ID: 954432062

View in Genome Browser
Species Human (GRCh38)
Location 3:50476066-50476088
Sequence AGGGACCCTCTTCCAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954432062_954432070 13 Left 954432062 3:50476066-50476088 CCTTCCCTTGGAAGAGGGTCCCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 954432070 3:50476102-50476124 GTGGCACCGGGCTCACCTCACGG 0: 1
1: 0
2: 0
3: 9
4: 93
954432062_954432068 0 Left 954432062 3:50476066-50476088 CCTTCCCTTGGAAGAGGGTCCCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 954432068 3:50476089-50476111 GAAGAGACAGCAAGTGGCACCGG 0: 1
1: 0
2: 2
3: 30
4: 316
954432062_954432069 1 Left 954432062 3:50476066-50476088 CCTTCCCTTGGAAGAGGGTCCCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 954432069 3:50476090-50476112 AAGAGACAGCAAGTGGCACCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
954432062_954432065 -6 Left 954432062 3:50476066-50476088 CCTTCCCTTGGAAGAGGGTCCCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 954432065 3:50476083-50476105 GTCCCTGAAGAGACAGCAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 209
954432062_954432072 22 Left 954432062 3:50476066-50476088 CCTTCCCTTGGAAGAGGGTCCCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 954432072 3:50476111-50476133 GGCTCACCTCACGGAGCTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954432062 Original CRISPR AGGGACCCTCTTCCAAGGGA AGG (reversed) Intronic
900317902 1:2068573-2068595 AGGAACCCTTTTCCAAAGGAGGG + Intronic
901194635 1:7433495-7433517 AGGTACCCACTTCTCAGGGAGGG + Intronic
902237531 1:15067166-15067188 AGGCACCCACTTCAAAAGGAGGG + Intronic
903330856 1:22596384-22596406 AGAGATCCTCTCCCCAGGGAAGG + Intronic
903813279 1:26046475-26046497 GGAGACCCTCTTCCGAGGCAAGG - Intergenic
906940024 1:50247828-50247850 AGGGGCCCTCTTTGGAGGGAGGG + Intergenic
907460353 1:54601987-54602009 AGGGGACCTCCCCCAAGGGAGGG - Intronic
911324207 1:96450313-96450335 AGGAACACTCTTCCCAGGCACGG + Intergenic
911439633 1:97909215-97909237 AAGTTCCCTCTTCCAATGGATGG - Intronic
911706133 1:101015674-101015696 AGGCATCCTCTTCCAATAGAAGG + Intronic
913058370 1:115182793-115182815 AGGGACCCTCCTGCTAAGGAAGG - Intergenic
913253322 1:116930709-116930731 AGGGACCCTCTATCAATGGTGGG - Intronic
916169656 1:161992030-161992052 TGGCACCTTCTTCCAATGGATGG + Intronic
920190874 1:204192993-204193015 AGGGACAGTCCTCCAAGAGAGGG + Intronic
920414518 1:205789818-205789840 AAGGGCCCACCTCCAAGGGAAGG - Exonic
921905675 1:220493326-220493348 AAGGACCCAGTTCCAAGGAAGGG - Intergenic
1065755652 10:28927983-28928005 AGGGATGCTCTTCCAAGGAGAGG + Intergenic
1070481739 10:76889684-76889706 AGGGTCCATGTGCCAAGGGACGG + Intronic
1071251730 10:83825935-83825957 TGGGACCCTCTTACTAGTGATGG + Intergenic
1073486542 10:103822610-103822632 GGGCAGCCTCTTCCCAGGGAGGG + Intronic
1075190134 10:120299696-120299718 AGGGACCCTCTTCTCAGTCAAGG + Intergenic
1075781824 10:125022217-125022239 AGGGACGCTCTTCCAAGCATAGG + Intronic
1076064938 10:127441515-127441537 AGGGCACCTCCTCCAGGGGACGG + Intronic
1076203489 10:128576761-128576783 AGGGTCCGTCTTCCAGAGGAGGG - Intergenic
1076370427 10:129949475-129949497 AATGACCCTGTTCCAAGTGATGG + Intronic
1076737273 10:132464499-132464521 AGCGAGCCTGCTCCAAGGGAGGG - Intergenic
1083631718 11:64098768-64098790 AGGGCAGCTCTTCCCAGGGAGGG + Intronic
1083852856 11:65378066-65378088 AGGCCCCATCTCCCAAGGGATGG - Intronic
1083880277 11:65545006-65545028 AGGGACCTTCTTGCCAAGGAAGG + Intronic
1084531921 11:69732472-69732494 AAAGACCCTCTTCAAAGGGCAGG + Intergenic
1085297019 11:75437088-75437110 AGGGTCTCTGCTCCAAGGGAGGG - Intronic
1085704099 11:78770593-78770615 AGGGACGCTTCTCCCAGGGAAGG - Intronic
1087644899 11:100797309-100797331 TGGCAACTTCTTCCAAGGGAAGG - Intronic
1089097150 11:115928508-115928530 GGGGACCTTCTTCCAAGGCCTGG + Intergenic
1090077465 11:123588240-123588262 TGGTACCCTCTTCCCAGGGATGG - Intronic
1091728145 12:2859465-2859487 AGGGCCACTCTTCCAAGGGAGGG + Exonic
1092557243 12:9570311-9570333 AGGGACCCTCATCGCAGGGGGGG - Intergenic
1095627739 12:44337303-44337325 ACTGACCCTCTTATAAGGGATGG + Intronic
1096104291 12:48987377-48987399 AGGCAGCCTCTGCCAGGGGATGG + Intergenic
1098785719 12:74751875-74751897 TGGCATCTTCTTCCAAGGGAAGG - Intergenic
1100362654 12:93892642-93892664 AGGGCCCCCCTTCCAAGGCCAGG - Intronic
1102855846 12:116292604-116292626 ATGGACCTTCTTCCACGTGAGGG + Intergenic
1103005522 12:117417330-117417352 AGGGACCCTCTTCCACAGCATGG + Intronic
1103582419 12:121925129-121925151 TGGGACCCTCTTGGAATGGATGG - Intronic
1103866290 12:124054641-124054663 AGGGACCTTCCTTCAGGGGACGG + Intronic
1104534015 12:129601019-129601041 AGGCACCTTCTTCCAATAGAAGG + Intronic
1113618997 13:111700534-111700556 AGGGACCCTCCCCCTAGGGTAGG + Intergenic
1113624526 13:111785795-111785817 AGGGACCCTCCCCCTAGGGTAGG + Intergenic
1113791256 13:113029632-113029654 GGGGACCCTCTTCCCAAGGTGGG + Intronic
1117450875 14:55848613-55848635 AGGGTGCCTCCACCAAGGGAAGG + Intergenic
1118974930 14:70668433-70668455 AGGGGCTCTCTACCAAGGGATGG + Intronic
1119102536 14:71893584-71893606 AGGTACCCTCTTCTCAAGGAGGG + Intergenic
1119460513 14:74798661-74798683 AGGGGACCTCTTCGAAGGGCTGG + Exonic
1122032419 14:98922463-98922485 AGGGATCATCTTCAAAGGAAAGG + Intergenic
1125130415 15:36278477-36278499 AGTGACCCTCTTCCCACAGAGGG - Intergenic
1128220707 15:65966609-65966631 GGGGACCTTCTTCCAAGGAAGGG - Intronic
1131149369 15:90037266-90037288 AGGGACTTTCTTCCAAGGGAAGG - Intronic
1131373507 15:91904119-91904141 TGGGACCCTCTTCAGAGGAAGGG - Intronic
1132097380 15:98997864-98997886 AGGGACCCTCCTGGGAGGGATGG - Intronic
1132539188 16:500315-500337 AAGGACCCTCCTCCCAGAGAGGG - Intronic
1136111920 16:28068859-28068881 AGGGCCACTGTTCCCAGGGAAGG + Intergenic
1137583855 16:49652085-49652107 AGGGACCCACATCCAAGCCATGG - Intronic
1138275664 16:55732299-55732321 AGGGACCCTGTCCCTCGGGAGGG + Intergenic
1140060635 16:71566401-71566423 AGGCTCCCTCCTCTAAGGGAAGG + Exonic
1141799516 16:86297338-86297360 AGGGTCCCTACTCCAAGGAAAGG - Intergenic
1142408685 16:89905139-89905161 AGGGACCCTCATCCCAGACACGG + Intronic
1143724596 17:8836596-8836618 AGGGACACTGTACCAAAGGATGG - Exonic
1146274019 17:31503456-31503478 TGGGAACCTCCTTCAAGGGAAGG + Intronic
1146953101 17:36920302-36920324 AGGGACCTTCGTCCAGGGGGAGG + Intergenic
1147211477 17:38874809-38874831 AGAGCCCCTCTTCTAGGGGATGG - Intronic
1147968211 17:44205598-44205620 TGGGTCCCTCTCCCAAAGGAAGG - Exonic
1148071095 17:44909085-44909107 AGGGACGCTCTGCCGAAGGAAGG + Intronic
1149042267 17:52204054-52204076 ATTGACCCTCTTCCAGTGGAGGG - Intergenic
1150580971 17:66473440-66473462 AGGGAGGCTGTTACAAGGGAAGG - Intronic
1151388994 17:73772937-73772959 AGGCACCCTCATCCTTGGGAGGG + Intergenic
1151558283 17:74858307-74858329 AGAGACTCTCTCCAAAGGGAAGG + Intronic
1156475955 18:37405461-37405483 AGAGCCCCTCTTCGAAGGAAGGG - Intronic
1163388639 19:17015889-17015911 AGGCATCCTCTTCCCTGGGAAGG - Intronic
1164464065 19:28472639-28472661 AGGGACCCTCTTAAAATGCAGGG + Intergenic
1164503188 19:28836421-28836443 TGGGCCCCTCTTCCATGTGAAGG + Intergenic
1166750617 19:45162524-45162546 AGGGCCACTCTGCCCAGGGACGG + Intronic
1168128257 19:54299125-54299147 AGTGAGCCTCTTCCAGGTGAGGG + Intergenic
925395608 2:3531451-3531473 AGGGACACTCTTCCAAGGACAGG + Intergenic
926695119 2:15765715-15765737 TGGCACCCACTTCCCAGGGATGG - Intergenic
927865691 2:26585909-26585931 AGAGTCCCACTTCCTAGGGAGGG - Intronic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
932001901 2:67892949-67892971 AGGGACCATTTCCCAATGGAAGG - Intergenic
932105393 2:68936933-68936955 AGGGACCATGTACCATGGGATGG + Intergenic
932269888 2:70399965-70399987 AGGGACTTTGTTCCAAGGCAGGG + Intergenic
934767176 2:96886166-96886188 TGGGACACTCTTACAAAGGAAGG - Intronic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
935687299 2:105695664-105695686 AGGGACCTTTTTCGAAGGCATGG + Intergenic
936859142 2:116995007-116995029 AGGGACCTCCTTCAATGGGAAGG + Intergenic
939869907 2:147515472-147515494 AGGATCCCTCTTCAAAGGTAGGG - Intergenic
941249359 2:163143706-163143728 AGGGACCCTCTGCAAAGCCAGGG - Intergenic
942381972 2:175401079-175401101 AGGCACCTTCTTCCCAGGGCGGG + Intergenic
942517469 2:176769019-176769041 AAGGATCCTCAGCCAAGGGATGG + Intergenic
943434493 2:187847695-187847717 AGGGACACTCTGCCAAGCCATGG - Intergenic
944242089 2:197496460-197496482 AGGAACCCTCTTGTAAGTGAAGG - Intronic
945542710 2:211108111-211108133 ATGAACCCACTTTCAAGGGAGGG + Intergenic
946023870 2:216660200-216660222 AGGGACCCTCTTACAAGGCTGGG - Intronic
947674019 2:231961442-231961464 CGGGCCCCTCTTCCACCGGAAGG - Intronic
947993770 2:234509802-234509824 AGAGACCCTCTGAGAAGGGAAGG - Intergenic
948181169 2:235981865-235981887 AAGCGCCCCCTTCCAAGGGAAGG - Intronic
948212966 2:236208565-236208587 AGGGCACCTCTTCCCAGGGTGGG - Intronic
1172513633 20:35517291-35517313 AGGGTCCAGCTGCCAAGGGAAGG + Exonic
1173051931 20:39571706-39571728 AAGGAGCCACTTCCAAGGGCGGG + Intergenic
1173836395 20:46128799-46128821 AGGGATCCGCTTCCCAGGGAGGG + Intronic
1174550196 20:51356512-51356534 AGGGACCTTCAGGCAAGGGATGG + Intergenic
1175720068 20:61280442-61280464 GGGCACCGTCTTCCAAGGCAGGG - Intronic
1175836300 20:61997473-61997495 AGCCACCCTCTTCTAGGGGACGG - Intronic
1175942904 20:62546135-62546157 ATGGACCCTTGTCCAGGGGAGGG - Intergenic
1178395088 21:32235912-32235934 CAGGACACTCTTCAAAGGGAAGG - Intergenic
1181442343 22:22943184-22943206 CTGGGCCCTCTCCCAAGGGAGGG + Intergenic
1182446112 22:30390542-30390564 AGGCACCCTGCTCCCAGGGATGG + Intronic
1182693444 22:32179444-32179466 CAGGATCCTGTTCCAAGGGATGG - Intergenic
1184340480 22:43883198-43883220 AGGGACTCTCTGGCCAGGGAAGG - Intronic
1184643803 22:45885564-45885586 AGGGCCCCACTCCCCAGGGACGG + Intergenic
1184649677 22:45913791-45913813 AGGGACCCTCTTAGAAATGAAGG + Intergenic
950641945 3:14354071-14354093 AGGGGCCCTCTGGGAAGGGAAGG + Intergenic
954225449 3:49178046-49178068 AGGGACCCTCCTCAACGGTATGG + Exonic
954432062 3:50476066-50476088 AGGGACCCTCTTCCAAGGGAAGG - Intronic
955054642 3:55444696-55444718 GGGCACCCTATTCCAGGGGAGGG - Intergenic
955234391 3:57126697-57126719 AGCGCCCCTCTTCCAGTGGAAGG + Intronic
956710714 3:72036447-72036469 AGACAAACTCTTCCAAGGGAGGG + Intergenic
956894846 3:73649010-73649032 AGGGGCCCTCTGCCCAGGGCTGG - Intergenic
962535119 3:136321635-136321657 AGGGACCATGTGTCAAGGGAGGG - Intronic
962893937 3:139697449-139697471 AAGGACCCTCTTCCATGTCATGG - Intergenic
964760660 3:160132577-160132599 AGGGCCCATGTTCCATGGGATGG + Intergenic
967529029 3:190528401-190528423 AGAGACTCTTTTCCAAGGTAAGG + Intronic
968672123 4:1857274-1857296 AGGGATCCTCATCTTAGGGAAGG - Intergenic
972593063 4:40506368-40506390 AGGAATCCTGTTCAAAGGGAAGG + Intronic
973089999 4:46124268-46124290 AGGCAGCCTCTCCCTAGGGAGGG - Intergenic
977447125 4:97144876-97144898 AGCGTGCCTCTTCCAAGGGCTGG + Intergenic
977922262 4:102658648-102658670 AGGAAGCCACTTCCTAGGGATGG - Intronic
984207149 4:176798958-176798980 AGTGACGCTCTTCCAAATGAGGG + Intergenic
985925960 5:3019241-3019263 AGGGACCCACTCCCTAGGGATGG - Intergenic
992432047 5:76718939-76718961 GGGGACCCTCCTGCAAGGGGAGG - Intronic
996810583 5:127512504-127512526 GGAGGCCCTCTTCCAAGGTAGGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999388027 5:151169275-151169297 AGGGACCCCTGTCCATGGGAGGG - Intergenic
1002101781 5:176861473-176861495 AGGGACCCTCTCCCCAGGGTGGG - Intronic
1002526276 5:179817523-179817545 AGGGACCCTCTCCTACTGGAAGG - Intronic
1003113022 6:3264664-3264686 AGGTCCCCACCTCCAAGGGAGGG - Intronic
1007345786 6:41228588-41228610 AGGGGCCCTCTTCCATGTGTGGG + Intronic
1014511588 6:122329170-122329192 AGGGACCATATTCTGAGGGAAGG + Intergenic
1015522458 6:134145444-134145466 AGGGACCCTAGTCCAGGGGGTGG + Intergenic
1015914586 6:138203120-138203142 AAGGACCCTCTTCCTAGAGGAGG - Intronic
1016191568 6:141274272-141274294 AGGGAGCCTTTACCAAGTGACGG + Intergenic
1016278392 6:142382003-142382025 GGGGACCCTCTGTCAAGGTAGGG + Exonic
1018847828 6:167567361-167567383 AGGGACCGTCCTCGAAGGGATGG + Intergenic
1023059545 7:36314730-36314752 AGGGACCCACTCCCAAAGGGTGG - Intergenic
1024106544 7:46093815-46093837 AGAGACCCTCTGCCAAGGTAGGG - Intergenic
1026563715 7:71472166-71472188 AGGGTCCCTTTTCTAAGGCATGG + Intronic
1028525702 7:91783363-91783385 AGGGATCATCTTCTTAGGGATGG + Intronic
1029032028 7:97478658-97478680 AGGGACCTACATCCAAGGCAGGG + Intergenic
1030136823 7:106260161-106260183 CGGCACCTTCTTCCAATGGAAGG + Intronic
1034318361 7:150155697-150155719 AGGGACCCTCTGCCAGTCGAAGG - Intergenic
1034774392 7:153811535-153811557 AGGGACCCTCTGCCAGTCGAAGG + Intergenic
1035386192 7:158474726-158474748 AGGGACCCTCTTCCCAAGGTCGG + Intronic
1036388257 8:8301118-8301140 AGGCATCTTCTTCCAAGAGAAGG + Intergenic
1036812143 8:11874550-11874572 AGGGTCCCTGCTCCAGGGGAGGG + Intergenic
1037514765 8:19619384-19619406 TGGGAACCTCTGCGAAGGGATGG + Intronic
1040291547 8:46128085-46128107 AGGCACCCTGTTCCAACGGTTGG + Intergenic
1040304860 8:46206723-46206745 AGGCACCCTCTTCCAAAGCCTGG - Intergenic
1040308262 8:46223446-46223468 AGGGACCCTCCTCCAAAGCCTGG - Intergenic
1040309507 8:46229467-46229489 AGGCACCCTGTTCCAAGGCCTGG - Intergenic
1045695538 8:104805482-104805504 AGGGACCATTTTCAAAGGTATGG + Intronic
1048190041 8:132280025-132280047 ACAGACCCTCTTCCAAGTGCTGG + Intronic
1050125364 9:2351843-2351865 AAGGACCATATTCCCAGGGATGG + Intergenic
1051842866 9:21418063-21418085 AGGGACTCTGTCCCAGGGGAAGG - Intronic
1057260215 9:93578644-93578666 GGGGACCCTCTGGGAAGGGAAGG + Intronic
1058915850 9:109565006-109565028 AAGGAACATCTTCCAGGGGAAGG - Intergenic
1061234556 9:129334913-129334935 GGGGACCCTCTCCCAACAGAAGG + Intergenic
1061412582 9:130429492-130429514 AGGGCCCCTCCCCCAAGGGACGG - Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1062092177 9:134684098-134684120 GGGGCCCCACTTCCAAGGGGAGG + Intronic
1185914774 X:4023803-4023825 AGGGATACTCTTCAAAGGGTCGG + Intergenic
1186776872 X:12873641-12873663 AGTCCCCCTCTTCCCAGGGAAGG + Intronic
1187244695 X:17543506-17543528 TGGGTTCCTCTTCCCAGGGAAGG + Intronic
1189208824 X:39265598-39265620 ATGGAGGCTCTTCCAATGGAGGG + Intergenic
1190877891 X:54472590-54472612 AGGGACCCCCACCCCAGGGATGG + Intronic
1197051120 X:122060968-122060990 AGGGACCATGCTTCAAGGGACGG + Intergenic
1199202790 X:145112597-145112619 AGGTATCCTCTTCCAAGTTATGG + Intergenic
1199399712 X:147383667-147383689 AAAGACCCTCTTCCAAGGTGAGG + Intergenic
1199592754 X:149483045-149483067 ACGGATCCTCTTCCAAGTCACGG + Exonic