ID: 954434656

View in Genome Browser
Species Human (GRCh38)
Location 3:50489710-50489732
Sequence ATGGATAAGCCATTGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954434656_954434670 29 Left 954434656 3:50489710-50489732 CCCCCCATCAATGGCTTATCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 954434670 3:50489762-50489784 AGGACCTCCACACCCTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 114
954434656_954434663 -4 Left 954434656 3:50489710-50489732 CCCCCCATCAATGGCTTATCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 954434663 3:50489729-50489751 CCATGGAGAAAGATGTGTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 226
954434656_954434669 28 Left 954434656 3:50489710-50489732 CCCCCCATCAATGGCTTATCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 954434669 3:50489761-50489783 CAGGACCTCCACACCCTGACTGG 0: 1
1: 0
2: 4
3: 28
4: 304
954434656_954434671 30 Left 954434656 3:50489710-50489732 CCCCCCATCAATGGCTTATCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 954434671 3:50489763-50489785 GGACCTCCACACCCTGACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 167
954434656_954434664 9 Left 954434656 3:50489710-50489732 CCCCCCATCAATGGCTTATCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 954434664 3:50489742-50489764 TGTGTCCAGGTGATCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954434656 Original CRISPR ATGGATAAGCCATTGATGGG GGG (reversed) Intronic
900005313 1:41972-41994 ATGGCCAAGACATTGATGGCAGG + Intergenic
900056348 1:633826-633848 TTGGATTAGTCATTGTTGGGTGG - Intergenic
900922032 1:5678932-5678954 ATGGATGAGAGATGGATGGGTGG + Intergenic
901183394 1:7356988-7357010 ATTGAAAAGCCCATGATGGGAGG - Intronic
902397935 1:16142671-16142693 ATGGATGAGGGATGGATGGGTGG + Intronic
903277434 1:22231060-22231082 ATAGATAAACTATGGATGGGTGG - Intergenic
904487958 1:30840081-30840103 ATGGATAGGGAATGGATGGGTGG + Intergenic
905166356 1:36085354-36085376 GTTGAGAAGCCCTTGATGGGGGG + Intronic
910814497 1:91276162-91276184 AAGGATAAGCCAAGGATGGAGGG - Intronic
912015171 1:105025584-105025606 ATGGAGAAAACATTTATGGGGGG - Intergenic
912719458 1:112007325-112007347 ATGGATATGCCACTGAGAGGGGG - Intergenic
913359610 1:117965514-117965536 AGGTAGAAGCCATTGATGGATGG - Exonic
916023859 1:160817415-160817437 ATGCATAAGCCCTTGAAGTGTGG - Intronic
922289900 1:224201398-224201420 GTGGATATGTAATTGATGGGTGG - Intergenic
923289569 1:232531331-232531353 ATGGAAAAGACATTGCAGGGAGG - Intronic
1068275974 10:54797229-54797251 ATGGATAAGAAATTGATAGGAGG - Intronic
1070633970 10:78109076-78109098 AGGGAGAGGCCATTGTTGGGTGG + Intergenic
1073139972 10:101240735-101240757 ATGGATAAGACTTTGAGGGCAGG + Intergenic
1074031236 10:109690837-109690859 ATGATTAAGCCATTTATGGTTGG - Intergenic
1074559834 10:114525387-114525409 CTGGATAAGCCACTGATGCGAGG + Intronic
1076384698 10:130047805-130047827 ATGGAAATGACATTGATGGGAGG - Intergenic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1078442825 11:11381463-11381485 ATGACTAAGGTATTGATGGGAGG + Intronic
1082630989 11:55541777-55541799 ATCTATAAGACCTTGATGGGTGG - Intergenic
1083048901 11:59759544-59759566 ATGGAGAAGCCAGTGATGTATGG + Intronic
1083519018 11:63290036-63290058 ATGGATGAGAAATTGATGCGAGG + Intronic
1084785724 11:71440636-71440658 ATGGATGATGCATTGGTGGGTGG + Intronic
1087539550 11:99498328-99498350 ATAGATAAACCAGAGATGGGAGG - Intronic
1088624793 11:111722162-111722184 AAGGATATGCCACTGAGGGGTGG + Intronic
1089985221 11:122806117-122806139 ACAAATAAGCCATTGATGGATGG - Intronic
1090965207 11:131592067-131592089 ATGGTTAAGTCAGTGATGAGGGG + Intronic
1092811234 12:12273140-12273162 ATGGATCAGCCTTGGATGGGAGG + Intergenic
1093818699 12:23584222-23584244 ACGGATAGCCCATTGACGGGGGG + Intronic
1096824588 12:54265080-54265102 TTAGATATGCCATTGATGAGTGG + Intronic
1099018362 12:77372740-77372762 ATTCATAATCCATTGAAGGGGGG - Intergenic
1099853779 12:88138711-88138733 ATGGATCAGCCTTTGAAAGGAGG - Intronic
1104426495 12:128682385-128682407 AAGGAAAACCCATTCATGGGTGG - Intronic
1104896434 12:132167136-132167158 ATGGATAAGGGATGGGTGGGTGG - Intergenic
1107404415 13:40099210-40099232 AAGGAAAAGGCATTGAGGGGAGG + Intergenic
1112158871 13:96848197-96848219 ATGGGTAAGTGTTTGATGGGAGG - Intergenic
1112164375 13:96902363-96902385 ATTGATAATGCATTTATGGGTGG + Intergenic
1113583451 13:111446244-111446266 ATGGATAAGCCAGTGAAGAAGGG - Intergenic
1123406650 15:20023506-20023528 ATGGATAAGTGATGGATGGATGG - Intergenic
1123467931 15:20529933-20529955 CTGGATAAGCCAGTGCTGAGGGG + Intergenic
1123515980 15:21030154-21030176 ATGGATAAGTGATGGATGGATGG - Intergenic
1123650182 15:22471109-22471131 CTGGATAAGCCAGTGCTGAGGGG - Intergenic
1123728245 15:23125142-23125164 CTGGATAAGCCAGTGCTGAGGGG + Intergenic
1123740588 15:23279951-23279973 CTGGATAAGCCAGTGCTGAGGGG - Intergenic
1123746410 15:23322607-23322629 CTGGATAAGCCAGTGCTGAGGGG + Intergenic
1124278677 15:28345924-28345946 CTGGATAAGCCAGTGCTGAGGGG + Intergenic
1124304023 15:28565684-28565706 CTGGATAAGCCAGTGCTGAGGGG - Intergenic
1126873874 15:53017812-53017834 ATAGAAATGCCACTGATGGGTGG + Intergenic
1128518982 15:68363013-68363035 ATGGATGATGAATTGATGGGTGG + Intronic
1129182700 15:73887097-73887119 ATGGGCAGGGCATTGATGGGTGG - Intronic
1131360649 15:91787794-91787816 ATGGATGAGGAATGGATGGGTGG + Intergenic
1132448199 15:101948969-101948991 ATGGCCAAGGCATTGATGGCAGG - Intergenic
1134632276 16:15765415-15765437 ATGGATACAGCATTGATGGATGG + Intronic
1139522310 16:67491046-67491068 AGGGAGAAGCCATTGATGGCAGG + Intergenic
1141794455 16:86261019-86261041 ATTGCTAAACCATTGATTGGGGG - Intergenic
1143072709 17:4310633-4310655 AATGATAAGCCTTTGAAGGGTGG + Intronic
1147455583 17:40536276-40536298 AGTGATAAGCCCTGGATGGGGGG + Intergenic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1152926187 17:83088810-83088832 TTGGAGAAGTCCTTGATGGGTGG + Intronic
1158180924 18:54714187-54714209 ATGGATGAGCCGGTGAAGGGGGG - Intergenic
1160637068 19:83583-83605 ATGGCCAAGGCATTGATGGCAGG + Intergenic
1161287575 19:3476904-3476926 ATGGATGATGGATTGATGGGTGG + Intronic
925627135 2:5852756-5852778 ATGGGGAGGCCATTGATGGTTGG - Intergenic
929542857 2:42835568-42835590 GTGGATAAGCCAGTGATGTTTGG + Intergenic
934011531 2:87825233-87825255 TTGGATTAGTCATTGTTGGGTGG - Intronic
935013437 2:99156993-99157015 ATGCATAAGCCATTCATGTTTGG - Intronic
935958198 2:108399414-108399436 ATAGTTAAGCCATTCATGGATGG + Intergenic
937577605 2:123443075-123443097 ATGGAAAATCTATTGATGCGAGG - Intergenic
939994141 2:148904512-148904534 ATGGATTAGGCGTTGATGGTGGG + Intronic
941478311 2:165974441-165974463 ATGTATAATCCATTGATTTGGGG - Intergenic
943389646 2:187248763-187248785 ATGGATAGGCTATTTATAGGAGG - Intergenic
944001692 2:194846847-194846869 ATGCATAAGCACTTGATGTGTGG + Intergenic
946692904 2:222322292-222322314 CTGGATAAGTCTTTGATGTGGGG + Intergenic
1168826218 20:816114-816136 TTGGTGAAGGCATTGATGGGTGG + Intergenic
1170164719 20:13349038-13349060 AGGGATCAGCCAGTGGTGGGAGG + Intergenic
1174724255 20:52844766-52844788 ATTGATCAGGAATTGATGGGGGG - Intergenic
1174845839 20:53942377-53942399 TTGGGGAAGCCATTGGTGGGAGG - Intronic
1180020039 21:45117691-45117713 ATGGATCAGCTATTGATAAGGGG + Intronic
1180930786 22:19589567-19589589 ATGGAGAAGGGATTGATGGAAGG - Intergenic
1181441511 22:22938268-22938290 ATGGGTGAGTGATTGATGGGTGG + Intergenic
1182993896 22:34795131-34795153 ATAGCTAAGCCATAGATGTGAGG + Intergenic
1183818916 22:40328221-40328243 ATGGATAAGTGATTTATTGGGGG - Exonic
1184391240 22:44204770-44204792 GTGGCTAAGACATTGAAGGGAGG + Intronic
953138832 3:40208757-40208779 ATAAATAAGCACTTGATGGGAGG - Intronic
954434656 3:50489710-50489732 ATGGATAAGCCATTGATGGGGGG - Intronic
954957656 3:54536464-54536486 ATGGATAATCCCTTGTGGGGTGG - Intronic
959582328 3:107994188-107994210 GTTGCAAAGCCATTGATGGGAGG - Intergenic
960522730 3:118674360-118674382 ATGGATATCCCAGGGATGGGGGG - Intergenic
960942685 3:122944823-122944845 ATGCATGACCCATGGATGGGTGG + Intronic
963209844 3:142676894-142676916 ATTAATAAGTCATTTATGGGTGG - Intronic
963378361 3:144498031-144498053 ATGGTGGAGCCATTCATGGGAGG + Intergenic
968594692 4:1476347-1476369 ATGGATGAGTGAATGATGGGTGG + Intergenic
969651066 4:8468456-8468478 TTGAAAAAGCCATTGATGGTGGG + Intronic
969674095 4:8605517-8605539 ATGGATAAATCAATGATGGATGG - Intronic
970329953 4:14970837-14970859 ATGGAAAAGCAATTCATAGGAGG - Intergenic
977727974 4:100319846-100319868 AATGAGAAGCCATTGGTGGGTGG + Intergenic
979911930 4:126378524-126378546 ATAAATTAGGCATTGATGGGAGG - Intergenic
980636498 4:135511183-135511205 ATGGATAAGGCAGTGCTCGGGGG + Intergenic
980679125 4:136132657-136132679 TTCGATAAGCCATTTAAGGGAGG - Intergenic
984447262 4:179852407-179852429 ATGGATAACCAAATGAAGGGAGG + Intergenic
984453758 4:179938717-179938739 ATGGACAAGCAAATGAAGGGGGG + Intergenic
985046571 4:185947001-185947023 ATGGAGTAGAAATTGATGGGAGG - Intronic
990734465 5:58844945-58844967 ATGGTGTAGCTATTGATGGGTGG + Intronic
992859602 5:80897227-80897249 ATGGATCTGCCACTAATGGGTGG + Intergenic
993744883 5:91585273-91585295 ATTGATAACACATTGATGGAAGG - Intergenic
994105774 5:95946661-95946683 ATAGCTGAGCCATTGTTGGGAGG - Intronic
1000043927 5:157505861-157505883 AAGGATAAGGCAGGGATGGGGGG - Intronic
1001716726 5:173822524-173822546 GTGGGTGAGCCATTGAGGGGAGG + Intergenic
1006059711 6:31411043-31411065 ATGGAGAAGTCACTGCTGGGTGG + Intronic
1006072199 6:31506114-31506136 ATGGAGAAGTCACTGCTGGGTGG + Intronic
1010060230 6:71614326-71614348 ATGGATTAGTCTTGGATGGGAGG - Intergenic
1010258889 6:73792640-73792662 GAGGCTAAGCCATTGATGGAAGG - Exonic
1012320990 6:97845378-97845400 AAAGATAAGCCATAGATGGAGGG - Intergenic
1015348756 6:132192163-132192185 ATGGTTAAGCCATTGATACATGG - Intergenic
1018853178 6:167655702-167655724 ATGGATGATACATTGATGGGTGG + Intergenic
1021163871 7:17309602-17309624 ATGCATTAGCCATTGTTTGGTGG - Intronic
1022017326 7:26362529-26362551 ATGGATAAGCCTTGGCTTGGTGG + Intronic
1024105749 7:46083939-46083961 ATGGATAAGCCTATTTTGGGCGG - Intergenic
1024776109 7:52788151-52788173 ATGGAGTAGCCATTGGAGGGTGG - Intergenic
1026020886 7:66705102-66705124 ATGGAAAAGCAATAGATGGCCGG + Intronic
1031714266 7:125087940-125087962 CTGGATAAGTCTTTGTTGGGGGG + Intergenic
1033460087 7:141538917-141538939 ATGGATGAGCTGTGGATGGGAGG + Intergenic
1034883628 7:154780945-154780967 ATGGATAATGAATGGATGGGTGG + Intronic
1035318696 7:158014310-158014332 ATGGATGAGGGATGGATGGGTGG - Intronic
1036644132 8:10601519-10601541 ATGGATAAGCCTGGGATGGCTGG + Intergenic
1038530442 8:28314302-28314324 ATGCAGAAGCCATTCATTGGAGG - Intergenic
1039106019 8:33990591-33990613 GTTGATTAGCCATTGATGGTGGG - Intergenic
1040332096 8:46390967-46390989 ATGGGAAAGACATTGTTGGGAGG - Intergenic
1043578321 8:81683247-81683269 AGGGATAAGACATTGATTGAAGG + Intronic
1049420646 8:142515074-142515096 CAGGAGAAGCCATTGGTGGGAGG + Intronic
1050447958 9:5746768-5746790 ATTAAAAAGCCATTGATGGTAGG - Intronic
1052473914 9:28933757-28933779 CTGGACAAGCAATTGTTGGGCGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1060329895 9:122658171-122658193 ATTGATCAGCCACTCATGGGTGG + Intergenic
1062682271 9:137788256-137788278 ATGCTGAAGCCATTGCTGGGCGG + Intronic