124 3:81557464-81557486 AGGAAGAGGAAGAGGGAAGGAGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958152769 3:89712595-89712617 CATAAGAGGAAGAAGAAATGCGG + Intergenic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958560132 3:95737960-95737982 CAGAAGAAGAAGCAGGCAGAGGG - Intergenic
958656935 3:97014426-97014448 AAGGAAAGGAAGAAGGAAGGTGG - Intronic
959049384 3:101510482-101510504 AAGAAGAGGTAGAAGGAAGGTGG - Intronic
959574463 3:107919405-107919427 TGGAAGAGGAAGGAGGAAGGAGG + Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959613611 3:108322487-108322509 CAGAAGAGGAAAGAGGAGGTGGG - Intronic
959839298 3:110955865-110955887 CAGAAGATTAAGAAGGATGGAGG - Intergenic
959962503 3:112314792-112314814 CAGAAGGGGAAGAAAAAAACAGG + Intergenic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960418334 3:117412670-117412692 GAGAAGAGGAAGAAGGAGAAGGG - Intergenic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
960680168 3:120239388-120239410 AAGAAGAAGAAGAAGGGAGGAGG - Intronic
960775386 3:121245886-121245908 CAAAAGATCAAGAAGGAAACAGG + Intronic
960854769 3:122091862-122091884 CAGAGGAGGAAGAAGCACACGGG - Intronic
960931944 3:122861079-122861101 TGGAAGAGGAAGAAAGAAGAAGG - Intronic
961254207 3:125533215-125533237 CAGAAGAGAAAGAGGGAGGGAGG - Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961505574 3:127368751-127368773 GAGAAGAGGAAGAAGGCAGTGGG + Intergenic
961553897 3:127684799-127684821 CAGAAGAGGAAGAAGAGTGAAGG + Intergenic
961646489 3:128395413-128395435 AGGAGGAGGAGGAAGGAAGCTGG - Intronic
962100240 3:132334212-132334234 TAGAAGAGGAGGAAAGAAACAGG + Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
962865937 3:139448080-139448102 AAGAAGAGAAAGGAGGAAGGAGG - Intergenic
962870045 3:139480807-139480829 ATCAAGAGGAAGAAGAAAGCAGG - Intergenic
963292555 3:143507048-143507070 CACAAGATGAATAAGGAAGGAGG - Intronic
963414301 3:144975108-144975130 GGGAAGAGAAAGAAGGAAGAAGG - Intergenic
963606372 3:147414594-147414616 CAGAAGAGGCAGCAGGTTGCTGG - Exonic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
963776846 3:149448490-149448512 AAGAAGAGGAAGGAGAAAGGGGG - Intergenic
963796480 3:149635627-149635649 GAAAGGAGGAAGAAGGAAGAAGG + Intronic
963826349 3:149958441-149958463 GAAAAGTGGAAGAAGGAAGCAGG - Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964140189 3:153389216-153389238 CAAAAGGGAAAGAAGGAAGGAGG + Intergenic
964265114 3:154887423-154887445 TAAAAGAGGAATCAGGAAGCAGG + Intergenic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964525398 3:157611415-157611437 CAAAAGAGGAAAAAGGAGGGAGG + Intronic
964708474 3:159646473-159646495 AAGGAGAGGATGAAGGAAGGAGG - Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966508668 3:180736069-180736091 CAAAAGAGGAAGCAGGTGGCTGG - Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966802821 3:183780234-183780256 CACCACAGGAAGGAGGAAGCGGG + Intronic
966889652 3:184397797-184397819 GAAAAGGGGAAGAAGGAAGGGGG + Intronic
966922076 3:184619034-184619056 AGGAAGAGGGAGAAGGAAGGAGG - Intronic
967103117 3:186233218-186233240 CATAAGTGGAAGAGGGAGGCAGG + Intronic
967442981 3:189530566-189530588 AAAAGAAGGAAGAAGGAAGCGGG - Intergenic
967448850 3:189599002-189599024 CAGAGGCTGAAGGAGGAAGCAGG + Intergenic
967686931 3:192428332-192428354 CAGGAGAGGAAGAAGGGAAGGGG + Intronic
967713504 3:192736937-192736959 GAAAAGAGCAAGAATGAAGCAGG - Intronic
967895927 3:194396478-194396500 GAGAAGAGGAAGAAGAGAGGAGG + Exonic
968361550 3:198150560-198150582 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968767770 4:2482868-2482890 CAGAGGAGGTTGAAGAAAGCCGG - Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
969080977 4:4617802-4617824 AAGAGGAGGAAGAAGGAGGTAGG - Intergenic
969139429 4:5055671-5055693 CAGACGAGCAGGAAGGAGGCAGG - Intronic
969435667 4:7187881-7187903 CAGAAGTGGACCCAGGAAGCAGG + Intergenic
969651154 4:8469123-8469145 CAAAGGATGAAGAAGGAAACGGG - Intronic
969901428 4:10354139-10354161 CACCAGTGGAAGGAGGAAGCAGG + Intergenic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970150595 4:13085550-13085572 CAGATGATGAGGCAGGAAGCAGG - Intergenic
970818557 4:20187118-20187140 CACAAGAGAAAGATGAAAGCTGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971280203 4:25236726-25236748 CAGAAGATGAAGAAAGAACCAGG - Intronic
971317507 4:25579842-25579864 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971512449 4:27443778-27443800 AGGAAGAGAAAGAAGGAAGAAGG - Intergenic
971609273 4:28700890-28700912 AAGAAGAAGAAGAAGAAAACAGG + Intergenic
971849075 4:31960107-31960129 AAGAAGAGAAAGAAGAAAGAAGG - Intergenic
972546731 4:40087215-40087237 CATAAGAGGAAGAAAGAAAGGGG - Intronic
972707492 4:41559528-41559550 AAGAAGAGGATGAAGAAAACGGG - Intronic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
973306685 4:48659954-48659976 AAGAAGAAGAAGAAGAAAGGAGG + Intronic
973711433 4:53633721-53633743 CAGAGGAGGAAGATGGATGAGGG - Intronic
974091393 4:57315049-57315071 GAGAAGTGGAAGAAAGAGGCTGG - Intergenic
974279589 4:59775239-59775261 AAGAAGAGGAAGATGAAAGGAGG - Intergenic
974498715 4:62667936-62667958 TAGAAGAGGAAGAATGAATAGGG + Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975156088 4:71074654-71074676 AAGAAGGGGAGGAAGGAAGAAGG + Intergenic
975211362 4:71703895-71703917 TAAAAGTGGAAGAAGGAAGCAGG - Intergenic
975336306 4:73180259-73180281 AAGAAGAGAAAGAAGGAACATGG + Intronic
976127311 4:81847709-81847731 GAAAAGAGGGAGCAGGAAGCAGG - Intronic
976274027 4:83258055-83258077 AAGAAGAGCCAGAAGGCAGCAGG + Intergenic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
976628196 4:87209028-87209050 TAGAACAGGAAGACAGAAGCAGG + Intronic
976749026 4:88435188-88435210 AAGAAGGGGAAGAAGGAAAGAGG - Intronic
976757435 4:88513447-88513469 AAGAACAGGAAGAAGGAAAAGGG - Intergenic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
977002830 4:91525022-91525044 CAAAAGAGAAAGAAGGAATGGGG + Intronic
977417098 4:96747901-96747923 CACATGTGGAAGAATGAAGCTGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978315100 4:107427064-107427086 GAGCAGAGGAAGAAGAATGCAGG - Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
979324521 4:119363049-119363071 AAGATGAGGAAGAAGGATGCTGG + Intergenic
979401898 4:120259405-120259427 TAGAAGGGGAAGGAGGAAGCTGG + Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
979888799 4:126064152-126064174 CAGAGGAGAAAAAAGGAAGGAGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980264616 4:130499312-130499334 GAAAAGAGAAAGAAGGAAGGAGG - Intergenic
980454557 4:133022493-133022515 AAGCCGAAGAAGAAGGAAGCTGG + Intergenic
980537976 4:134153972-134153994 CCAAAGAGGAAAAAGGAAGGTGG + Intergenic
980672216 4:136024891-136024913 CAGAAGAGAAAGAGTGAAGCGGG - Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981027863 4:140094764-140094786 CAGGAAAGGAGGAAGGAAGCGGG - Intronic
981093498 4:140756387-140756409 AAGAGGAGGAGGAAGGGAGCGGG + Intergenic
981137563 4:141229063-141229085 CATAAGAGAAAAAAAGAAGCTGG + Intronic
981585091 4:146291987-146292009 AAGAACAGGAAGGAGGAACCAGG + Intronic
982063790 4:151632434-151632456 CAGAAGATAAAGAAGGAAACAGG + Intronic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982624898 4:157754318-157754340 CACAGGAGGAAGATGGATGCAGG - Intergenic
982776259 4:159444555-159444577 CAGAAGAGGCAGCATCAAGCAGG - Intergenic
983242358 4:165247746-165247768 AAGATGAGGAAGAGGGATGCTGG + Intronic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
984273932 4:177584622-177584644 CAGAAGAAGTAGAAGCCAGCAGG + Intergenic
984536172 4:180978336-180978358 CATGAGAGGAAGAAAAAAGCTGG - Intergenic
984864681 4:184271583-184271605 CAGTAGAGCAAGAAGGAAATGGG - Intergenic
985028023 4:185758648-185758670 AAGAAGGGGAAGGTGGAAGCTGG - Intronic
985078682 4:186243438-186243460 CAGATGAGGAAGAAAAAAACTGG + Intronic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985320890 4:188709635-188709657 GAGAACAGGAGGAAAGAAGCTGG + Intergenic
985591573 5:768137-768159 CCCAAGAGGAAGAGGGGAGCAGG + Intergenic
985609489 5:879096-879118 CCCAAGAGGAAGAGGGGAGCAGG + Intronic
985625067 5:981607-981629 CAGAGTGGGAAGAAGGCAGCTGG + Intergenic
985898094 5:2762337-2762359 AAAAAGAGGAAGAAGGAAAAAGG + Intergenic
986118215 5:4801779-4801801 CAGAAGAGATTGAAGGAAGTTGG - Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986362441 5:6993221-6993243 AAGAAGAAGAAGAAAGGAGCGGG - Intergenic
986482651 5:8204347-8204369 CAGAAGGTGAAGGAGGAAGGAGG - Intergenic
986634907 5:9811624-9811646 CAGAAGAAGAAGAAGAAAAAAGG - Intergenic
986997711 5:13626143-13626165 CACAAGAAGAAGAAGAAAGAGGG + Intergenic
987190887 5:15477204-15477226 GAGAAGAGGGAGAAGGAAAATGG - Intergenic
987294062 5:16534652-16534674 CAGAAAAGGAACATGGCAGCTGG - Intronic
987837397 5:23179064-23179086 CTGATGAGGAAGAATGAATCTGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988710634 5:33770775-33770797 GAGAAGGAGAAGAAGAAAGCAGG - Intronic
988995036 5:36706514-36706536 TAAAAGTGGAAGAAGGAGGCAGG + Intergenic
989080834 5:37618841-37618863 AAGAAGAGAAAGGTGGAAGCAGG + Intronic
989272598 5:39550544-39550566 CAGAAGAGAGGGAAGGAAGGAGG + Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989414122 5:41153606-41153628 CAGAAGAGAATAAAGGACGCAGG + Intronic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
989986943 5:50712015-50712037 CAGAAGTGGAAGAAGTAATGAGG - Intronic
990495128 5:56339514-56339536 TAGAAGTGGAAGAAGGAAGGAGG - Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990990519 5:61679049-61679071 CACAGAAGGAAGGAGGAAGCAGG + Intronic
992322353 5:75626177-75626199 TAGAATGGGAAGAAGGAATCTGG - Intronic
992342816 5:75843781-75843803 AAGAAGAGGAAGAAGGACCCTGG + Intergenic
992448106 5:76851622-76851644 GGGTAGAGGAAGAAGGGAGCAGG + Intronic
992967577 5:82018844-82018866 CAGAGTAGGAAAAGGGAAGCAGG - Intronic
993253302 5:85555980-85556002 GGGAAGGGTAAGAAGGAAGCAGG + Intergenic
993535681 5:89083091-89083113 TAGAAGAGAAAGCAGGAAGGGGG - Intergenic
993876851 5:93317594-93317616 GAAAAGAGCAAGAAAGAAGCTGG + Intergenic
993903735 5:93601766-93601788 CAGAAGAGGAAAAAGGGTGGTGG + Intergenic
994239337 5:97402625-97402647 TAGAAGTGGAAGAAGGAAACTGG + Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
996016346 5:118538145-118538167 CACAGGAGGAAGATGGAGGCTGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996106416 5:119509541-119509563 AAGAAGAGGAAGAAGAAACTAGG - Intronic
996127537 5:119744005-119744027 AAGAAGAAGAAGAAGAAAGGAGG + Intergenic
996354582 5:122581612-122581634 AAAAAGAGGAAGAGGGAAGGAGG + Intergenic
996476118 5:123923092-123923114 TTGAAAAGGAAGTAGGAAGCTGG - Intergenic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
996662450 5:126020469-126020491 TGGAACAGGAGGAAGGAAGCAGG - Intergenic
996732073 5:126726095-126726117 AAGAGGAGGAAGAAGAAAGAAGG + Intergenic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997587010 5:135049192-135049214 CAGAAGTGTGAGCAGGAAGCAGG - Intronic
997606773 5:135180479-135180501 CAGTGGAGGATGAAGGAACCAGG - Intronic
997713795 5:136027863-136027885 AAGAAGGGGAGGAAGGTAGCAGG - Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997804623 5:136904994-136905016 GAAAGGAGGAAGAAGGAAGAAGG - Intergenic
997853379 5:137352630-137352652 AAGACGAGGAAGAAGGAGGGAGG + Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
997963036 5:138337402-138337424 CAGAAAGGGAAGGAGGAAACAGG - Intronic
997975687 5:138440203-138440225 CCGAATGGGAAGAAGGGAGCAGG - Intronic
998005624 5:138655054-138655076 GAGAAGAGAAAGAAGAAAGAGGG + Intronic
998075441 5:139232556-139232578 GAGAGGAGAAAGAAAGAAGCTGG - Intronic
998192758 5:140041850-140041872 CAGGAGAGGAAGGAGGGGGCGGG + Intronic
998225760 5:140325053-140325075 CTGAAGAGCAAGAGGGCAGCTGG + Intergenic
998232686 5:140371421-140371443 AACAAGAGGAAGAGGAAAGCAGG - Intronic
998894507 5:146785195-146785217 TAGAAAAGGAGGAAGGAAGTGGG + Intronic
998966398 5:147545562-147545584 CAGAAGAGAAAGAGGGCAGTGGG - Intergenic
999013512 5:148070109-148070131 AAAAGGAGGAAGAAGGAAGGAGG + Intronic
999084817 5:148878267-148878289 AAGAAGAGGAGGGAGGAAGAGGG + Intergenic
999418332 5:151419073-151419095 CAGAAGGCGAAGAAGAAACCAGG - Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999658768 5:153836301-153836323 CACAAGAGACAGAAGGAAGCTGG - Intergenic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999751712 5:154632355-154632377 GAGAAGGGAAAGAAGGAAGGAGG - Intergenic
999916148 5:156263788-156263810 CACAAGTAGAAGAATGAAGCTGG - Intronic
999970764 5:156859919-156859941 CAGAATAGGAAGAAAGATTCTGG - Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000567484 5:162867711-162867733 CAGTAGATGAAGGGGGAAGCAGG - Intergenic
1001563114 5:172683133-172683155 AAGAAGAGAAAGGAGGAGGCAGG + Intronic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1001609016 5:172984727-172984749 CAAAAGAGGAACCAGGAAGAGGG - Intronic
1001675456 5:173509381-173509403 CTGAAGAGAAAGAACAAAGCTGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001840972 5:174876438-174876460 CAGAAGAGGAAGCAGGCAGGTGG + Intergenic
1001862434 5:175069170-175069192 CAGGAGAGAAAGAGCGAAGCAGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002370740 5:178752053-178752075 AAGAAGAAAAGGAAGGAAGCAGG - Intergenic
1002380198 5:178822142-178822164 CAGAAAATTAACAAGGAAGCTGG - Intergenic
1002382665 5:178841374-178841396 AAGGAGAGGAAGAAGGGAGGGGG - Intergenic
1002406007 5:179032064-179032086 AAGAAGAGGAGGAAGGAAGCAGG - Intronic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1002969130 6:1996119-1996141 AAGAAGAGGAAGGAGGAAGGAGG - Intronic
1002995623 6:2281448-2281470 CAGAAGAGGAAGTAGTAATCAGG - Intergenic
1003000378 6:2326100-2326122 TAGAACAGGAAGAAGAGAGCTGG - Intergenic
1003006453 6:2387065-2387087 GAGAAGAGGAAGCAGGAACATGG + Intergenic
1003389822 6:5703967-5703989 CGGCAGAGGAAGGAGGAAGAGGG - Intronic
1003577547 6:7312354-7312376 AAGAAGAGGAAGAAGGCAGAAGG + Intronic
1003612270 6:7624521-7624543 CAGAAGAGGAAAAAGGGAGAAGG + Intergenic
1003693675 6:8380147-8380169 AAGAACAGCAAGAAGGAAGAGGG + Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003940122 6:11016151-11016173 GAGAAGGGGAAGAAGGAAGAAGG - Intronic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004266451 6:14152078-14152100 AGGAAGAGGAAGAAGGAAGGAGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004525816 6:16406762-16406784 CAGAAGAGAACAAAGGAAGGAGG - Intronic
1004546555 6:16603715-16603737 CAGAACAGGCAGGAGGAAGTAGG + Intronic
1004572334 6:16859382-16859404 AAGAAGAGGAAAAAGAAAACAGG - Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005136091 6:22570583-22570605 GAGAAGAGGGAGCCGGAAGCTGG - Exonic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1005421904 6:25660042-25660064 CCAAAGAGGAAGAAGCTAGCAGG + Intronic
1005493013 6:26364073-26364095 GGCAAGAGGAAGAAGGAAGAAGG + Intergenic
1006273147 6:32979884-32979906 CAGAGGAGGAGGAAGAGAGCAGG + Exonic
1006730406 6:36231752-36231774 TTGAAGAGAAAGAAGGAAGGAGG - Exonic
1007056746 6:38893373-38893395 TAGAAGAGAAGGAAAGAAGCAGG + Intronic
1007393237 6:41562536-41562558 AAAAAGAGAAAGAAGGAAGGAGG - Intronic
1007431946 6:41781502-41781524 CAGAAGAGGAAGGAAGCAGGTGG + Exonic
1007630592 6:43271023-43271045 CAGAAGAGGCAGGCGCAAGCTGG - Intronic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007782896 6:44264419-44264441 TAGCAGAGGAGGAAGTAAGCTGG + Intronic
1007837726 6:44687548-44687570 CACAAGTAGAAGAATGAAGCTGG - Intergenic
1007935798 6:45730767-45730789 GTGAAGAGGAAGAAGAAAGGGGG - Intergenic
1008007847 6:46431011-46431033 CAGAAGCAGAATATGGAAGCAGG + Intronic
1008282988 6:49618335-49618357 AAGAGGAGGAATAAGGAAGTGGG - Intronic
1008302126 6:49854165-49854187 CAGAAGAGGAGGAAAGAAAGGGG - Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008510086 6:52267856-52267878 CAGAAGAGGAAGAGGTAAGGTGG - Exonic
1008538219 6:52524143-52524165 TGGAAGGGGCAGAAGGAAGCTGG + Intronic
1008800493 6:55362981-55363003 AAGAAGAGGAAACAGGAAGGAGG + Intronic
1008821784 6:55641577-55641599 CAGAATTGGAAGAAGGGAGTAGG + Intergenic
1008828685 6:55731200-55731222 TAAAAGTGAAAGAAGGAAGCAGG + Intergenic
1008869203 6:56252065-56252087 AAGAAGAGAAAGAAGAAAGAAGG - Intronic
1008936341 6:56996614-56996636 AAGATGAGGAAGAAAGAAACAGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1010014542 6:71089337-71089359 CAAAGGAGGAAAAAGCAAGCAGG - Intergenic
1010194325 6:73224472-73224494 GAGAAGGGGATGAAGGAGGCCGG + Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010311381 6:74389870-74389892 AAGAAGAGGAAGGAGGAAGAAGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1010376434 6:75176114-75176136 GAAGAGAGGAGGAAGGAAGCAGG + Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010719893 6:79271005-79271027 AAGAAGAGGAAGATGGAAGGAGG + Intergenic
1010967441 6:82227890-82227912 CAGATAAGGAAAAAGGAAGTGGG - Intronic
1011219283 6:85036861-85036883 CAGAAGAGGAAGCAGGGAAATGG + Intergenic
1011242319 6:85286038-85286060 CGACAGAGGAAGAAGGAAGCGGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011719027 6:90136010-90136032 CAAAAGAGAAAGAAGGAAAGAGG - Intronic
1011720442 6:90150615-90150637 AAGGAGAGGAGGAAGGAAGGAGG + Intronic
1011871665 6:91901951-91901973 AAGAGGAGGAAGAAGGAAAATGG + Intergenic
1012152600 6:95773480-95773502 CAAAAGAGGAAGAAGAAGGGGGG - Intergenic
1012976156 6:105783235-105783257 CAGAAGTAGAAGAAAGAAGGAGG + Intergenic
1013085259 6:106851461-106851483 GACAAGAGGATGACGGAAGCAGG - Intergenic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013760274 6:113510275-113510297 CAGAACAGGAGGAAGGGACCGGG - Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014213295 6:118729404-118729426 AATAAGAGGAAAAAGGATGCTGG + Intergenic
1015452022 6:133380928-133380950 GAGAAGAGGAAGAAAGGAGGAGG - Intronic
1015637040 6:135287353-135287375 CAGAAGAGGAAGAAACACACTGG + Intronic
1015726393 6:136303705-136303727 AAGCTGAGGAACAAGGAAGCTGG - Intergenic
1015778723 6:136841502-136841524 CAGAAGAGAAAGACTGAGGCAGG - Intronic
1015844448 6:137505059-137505081 CAGAAGAGAAAAAAGGAAATGGG + Intergenic
1016073811 6:139772668-139772690 AAGGAGAGGGAGAAGGAAGGAGG - Intergenic
1016154427 6:140786229-140786251 CTGAAGAGGAAGAATCAAGCTGG + Intergenic
1016244792 6:141968901-141968923 AAGCTGAGGAAGAAAGAAGCTGG - Intergenic
1016546473 6:145229613-145229635 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1016624648 6:146152318-146152340 CAGAAAAGTAAGAAGGAAAGTGG - Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016918528 6:149267276-149267298 AGGAAGAGGAAGAAGGAATCTGG - Intronic
1017228278 6:152044687-152044709 CACAGGAGAAAGATGGAAGCCGG + Intronic
1017462959 6:154668372-154668394 GAAAGGAGGAAGAAGGAAGAAGG + Intergenic
1017635743 6:156441534-156441556 GAGAAGAAGAGGAATGAAGCAGG + Intergenic
1017663423 6:156695787-156695809 CAGAAGAACAAGAGAGAAGCAGG - Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018392933 6:163354206-163354228 CGGAAGAGGATGAAGAATGCGGG + Intergenic
1018516305 6:164583427-164583449 TAGAAGAGAAAGAATGAAGATGG - Intergenic
1018762701 6:166905488-166905510 GAGAAGAGGAATGAGGAAGCTGG + Intronic
1018807587 6:167273260-167273282 CACCAGAGCAATAAGGAAGCAGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1019080603 6:169427029-169427051 CAGATGAGGAAGAAATCAGCAGG + Intergenic
1019180706 6:170186055-170186077 CAGGAGAGCAGGAAGGAAACGGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019776148 7:2913117-2913139 GAGAAGAGGGAGAAGGGAGGAGG + Intronic
1019814898 7:3192452-3192474 CAGCAGAGGAAGCAGGCAGGTGG - Intergenic
1019923264 7:4176103-4176125 AAAAAAAGGAAGAAGGAAGTTGG - Intronic
1019937738 7:4267331-4267353 GAGAAAAGGAAGAAGGAATAGGG - Exonic
1020333657 7:7044554-7044576 CAAAAGATGAGGAAGGTAGCTGG + Intergenic
1020466956 7:8491079-8491101 CTGATGAGGAAGAAGGCAACTGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021228466 7:18056773-18056795 CAGAAGTGGATGGAGGAAGGTGG - Intergenic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021480519 7:21110680-21110702 GAGAAGAAGAAGAAGAAAACAGG + Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022456700 7:30564259-30564281 CAGAAGAGGAATAGGGCATCTGG + Intergenic
1022670299 7:32449357-32449379 AAGAAGAGGAAGAAGGAGAAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023623554 7:42095586-42095608 GAGAAGAGAAAGATGGAAGGTGG + Intronic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023708484 7:42967067-42967089 CAAAGGAGGAGGAAGGAAGAGGG - Intergenic
1023799813 7:43824123-43824145 CAGCAAAGGAAGGAGGGAGCGGG + Intergenic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024787629 7:52926409-52926431 GAGAAGAGGAAGAAGAAAGGGGG + Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026684925 7:72501464-72501486 AGGAGGAGGAAGAAGGAAGGAGG + Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027552637 7:79618563-79618585 TAGAAGTGGAAGAGGGAACCAGG + Intergenic
1028170577 7:87590869-87590891 TAGAAGAGCAAAAAGGAAGGAGG + Intronic
1028199527 7:87944893-87944915 AGGAAGAAGAAGAAGGAAGGAGG - Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028491870 7:91421741-91421763 CAAAACAGTAAGAAGGAAGAGGG - Intergenic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028949171 7:96615185-96615207 CAGAAGAGGATGATGGAAACTGG - Intronic
1028951067 7:96635483-96635505 CAGAAAAGGAGCAAGGCAGCAGG + Intronic
1028996163 7:97102391-97102413 CACATGTAGAAGAAGGAAGCTGG + Intergenic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029184740 7:98730463-98730485 CAGCAGAGGAATGAGGCAGCAGG + Intergenic
1029272112 7:99383505-99383527 CAGCAGGGGAGGAAGGCAGCGGG + Intronic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029518695 7:101045914-101045936 AAGAAGAGGAAGACAGAAGGAGG - Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029929703 7:104357798-104357820 AAAAAGAGGAAAGAGGAAGCTGG - Intronic
1029967462 7:104754991-104755013 ATGAGGAGGAAGAAGGAAGTGGG + Intronic
1030014998 7:105210382-105210404 CAAGAGAGGAAGAAGGAGGGAGG - Intronic
1030152862 7:106424121-106424143 CAGGTGAGGAAGAAGGTAGCAGG - Intergenic
1030271456 7:107673107-107673129 TAGATGAGGAACATGGAAGCTGG + Intronic
1030319589 7:108150977-108150999 CACACAAGGAAGAAGGGAGCTGG - Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030575661 7:111282924-111282946 CAGAAGATCAACAAGGAAACAGG + Intronic
1030597439 7:111556969-111556991 GAGAAGAGGAAGAAGGTATGAGG - Intronic
1031302429 7:120079206-120079228 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1031602997 7:123735742-123735764 CAGAAAAGGAAAAAGCAAGGAGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031715309 7:125101924-125101946 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032498645 7:132382210-132382232 GAGAAGAGGAAGCAGGAAGAGGG + Intronic
1032548482 7:132762862-132762884 CAGTAGAGGAAGAAGATGGCAGG - Intergenic
1032669356 7:134069252-134069274 GAGAAGAGGAGGGAGGAAGTAGG - Intergenic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1032871459 7:135990447-135990469 CAAAAGAGGAAGAAGGAATAGGG + Intergenic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032932820 7:136694118-136694140 CTGAAGAGGAAGATGAATGCGGG - Intergenic
1033225785 7:139561037-139561059 TGGAAGAGGCAGCAGGAAGCTGG + Intergenic
1033234890 7:139630388-139630410 AAGAAAAGGAAGAATGAAGCGGG - Intronic
1033247431 7:139729553-139729575 CACACGAGGAAGAACCAAGCCGG - Intronic
1033255536 7:139798222-139798244 CAGAAGGAAAAGAAAGAAGCCGG + Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033592850 7:142828148-142828170 AAGAGGAGGAAAAAGGTAGCTGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034238215 7:149589278-149589300 CACTGGAGGAAGAAGGATGCTGG - Intergenic
1034427074 7:151019576-151019598 TAGAAGAGGATGAAGGAAGTAGG - Intronic
1034670003 7:152850554-152850576 CAGAGCAGGAAGAATGAAACGGG - Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036053299 8:5224447-5224469 CAGAAGAGGAAGGACAAAGGAGG + Intergenic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036437324 8:8746738-8746760 GAGGAGAGGAAGAAGGGAGTGGG - Intergenic
1036518197 8:9465524-9465546 AAAAAAAGGAAGAAGAAAGCAGG + Intergenic
1036604498 8:10293697-10293719 CAGGAGGGGAGGAAGGAAACAGG - Intronic
1036667982 8:10760133-10760155 CAGGAGAGGCGGGAGGAAGCTGG + Intronic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1037209273 8:16365825-16365847 CACATGTGGAAGAATGAAGCTGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037572667 8:20171924-20171946 GAGAAGAAAAAGAAGAAAGCGGG + Intronic
1037713735 8:21378165-21378187 CAAAAGAGGAGGGAGGAAGGTGG - Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037932391 8:22889366-22889388 GAGAAGAGGAAGGTGGAAGCTGG + Intronic
1037932693 8:22891684-22891706 CAGCAGAGGAGGAATGGAGCTGG + Intronic
1037951017 8:23018863-23018885 GAGAAGAGGGAGAATGGAGCAGG + Intronic
1038072322 8:24030776-24030798 GAGAAGATGAAGATGGATGCAGG + Intergenic
1038431972 8:27507596-27507618 GAGAAGAGGCAGGAGAAAGCTGG + Intronic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1038531055 8:28318136-28318158 GAGAGGAGGAAGAAAGAAGGTGG - Intronic
1038559826 8:28564286-28564308 CAGAAGAGAAAGAAAAATGCTGG + Exonic
1038610326 8:29054825-29054847 CATCACAGGAAGAAGGAACCTGG + Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038698096 8:29824260-29824282 AAAAAGAAGAAGAAGGAAGTGGG + Intergenic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039221677 8:35338732-35338754 AAGGCGAGGAAGAAGGAAACTGG - Intronic
1039257591 8:35735888-35735910 CAAAAGAGTAAAAAGAAAGCAGG + Intronic
1039745258 8:40419840-40419862 CAGGGAAGGAAGAAGGAATCTGG + Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039806188 8:41001730-41001752 AAGAGGAGGAGGAAGGAAGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1041111749 8:54489418-54489440 CTGAACAGGAAGAAGGAAGGAGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041362611 8:57068678-57068700 AACAAGGGGAAGAAGAAAGCTGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1041756041 8:61313970-61313992 CAGAAGAGGAAGTTGGCACCCGG - Intronic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1042055399 8:64759050-64759072 GAGAAAAGGAAGGAGGAAGAAGG + Intronic
1042174673 8:66027262-66027284 GAGGAGAGGAGGCAGGAAGCTGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1042372841 8:68012018-68012040 CAGAAGATGAAGCAGAAATCAGG - Intronic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042601735 8:70505667-70505689 AAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1042785118 8:72537483-72537505 CAGAAGAGGAAAAATCGAGCGGG - Exonic
1042860454 8:73308060-73308082 AGGAAGAGAAAGAAGGAAGCTGG - Intronic
1042881848 8:73501910-73501932 CCAGAGAGGAAAAAGGAAGCAGG + Intronic
1043128550 8:76431786-76431808 AAGAAGAGAAAGAAGGAAACAGG + Intergenic
1043271118 8:78334880-78334902 CAGAACAGTAAGATGTAAGCAGG + Intergenic
1043981439 8:86645325-86645347 CAAAAGAGGAAGTAGGAAGTAGG - Intronic
1044172647 8:89074773-89074795 CAGCAGAGGAAGTAGTCAGCAGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044543718 8:93436231-93436253 CAGAAAAGGAAGAACTAAACAGG + Intergenic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045393712 8:101739610-101739632 CAGGGGAGAAAGATGGAAGCCGG - Intronic
1045587830 8:103559217-103559239 AAAAAGAAGAAGAAGGAAGTGGG - Intronic
1046672825 8:117076026-117076048 AGAGAGAGGAAGAAGGAAGCAGG - Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047715696 8:127593107-127593129 CAGCAGAGGTAGAAGCCAGCAGG - Intergenic
1047920216 8:129627955-129627977 GAAAAGAGGATGAAGGAACCAGG - Intergenic
1048056360 8:130869962-130869984 AGGAGGAGGAAGAAGGAAGAAGG - Intronic
1048225022 8:132576868-132576890 CAGAAGTGGAAGAAGGGAGAGGG + Intronic
1048235250 8:132683495-132683517 CAGAAGACCAAAAAGGAAGAGGG - Intergenic
1048263441 8:132965008-132965030 GAGAAGAGAAACAAGGCAGCAGG - Intronic
1048599648 8:135906230-135906252 CAGGCGAGGAAAAAGGAAGAAGG - Intergenic
1048928570 8:139292403-139292425 CAGAAATGGATGAAGGAAGAAGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049311822 8:141937513-141937535 GAGAAAAGGAAGAAGGGAACGGG - Intergenic
1049331698 8:142058008-142058030 AGGAAGGGGAAGAAGGAAGAGGG + Intergenic
1049343530 8:142126594-142126616 CAGGAGAGGAAGAGGGACGGCGG + Intergenic
1049361296 8:142213627-142213649 GAGCAGAGGAAGGAGGCAGCTGG + Intronic
1049551246 8:143260990-143261012 CAGGAGAGCAGGAAGGGAGCAGG + Intronic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1050354077 9:4766743-4766765 CAAAAGAGGAAGAAGAATGGTGG + Intergenic
1050475910 9:6040922-6040944 GAGAAGATGAAGAAGTAAGGAGG - Intergenic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050568685 9:6914748-6914770 CAGAAGAGATAGAAGGAATGGGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050744271 9:8858203-8858225 AAGAAGAGGCAGCAGGAAGGAGG - Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051339499 9:16098458-16098480 CAGAAGGAGAATAAGAAAGCTGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051596128 9:18825964-18825986 AAGAGGAGGAAACAGGAAGCTGG - Intronic
1051715294 9:19976429-19976451 CAGAAGAGAGAGAGTGAAGCAGG - Intergenic
1051767830 9:20543715-20543737 CGGAGGAGGAAGGAGGAAGGAGG + Intronic
1051986245 9:23091097-23091119 TAGAAGAGAAAGAAAGAAGAAGG + Intergenic
1052349553 9:27444357-27444379 CTGAAGAGGTGGAAGAAAGCAGG - Intronic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052687337 9:31772567-31772589 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1052776775 9:32740497-32740519 CAGACCTGGAAGGAGGAAGCAGG - Intergenic
1052973574 9:34396387-34396409 CAGATGAGGAAGGAGGATGTAGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053472696 9:38358199-38358221 CAGAAGAGGCAGCATCAAGCAGG - Intergenic
1053585791 9:39457258-39457280 GAGATGTGGAAGAAGGAAGGAGG - Intergenic
1053802321 9:41772234-41772256 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054142964 9:61543106-61543128 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1054190554 9:61983220-61983242 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054580516 9:66907964-66907986 GAGATGTGGAAGAAGGAAGGAGG + Intronic
1054647759 9:67604197-67604219 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1055106990 9:72523254-72523276 AAGAAGAGGAGGAAGGAGGGAGG + Intronic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1055317404 9:75047961-75047983 CAGAAGAGGAAGAGGAAGTCAGG - Intergenic
1055738878 9:79363962-79363984 AAGAGTAGGAAGAAGGAAACTGG - Intergenic
1056041663 9:82674515-82674537 CTGAAGAGGAACAATGAACCAGG + Intergenic
1056206465 9:84323992-84324014 GAGAAGAGGAAGAAAGAAGTAGG - Intronic
1056316174 9:85392638-85392660 AAGAAAAGAAGGAAGGAAGCAGG - Intergenic
1056328016 9:85497166-85497188 AAGAAGAAGAAGAAAGGAGCGGG + Intergenic
1056608016 9:88103357-88103379 AAGAGGAGGAAGATGGAAGATGG - Intergenic
1057089044 9:92239738-92239760 GAGAAGACAAAGTAGGAAGCTGG - Intronic
1057206056 9:93173315-93173337 CAGAGCAGAAAGAAGGAACCGGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057800466 9:98188049-98188071 GAGAAGAGGAAGAGAGGAGCAGG - Intronic
1057903732 9:98968504-98968526 CAGAAGAGGAAGAGGCAATGTGG - Intronic
1058039063 9:100284352-100284374 CAGAACAGCAAAAAGGAAGGCGG + Exonic
1058268980 9:102945346-102945368 CAGAAGGAGAAGAAAGGAGCAGG - Intergenic
1058376743 9:104330799-104330821 GAAAAGATGAAGAAGGAAGAAGG + Intergenic
1058444571 9:105043415-105043437 AAGAAGAGGAAGAAAAAAGGAGG + Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1059052951 9:110947935-110947957 CAGAAGTGGAGGAAGTAAGTTGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059339241 9:113588115-113588137 CTGCAGGGGAGGAAGGAAGCAGG - Intronic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059823203 9:117997113-117997135 GAAAAGAGGAAGGAGGAAGGAGG - Intergenic
1059955461 9:119511172-119511194 AAGAAGAGGAAGAAGGTTGAGGG + Intronic
1060180405 9:121529789-121529811 CAGGAGAGTGAGAAGAAAGCTGG + Intergenic
1060366971 9:123026766-123026788 CAGAAGAGGATTCTGGAAGCCGG - Intronic
1060477838 9:123999328-123999350 GAGGGGAGGTAGAAGGAAGCCGG + Intergenic
1060796673 9:126516640-126516662 CAGAACAGCAAGAAAGATGCAGG + Intergenic
1061038218 9:128125203-128125225 CAGGAAAGGAGGAAGGATGCAGG + Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061910387 9:133719268-133719290 CAAAAGGGGAAGAAGGAAGAAGG + Intronic
1061947099 9:133914632-133914654 GAGGGGAGGAAGCAGGAAGCAGG + Intronic
1061995111 9:134179258-134179280 CAGGGGAGGAAACAGGAAGCAGG - Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062485669 9:136774048-136774070 CAGAACAGCAAGATGGAAGGAGG + Intergenic
1062502882 9:136858802-136858824 CAGAAGCGGAGGCAGGAGGCTGG - Exonic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185501747 X:602075-602097 GAGAAGAAGAAAAAGGAAGGAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185603532 X:1354773-1354795 AAGAAGAGGAAGAAAGGAGGAGG + Intronic
1185652209 X:1656159-1656181 CAAAGGAGGAAGATGGAGGCTGG - Intergenic
1185700431 X:2227350-2227372 AAAAAGAGGAAGAAGAAAGGAGG + Intronic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1185827034 X:3261346-3261368 CAGACCAGGAAGGAGGAAGGAGG + Intergenic
1186032427 X:5384397-5384419 AAGCTGAGGAAGAAGGAAGCCGG + Intergenic
1186132892 X:6487862-6487884 TAGAAAAGGAAGGAGTAAGCAGG - Intergenic
1186290154 X:8088721-8088743 CTGAAGGGGAAGAAAGAACCAGG - Intergenic
1186402612 X:9273672-9273694 GGAAGGAGGAAGAAGGAAGCAGG + Intergenic
1186402630 X:9273776-9273798 GGAAAGAGGAAGAAGGAAGGAGG + Intergenic
1186402639 X:9273838-9273860 GGAAGGAGGAAGAAGGAAGCAGG + Intergenic
1186402651 X:9273894-9273916 TGGAGGAGGAAGAAGGAAGTAGG + Intergenic
1186402687 X:9274100-9274122 GGGAAAAGGAAGAAGGAAGTAGG + Intergenic
1186471176 X:9823145-9823167 GAAAAGAAGAAGAAGGAAGAAGG - Intronic
1186490751 X:9970337-9970359 AAGAAGAGAAAGAGGGAAGAAGG - Intergenic
1186490783 X:9970477-9970499 AAGAAGAGAAGGAAGGAAGGAGG - Intergenic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1186617502 X:11204718-11204740 CAGAAGACTAAGTAGGTAGCTGG - Intronic
1186699204 X:12071235-12071257 TATAGGAGGAAGAAGGAAGGAGG - Intergenic
1186833536 X:13415080-13415102 CAGAAGATAACGAAGGAGGCTGG - Intergenic
1187025681 X:15433646-15433668 AAGAAGAGGAAGGAGAAAGAAGG + Intronic
1187240201 X:17506016-17506038 CAGATGAGGAAGAATGATGCTGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187679593 X:21753690-21753712 CAAAAAGGGAAGGAGGAAGCAGG - Intronic
1187817932 X:23253418-23253440 CATATGAGGAAGAACGAAACTGG + Intergenic
1187999077 X:24961588-24961610 GAGAAGAGGAAGTAGAAAGGAGG - Intronic
1188019420 X:25141015-25141037 CAGAAGTGGAAACAGGAAACAGG - Intergenic
1188081156 X:25842378-25842400 CAGTACAGAAAGAATGAAGCTGG - Intergenic
1188312147 X:28630516-28630538 CTGAAGGGGAAGAAGGCAGACGG - Intronic
1188630636 X:32355086-32355108 AAGAAATGGAAGAAGGAAGGGGG - Intronic
1189056265 X:37702193-37702215 CAGAAGAGGAAGCGAGCAGCTGG + Intronic
1189134413 X:38533794-38533816 AAGAAGGGAAATAAGGAAGCAGG + Intronic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189775243 X:44464722-44464744 AAAAAGAGGAAGAAGAAGGCAGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190282503 X:48940279-48940301 CGGGAGAGGCTGAAGGAAGCTGG + Intronic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190623615 X:52314039-52314061 GAGAAAAGGAGGAAGGAACCAGG + Intergenic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1190831550 X:54063407-54063429 AAGAAGAGGAAGAAGTAAGATGG + Intergenic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1191702385 X:64056955-64056977 CAGAAGGAGAAGAACGAAGTTGG - Intergenic
1191787167 X:64928622-64928644 AAGAAGAAGAAGGAGAAAGCAGG - Intronic
1191846935 X:65553908-65553930 CAGAAGAGAACAAAGGAAGGAGG - Intergenic
1191880066 X:65836989-65837011 CAGAAGAGGAAGAAGGCCCAGGG - Intergenic
1192183634 X:68931345-68931367 GAGGAGAGGAAGAAAGATGCAGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193459166 X:81769609-81769631 CAGAAGAGGAAGGGGGACGAGGG + Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1194490440 X:94539787-94539809 AAGTGGAGGAAGAAGGAAGTTGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195068002 X:101254792-101254814 CAGGAGAGGGAGGAGGAAACAGG + Intronic
1195134514 X:101891161-101891183 CAGTAGGGGTAGAAAGAAGCAGG + Intronic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1196581108 X:117380087-117380109 CACAAGAAGAAAAAGGAAGATGG + Intergenic
1196934205 X:120713423-120713445 CAGAACAGGAAGAAGAGAGAAGG - Intergenic
1197067585 X:122252348-122252370 AAGCTGAGGAAGGAGGAAGCCGG + Intergenic
1197673427 X:129303652-129303674 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198762234 X:140044521-140044543 CAGAAGCAAAAGAATGAAGCTGG - Intergenic
1198810784 X:140534182-140534204 AAGAAGAGGAAGGAGGGAGGAGG + Intergenic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199461806 X:148093652-148093674 CAGAAGAGGAAGCCACAAGCAGG - Intergenic
1199751575 X:150824249-150824271 AGGAGGAGGAAGAAGGAAGGAGG + Intronic
1199751588 X:150824326-150824348 GAGAAGAAGAAGAAGAAAGAAGG + Intronic
1199849416 X:151714810-151714832 AGGAAGAGGAGGAAGGAAGGAGG - Intergenic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201298422 Y:12485616-12485638 AAGGAGAGGAGGAAGGAAGTAGG - Intergenic
1201422820 Y:13818918-13818940 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1201461674 Y:14232562-14232584 AAGAAGCAGAAGAAGGAAGGAGG - Intergenic
1201498589 Y:14617266-14617288 AAGAAGAAGAAGAAAAAAGCAGG - Intronic
1201598935 Y:15705945-15705967 CAGCCGAGGAATGAGGAAGCAGG + Intergenic
1201903192 Y:19064083-19064105 CAGAAGAGTAAGAGGCAAACAGG + Intergenic
1201909424 Y:19119322-19119344 CACCAGAGGCAGAATGAAGCTGG - Intergenic
1202282755 Y:23207426-23207448 AGGAAGATAAAGAAGGAAGCTGG - Intergenic
1202283136 Y:23211093-23211115 AGGAAGATAAAGAAGGAAGCTGG + Intergenic
1202434429 Y:24821811-24821833 AGGAAGATAAAGAAGGAAGCTGG - Intergenic
1202434810 Y:24825479-24825501 AGGAAGATAAAGAAGGAAGCTGG + Intergenic