ID: 954437192

View in Genome Browser
Species Human (GRCh38)
Location 3:50502665-50502687
Sequence GGACACTGCCTCTGTGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 454}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954437186_954437192 5 Left 954437186 3:50502637-50502659 CCTCAGGTGGAGGGGGGCCAAGA 0: 1
1: 0
2: 3
3: 20
4: 182
Right 954437192 3:50502665-50502687 GGACACTGCCTCTGTGGCACTGG 0: 1
1: 0
2: 2
3: 18
4: 454
954437179_954437192 19 Left 954437179 3:50502623-50502645 CCAGGGTACTCTCTCCTCAGGTG 0: 1
1: 0
2: 0
3: 13
4: 167
Right 954437192 3:50502665-50502687 GGACACTGCCTCTGTGGCACTGG 0: 1
1: 0
2: 2
3: 18
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954437192 Original CRISPR GGACACTGCCTCTGTGGCAC TGG Intronic
900600553 1:3500992-3501014 GGACACTGCAGCTGTGCCCCCGG - Exonic
901733075 1:11294585-11294607 GGGAACCACCTCTGTGGCACTGG - Intronic
901754279 1:11431795-11431817 GGATTCTCCCTCTGTGGCCCAGG + Intergenic
902095899 1:13945446-13945468 GGACTCTCCCTCTGTTGCCCAGG - Intergenic
902219957 1:14958558-14958580 GGACACTGCATCTGTTAAACGGG - Intronic
903121495 1:21219395-21219417 GGAGACTTGCTCTGTGGCCCAGG + Intronic
903631253 1:24773996-24774018 GGAGTCTCCCTCTGTGGCCCTGG + Intronic
903744803 1:25579640-25579662 GGTAGCTGCTTCTGTGGCACTGG - Intergenic
905115672 1:35638270-35638292 GGAAACTGCCTGTGTAGCTCTGG + Intronic
905120418 1:35677593-35677615 GGAATCTGGCTCTGTTGCACAGG - Intergenic
905224699 1:36471638-36471660 GGGCACTGGCTGTGGGGCACAGG + Exonic
905577491 1:39057467-39057489 GGAGTCTTCCTCTGTGGCCCAGG + Intergenic
905578415 1:39064490-39064512 GGAGTCTGACTCTGTTGCACAGG - Intergenic
905886291 1:41493857-41493879 GGCCACTGCCTGTGTGGCCTTGG + Intergenic
906115067 1:43350982-43351004 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
906194491 1:43921274-43921296 GAACACTGCCTCTGGGTCTCAGG + Intronic
906302234 1:44691230-44691252 GGAGTCTGTCTCTGTGGCCCAGG - Intronic
906628453 1:47344940-47344962 GGACTCTGGCTCTGTTGCTCAGG + Intronic
907976414 1:59435449-59435471 GCACAGGGCCTCTGTGGCATGGG - Intronic
909904310 1:81177052-81177074 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
910766905 1:90791191-90791213 GGACTCTCGCTCTGTGGCCCAGG + Intergenic
910848931 1:91632160-91632182 GAAGACTGCCTCAGTGGGACAGG + Intergenic
911383733 1:97148167-97148189 GGTCTCTGTCTCTGGGGCACTGG + Intronic
914416790 1:147491364-147491386 GGACCATGCTTCTGTGGAACTGG + Intergenic
914680074 1:149932923-149932945 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
915090377 1:153419882-153419904 GGACACTGCCCCTGGAGCAGAGG - Exonic
916734035 1:167591173-167591195 GGACACTCACTCTGTTGCTCAGG - Intergenic
917442471 1:175079638-175079660 GGCCACGGCTTCTGTGACACGGG + Exonic
918134473 1:181659265-181659287 GGCACCTGCCTCTGGGGCACAGG + Intronic
918180838 1:182085147-182085169 GGACACCGCCTCTCTAGCTCTGG + Intergenic
918226944 1:182492648-182492670 GGATTCTCCCTCTGTGGCCCAGG + Intronic
918294098 1:183139016-183139038 GGAGTCTTCCTCTGTGGCCCAGG - Intronic
918297067 1:183167024-183167046 GCACACTGGCTCTGGGGCCCAGG - Intergenic
918800861 1:188969641-188969663 GGCATCTGCCTCTGTGGCCCAGG + Intergenic
919662361 1:200259803-200259825 GGAGTCTTGCTCTGTGGCACAGG + Intergenic
919663100 1:200267461-200267483 GGCCCCTGCCTGTGTGGGACTGG - Intergenic
919955769 1:202413945-202413967 AGACACAGTCTCTGTGGCCCAGG + Intronic
923096958 1:230782989-230783011 GGAGTCTCACTCTGTGGCACAGG - Intronic
923820681 1:237437068-237437090 GGACTCTGGCTCTGTTGCCCAGG + Intronic
924697744 1:246418314-246418336 AGCCACTCCCTCTGTGGCAGAGG - Intronic
924739802 1:246788350-246788372 TGCCACTGCCCCTGTGGCCCTGG - Intergenic
1062889741 10:1049171-1049193 GGACGCTGCCTCTGCGGAACTGG - Intergenic
1062922558 10:1291234-1291256 GGCCCCCACCTCTGTGGCACTGG - Intronic
1063089264 10:2847633-2847655 GGAGTCTCGCTCTGTGGCACAGG - Intergenic
1063131181 10:3178684-3178706 GGAGTCTCCCTCTGTGGCTCAGG - Intergenic
1064378107 10:14815252-14815274 GGAGTCTGGCTCTGTGGCTCAGG - Intergenic
1065025718 10:21537321-21537343 GGAGACTCCCTCTGTCGCCCAGG + Intronic
1066375788 10:34856767-34856789 GGAGACTTCCTCTGTTGCCCAGG - Intergenic
1067951255 10:50740017-50740039 GGTCCCTGGCTCTGGGGCACTGG + Intronic
1068205741 10:53849833-53849855 GGAGCCTTCCTCTGTCGCACAGG - Intronic
1069042116 10:63706483-63706505 GGAGTCTTGCTCTGTGGCACAGG + Intergenic
1069376149 10:67794995-67795017 GGACACTGCCTGTGGGGGAGGGG + Intergenic
1070129051 10:73644074-73644096 GGAGTCTCCCTCTGTGGCTCAGG - Intergenic
1070540177 10:77410074-77410096 GGGCTCTGGCTTTGTGGCACAGG - Intronic
1070764751 10:79049894-79049916 GGAGTCTGCCTCTGTCGCCCAGG - Intergenic
1070861658 10:79671865-79671887 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1070875591 10:79803725-79803747 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
1070886583 10:79905087-79905109 GGTCCCTGGCTCTGGGGCACTGG + Intergenic
1070934802 10:80284778-80284800 TGACTCTGCCACTGTGCCACAGG + Intronic
1071642519 10:87325877-87325899 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
1072649859 10:97286564-97286586 GGAGTCTCGCTCTGTGGCACAGG - Intronic
1073261099 10:102191013-102191035 GGACACTCGCTCTGTTGCCCAGG - Intergenic
1073724129 10:106210181-106210203 GGGCAGTGCCTCAGTGTCACGGG + Intergenic
1074481288 10:113823213-113823235 GGAGTCTGACTCTGTGGCCCAGG - Intergenic
1074709650 10:116166823-116166845 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
1074713160 10:116194011-116194033 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
1075114274 10:119612920-119612942 GGAGCCTGGCTCTGTGGCCCAGG - Intergenic
1076140359 10:128073509-128073531 GGACAGTGCCTCAGGTGCACAGG - Intronic
1076310976 10:129507318-129507340 GGACAAGGCCTCTGGGGCAGGGG + Intronic
1076399187 10:130168468-130168490 GGACTCTGGCTCTGTAGCCCAGG + Intronic
1077365261 11:2158997-2159019 GGTCTCTGCCCCTGTGGCCCTGG + Intronic
1078235178 11:9477849-9477871 GGACTCTGGCTCTGTCGCCCAGG + Intronic
1078730667 11:13971169-13971191 GGCCAACGCCCCTGTGGCACTGG - Intronic
1078797780 11:14610387-14610409 GGCAATAGCCTCTGTGGCACAGG - Intronic
1080674253 11:34410342-34410364 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1080995220 11:37591525-37591547 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1082046497 11:47733362-47733384 GGACTCTGGCTCTGTTGCCCAGG + Intronic
1082050282 11:47765759-47765781 GGAGTCTTCCTCTGTGGCCCAGG - Intronic
1083157086 11:60830192-60830214 GGAGACTCCCTCTGTCGCCCAGG + Intergenic
1083225960 11:61284911-61284933 GGACACTCCCTCTGTTGCCCAGG - Intronic
1083613866 11:64016993-64017015 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1083770679 11:64865182-64865204 GGTCACTGCCTGCATGGCACAGG - Intronic
1084339784 11:68489042-68489064 AGAGTCTGCCTCTGTTGCACAGG + Intronic
1084372377 11:68752095-68752117 GGAGTCTAGCTCTGTGGCACAGG - Intergenic
1084746749 11:71175330-71175352 TGACACCACCTCTGTGGCTCAGG - Intronic
1086223837 11:84483403-84483425 GGAGTCTGGCTCTGTTGCACAGG - Intronic
1086536625 11:87854818-87854840 GGAGTCTGGCTCTGTGGCCCAGG + Intergenic
1086748584 11:90461885-90461907 GGAGTCTGGCTCTGTGGCCCAGG + Intergenic
1086997965 11:93380424-93380446 GGAGACTGGCTCTGTTGCCCAGG + Intronic
1087623362 11:100567611-100567633 GGACTCTCCCTCTGTCGCCCAGG - Intergenic
1088317332 11:108520592-108520614 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
1091479035 12:807743-807765 GGAATCTGGCTCTGTGGCCCAGG + Intronic
1091603966 12:1934974-1934996 GGACACTGCCTCTATGCACCTGG + Intergenic
1091641338 12:2239728-2239750 GCACACAGCCTCTGTGGAAATGG - Intronic
1092357790 12:7810954-7810976 GGACTCTCCCTCTGTCGCCCAGG + Intergenic
1093057515 12:14569310-14569332 GGAGTCTCCCTGTGTGGCACAGG - Intergenic
1096336616 12:50761688-50761710 GGAGTCTGCCTCTGTCGCCCAGG - Intergenic
1096462585 12:51830261-51830283 GGAGACTGGCTCTGTTGCCCAGG - Intergenic
1097388887 12:58984798-58984820 GGACTCTCACTCTGTTGCACAGG + Intergenic
1098023600 12:66180137-66180159 GGACTCTGGCTCTGTCGCCCAGG + Intergenic
1098633127 12:72749080-72749102 GGACACTCCCTTTGTAACACAGG + Intergenic
1099613541 12:84907320-84907342 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
1101329390 12:103745223-103745245 GGGCAGTGCCTCTGTGAAACGGG + Exonic
1101880671 12:108623489-108623511 GGACAGGGCCTCTGTGGCACTGG + Exonic
1102499938 12:113345046-113345068 GGAGACTTGCTCTGTGGCTCAGG + Intronic
1102705855 12:114879926-114879948 GGAGACTGGCTCTGTCGCCCAGG + Intergenic
1102853320 12:116271598-116271620 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1102984631 12:117268254-117268276 GGACTCTCGCTCTGTCGCACAGG + Intronic
1103251759 12:119505827-119505849 GGAGTCTTCCTCTGTGGCCCAGG - Intronic
1103789259 12:123457863-123457885 GGAGACTCCCTCTGTCGCCCAGG - Intronic
1103931333 12:124452666-124452688 GGACAGTGCTTCTGCGGCACAGG + Intronic
1104002606 12:124869679-124869701 GGAGACTCGCTCTGTGGCCCAGG + Intronic
1105661820 13:22504280-22504302 GGACTCTCCCTCTGTAGCCCAGG + Intergenic
1105759758 13:23503191-23503213 AGTAACTCCCTCTGTGGCACAGG - Intergenic
1106657893 13:31766897-31766919 GGCCAGTTGCTCTGTGGCACTGG + Intronic
1106856082 13:33854609-33854631 GGAAATAGCCCCTGTGGCACAGG + Intronic
1107116037 13:36746724-36746746 GGACACTTGCTCTGTTGCCCAGG + Intergenic
1107116969 13:36757394-36757416 GGACTCTGGCTCTGTTGCCCAGG + Intergenic
1107471588 13:40696402-40696424 GGACTCTTGCTCTGTGGCCCAGG + Intergenic
1107670643 13:42743294-42743316 GGACACTACATCAGTGACACTGG - Intergenic
1107717736 13:43217171-43217193 GGTCACTGCCTCTCTGGCCCTGG + Intronic
1107867892 13:44721237-44721259 GGACTCTTGCTCTGTGGCCCAGG + Intergenic
1107944962 13:45410020-45410042 GAATACTGCCCCTGTGGGACTGG - Intronic
1107949554 13:45449669-45449691 GGACACTCGCTCTGTCGCCCAGG + Intergenic
1107966160 13:45600041-45600063 GGACACTGTCTTTGGGGCAAAGG + Intronic
1108288322 13:48931084-48931106 GCAGGATGCCTCTGTGGCACAGG + Intergenic
1110290871 13:73805582-73805604 TGACAGTGCCTCTGTTGCCCAGG - Intronic
1110960065 13:81610285-81610307 GGCCACTGCCTCTGTGGAGTTGG + Intergenic
1111582773 13:90246124-90246146 GGACTCTTGCTCTGTGGCTCAGG - Intergenic
1111757885 13:92421671-92421693 GGAGTCTTGCTCTGTGGCACAGG - Intronic
1111984737 13:95054520-95054542 GGAGACTTGCTCTGTGGCCCAGG - Intronic
1112343739 13:98574035-98574057 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
1112637626 13:101233364-101233386 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
1112654420 13:101434703-101434725 AGACATTGCCACAGTGGCACTGG - Intergenic
1112676137 13:101704248-101704270 GGACCCTGCCTATGTAGCTCTGG + Intronic
1113837008 13:113334842-113334864 GGACACTTGCTCTGTCGCCCAGG + Intronic
1114819640 14:26002687-26002709 GGACTCTTGCTCTGTGGCCCAGG - Intergenic
1117168628 14:53067182-53067204 GGGCTCTCCCTCTGTGGCCCAGG + Intronic
1118336423 14:64856903-64856925 GTTCACTGCCTCTGTGGGAAGGG + Intronic
1119149189 14:72342702-72342724 AGACAAAGCCTCTGTTGCACAGG - Intronic
1119706965 14:76788993-76789015 GGCCACTGAGTGTGTGGCACAGG + Exonic
1119891522 14:78186053-78186075 GGACACTGCCTGGCTGACACTGG + Intergenic
1120874465 14:89362967-89362989 GGACCCTGCCTTTGTGTCACAGG - Intronic
1121644862 14:95510849-95510871 GCCCACTGCCTTTGTGGCATGGG - Intergenic
1122302257 14:100737859-100737881 TGACACTGCTTCTGTGGCACGGG - Exonic
1122366954 14:101200005-101200027 GGAGTCTGGCTCTGTTGCACAGG - Intergenic
1122664061 14:103316737-103316759 GCACAAGGACTCTGTGGCACGGG - Intergenic
1123737688 15:23201365-23201387 GGACTCTCCCTCTGTCGCCCAGG + Intergenic
1123813183 15:23949636-23949658 GGAAACTGTGTCTGTGGCACAGG + Intergenic
1124360138 15:29030434-29030456 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1124625540 15:31305541-31305563 GGACACCGACTCTGGGCCACAGG + Intergenic
1125573648 15:40740037-40740059 GGAAAATGCCTCTGTGGCCCAGG + Intronic
1125621146 15:41063309-41063331 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1125647742 15:41286637-41286659 GGAGTCTGTCTCTGTGGCCCAGG - Intergenic
1125662394 15:41404297-41404319 GGAGTCTGGCTCTGTGGCCCAGG - Intergenic
1126892464 15:53221223-53221245 GGAGTCTGGCTCTGTGGCCCAGG - Intergenic
1128809138 15:70557320-70557342 GGAGACTGCCCCTGTGGTACTGG + Intergenic
1129385673 15:75195026-75195048 GGAGTCTGGCTCTGTGGCTCAGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1129591032 15:76915358-76915380 GGAGTCTGCCTCTGTTGCCCAGG - Intergenic
1131097181 15:89663532-89663554 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097185 15:89663552-89663574 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097193 15:89663592-89663614 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097201 15:89663632-89663654 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097209 15:89663672-89663694 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097217 15:89663712-89663734 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097261 15:89663932-89663954 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097269 15:89663972-89663994 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097277 15:89664012-89664034 TGAAACTGACTCTGTGGCCCTGG - Intergenic
1131214650 15:90527152-90527174 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1131361642 15:91796989-91797011 GGACACTTGCTCTGTTGCCCAGG - Intergenic
1131645107 15:94333210-94333232 GGAGACTTGCTCTGTGGCTCAGG - Intronic
1133212189 16:4269782-4269804 GGACTCTCACTCTGTCGCACAGG - Intronic
1133362762 16:5187155-5187177 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1133463228 16:6005570-6005592 GGGCACTGCCTCTGTGTTGCAGG + Intergenic
1134560995 16:15209560-15209582 GGACTCTTCCTCTGTCGCCCAGG + Intergenic
1134837175 16:17370844-17370866 AGGCACTGCCTTTCTGGCACTGG + Intronic
1134921532 16:18121184-18121206 GGACTCTTCCTCTGTCGCCCAGG + Intergenic
1135023300 16:18980336-18980358 TGACACTTCCCCTGTGCCACAGG + Intergenic
1135197844 16:20409246-20409268 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
1136636420 16:31526785-31526807 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
1137256664 16:46780616-46780638 GGACACTCACTCTGTTGCCCAGG - Intronic
1137591465 16:49696614-49696636 CGTCACAGCCTCTGTGGCCCAGG - Intronic
1138027638 16:53534965-53534987 GGAAACTCCCTCTGTTGCCCAGG - Intergenic
1138414966 16:56866452-56866474 GGCCTCTACCTCTGGGGCACTGG - Intronic
1139385303 16:66564980-66565002 GGAAACTACCTCTCTGGCAGTGG + Intronic
1140379436 16:74473237-74473259 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1140573593 16:76137657-76137679 AGACACTGCCTATGTTGCCCAGG - Intergenic
1140741185 16:77943080-77943102 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
1141705658 16:85663078-85663100 GGACACGTCCTCTGAGGTACTGG + Exonic
1142662546 17:1441249-1441271 GGAGACTCCCTATGTGGCCCAGG + Intronic
1143088417 17:4434031-4434053 GGACACTGCCTGCCTGGCCCTGG - Exonic
1144132901 17:12265451-12265473 CCACACTCCCTCTGAGGCACTGG + Intergenic
1145923459 17:28628604-28628626 TATCACTGCCTCTGTGGCACTGG - Intronic
1147006996 17:37411446-37411468 GGACTCTCCCTCTGTTGCCCAGG + Intronic
1147138184 17:38446829-38446851 GGAGTCTTCCTCTGTGGCCCAGG + Intronic
1147628687 17:41916397-41916419 GGACTCTGGCTCTGTCGCCCAGG + Intronic
1148599103 17:48880566-48880588 GGAGTCTTGCTCTGTGGCACAGG - Intergenic
1148683473 17:49487561-49487583 GGACAGTTCCTCTCTGTCACAGG + Intergenic
1148959923 17:51384728-51384750 GGCCCCTGCCTGTGTGCCACTGG + Intergenic
1149451558 17:56753927-56753949 GGACTCTGGCTCTGTCGCCCAGG + Intergenic
1151307420 17:73272193-73272215 GGAGTCTCCCTCTGTGGCTCAGG - Intergenic
1152269657 17:79316574-79316596 GGACACAGGCTGTGTGGCCCAGG - Intronic
1152901591 17:82944259-82944281 GGCCACTGCCTCTTTCCCACTGG + Intronic
1153244510 18:3060729-3060751 GGACAGTTGCTCTGTAGCACCGG - Intergenic
1153533780 18:6078399-6078421 GGACTCTCCCTCTGTTGCCCAGG - Intronic
1153648353 18:7215815-7215837 GGACTCTCCCTCTGTCGCGCAGG + Intergenic
1155141822 18:23050853-23050875 GGACACTGGCTCTCTTGAACTGG + Intergenic
1155682071 18:28500231-28500253 GGAGTCTGCCTCTGTTGCCCAGG - Intergenic
1156191010 18:34720393-34720415 GAACAATGCCTCTGTTGTACTGG + Intronic
1157669122 18:49513453-49513475 GGAGTCTGGCTCTGTAGCACAGG + Intergenic
1157921626 18:51719141-51719163 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1158240242 18:55369466-55369488 GGAAACTGGCATTGTGGCACAGG - Intronic
1158346386 18:56520896-56520918 GGAGTCTACCTCTGTGGCCCAGG + Intergenic
1159871237 18:73761654-73761676 GGACACTGCTTCTGAGCCAAAGG - Intergenic
1160891168 19:1379503-1379525 GGACACTGGACCTGTGTCACTGG + Intergenic
1161255569 19:3307225-3307247 GGAGTCTGGCTCTGTGGCCCAGG - Intergenic
1161481064 19:4510867-4510889 GGACACTGCGTCTTTGGTTCCGG + Exonic
1161996361 19:7714553-7714575 GGAGACTCCCTCTGTTGCCCAGG - Intergenic
1163327335 19:16613530-16613552 GGGCACTGTCTAGGTGGCACTGG + Intronic
1163445547 19:17344018-17344040 GGACTCTCCCTCTGTCGCCCAGG - Intergenic
1164551177 19:29213332-29213354 GGACACTGACGAGGTGGCACCGG - Exonic
1164561158 19:29293183-29293205 GGACAGTGCCACTGTGGAAGAGG + Intergenic
1165404625 19:35622126-35622148 GGACTCTGCCTTGGGGGCACTGG + Intronic
1165740514 19:38202560-38202582 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
1165943908 19:39429938-39429960 GGACCCTTGCTCTGTGGCTCAGG + Intergenic
1166963515 19:46514076-46514098 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
1168034586 19:53709374-53709396 GGAGACTGGCTCTGTCGCCCAGG + Intergenic
926882818 2:17567382-17567404 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
926960538 2:18353872-18353894 GGGCACTGGTTCTGGGGCACCGG - Intronic
927108293 2:19846112-19846134 GGACACAGCCTCGCTGGCAGAGG + Intergenic
927272794 2:21231463-21231485 GCACGCTGCCACTGTAGCACAGG + Intergenic
929142248 2:38676735-38676757 GGACTCTGGCTCTGTTGCCCAGG - Intronic
929218600 2:39440671-39440693 GGACGCTTCCTCTGTTGCCCAGG - Intergenic
930014228 2:46959463-46959485 GGACAGGGCCTGTGTGTCACAGG + Intronic
930305926 2:49674179-49674201 GGACTCTTGCTCTGTGGCCCAGG - Intergenic
930435231 2:51332310-51332332 AGAGACTCCCTCTGTCGCACAGG - Intergenic
930672729 2:54168398-54168420 GGAGTCTGCTTCTGTGGCCCAGG - Intronic
931192304 2:60016050-60016072 GGAGTCTCGCTCTGTGGCACAGG + Intergenic
931227731 2:60348448-60348470 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
931269919 2:60692355-60692377 GGAGCCTGACTCTGCGGCACAGG - Intergenic
931285383 2:60827743-60827765 GGAGTCTGGCTCTGTGGCCCAGG + Intergenic
931321141 2:61175968-61175990 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
931649097 2:64453167-64453189 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
932309340 2:70727312-70727334 TGACCCTGCCTCTGTGGCTGGGG + Intronic
932348333 2:71010795-71010817 GGACGCTCACTCTGTCGCACCGG - Intergenic
932604869 2:73158165-73158187 GGTCACTGGCTCTGAAGCACAGG + Intergenic
934522745 2:95030256-95030278 GGGCACAGCCTCTGTGGCTCTGG - Intronic
934792023 2:97069677-97069699 GGACACTGACTTTATGGCAGAGG + Intergenic
934814596 2:97314033-97314055 GGACACTGACTTTATGGCAGAGG - Intergenic
934823098 2:97394450-97394472 GGACACTGACTTTATGGCAGAGG + Intergenic
936346129 2:111676778-111676800 GGAGGCTGCCTCTGGGGCAGGGG + Intergenic
936432764 2:112479290-112479312 GGAGTCTGGCTCTGTGGCCCAGG - Intergenic
936957675 2:118039835-118039857 AGACACTGACTCAGTGGTACTGG + Intergenic
938783057 2:134602796-134602818 GGACACTCCCTCTCAGGGACAGG - Intronic
942034483 2:171997697-171997719 AGAATCTTCCTCTGTGGCACAGG + Intronic
945278700 2:208014616-208014638 GGAGTCTGACTCTGTGGCCCAGG - Intronic
945366772 2:208964236-208964258 GGAGTCTGGCTCTGTGGCTCAGG - Intergenic
947630307 2:231648414-231648436 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
947948516 2:234127380-234127402 GGAGACTCCCTCTGTTGCCCAGG + Intergenic
948044644 2:234934450-234934472 GGACTCTTGCTCTGTCGCACAGG + Intergenic
948377081 2:237528374-237528396 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
948852189 2:240713948-240713970 GGACGCGGCCTCTGAGCCACAGG + Exonic
1169095675 20:2896351-2896373 GGAGTCTCCCTCTGTTGCACAGG - Intronic
1169161543 20:3383297-3383319 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1169484027 20:6011609-6011631 GGAGACTGACTCTGTCGCCCAGG + Intronic
1169720687 20:8673084-8673106 GGACTCTGGCTCTGTCGCCCAGG - Intronic
1171378216 20:24710015-24710037 GGATAGTGCCTCCGTGGCATTGG + Intergenic
1172364501 20:34338616-34338638 GGAGACTCGCTCTGTTGCACAGG + Intergenic
1172749732 20:37242304-37242326 GGAGTCTGGCTCTGTGGCCCAGG - Intergenic
1175305381 20:57972438-57972460 GGGGACTGCCTCAGTGGCAGGGG - Intergenic
1175360412 20:58405774-58405796 GGAGACTGGCTCTGTTGCCCAGG + Intronic
1175955480 20:62606898-62606920 GGGCACTGGCTCTGTGGAAATGG - Intergenic
1179558984 21:42200616-42200638 GGAGTCTCCCTCTGTTGCACTGG + Intronic
1179585862 21:42373768-42373790 GGTCACAGGCTCTGTGGCCCAGG + Intronic
1180075342 21:45459034-45459056 GGACACGGCCTCCCTCGCACGGG - Intronic
1180736508 22:18021762-18021784 GGCCACTCCCTCAGTGGCCCTGG + Intronic
1180836030 22:18929839-18929861 GGACAGTCCCTCTGTGGACCTGG - Intronic
1180926045 22:19555740-19555762 GGACAATGAGTCTCTGGCACTGG - Intergenic
1180947712 22:19705771-19705793 GGACCCTGCCTGCCTGGCACCGG + Intergenic
1180947723 22:19705806-19705828 GGACCCTGCCTGCTTGGCACTGG + Intergenic
1181408987 22:22704810-22704832 GGACAATCCCTCAGTGACACAGG + Intergenic
1181540815 22:23572372-23572394 GGAGTCTGGCTCTGTTGCACAGG - Intergenic
1182223102 22:28774091-28774113 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
1183015078 22:34979478-34979500 GGAGTCTGCCTCTGTTGCCCAGG - Intergenic
1183398003 22:37584197-37584219 GGACTCTTGCTCTGTTGCACAGG - Intergenic
1184143672 22:42595482-42595504 TCAAACTGCCTCTGTGGCAAAGG - Intronic
1203286122 22_KI270734v1_random:155138-155160 GGACAGTCCCTCTGTGGACCTGG - Intergenic
949171983 3:1010883-1010905 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
949942076 3:9162873-9162895 AGACACTGCCTCTGCTGTACTGG - Intronic
950082245 3:10231315-10231337 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
950223814 3:11217158-11217180 GGACTCTCCCTCTGTTGCCCAGG - Intronic
950669979 3:14520130-14520152 GGCCGCTGACTCTGGGGCACAGG + Exonic
953059378 3:39414510-39414532 GGACACTGACTCTGTGGCCATGG - Intergenic
953654770 3:44841421-44841443 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
954221726 3:49158937-49158959 GGTCACTGACTCTGTGGCTAGGG + Intergenic
954302929 3:49710303-49710325 GGAGTCTCGCTCTGTGGCACAGG + Intronic
954437192 3:50502665-50502687 GGACACTGCCTCTGTGGCACTGG + Intronic
954990958 3:54840434-54840456 GGACTCTCACTCTGTGGCCCAGG + Intronic
955291485 3:57696279-57696301 GGAGTCTCCCTCTGTCGCACAGG - Intergenic
955986176 3:64576289-64576311 TGACGCTGCTTCTGTGGCTCAGG - Intronic
956336334 3:68167850-68167872 GGACAATGTCTCTGTTGCACAGG - Intronic
956632381 3:71329245-71329267 GGAGTCTCCCTCTGTCGCACAGG + Intronic
957230215 3:77503496-77503518 GGACTCTCTCTCTGTGGCCCAGG - Intronic
957792033 3:84953735-84953757 GGACACTGTCTCTGTCCCCCAGG - Intergenic
959064743 3:101644999-101645021 GGACTCTCCCTCTGTTGCCCAGG + Intergenic
959687362 3:109162341-109162363 GGATTCTCGCTCTGTGGCACAGG - Intergenic
960576901 3:119239298-119239320 GGAATCTGGCTCTGTGGCCCAGG - Intronic
961409415 3:126707807-126707829 GCACACGGCCTCTCTGGCACTGG - Intronic
961721003 3:128895958-128895980 GGGGACTGTCTTTGTGGCACTGG + Intronic
962316160 3:134360723-134360745 TCACACTACCTCTGTGGCAAGGG + Intronic
962526758 3:136244142-136244164 GGAGCCTGGCTCTGTGGCCCAGG + Intergenic
964526584 3:157621361-157621383 GGAGTCTGCCTCTGTTGCCCAGG - Intronic
966262354 3:177994366-177994388 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
966471925 3:180299235-180299257 GGAGTCTGGCTATGTGGCACAGG - Intergenic
966616907 3:181923053-181923075 GGACTCTCCCTCTGTGGCCTAGG - Intergenic
967833556 3:193942541-193942563 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
967999379 3:195193260-195193282 GGAGTCTCGCTCTGTGGCACAGG - Intronic
968208457 3:196825615-196825637 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
968474927 4:799835-799857 GGAGCCTGCCTCTGTCGCTCAGG - Intronic
969330526 4:6471615-6471637 GGACCCTGCCTCTGGAGGACAGG + Intronic
969481766 4:7450149-7450171 GGACACTGAGGCTGAGGCACTGG - Intronic
969571017 4:8008437-8008459 GGACACAGCCACTGAGGCTCTGG + Intronic
969824910 4:9749827-9749849 GGACCCTCACTCTGTCGCACAGG - Intergenic
971181648 4:24333906-24333928 GGAGTCTTCCTCTGTTGCACAGG - Intergenic
971945718 4:33274246-33274268 GGAAACTCCCTCTGTAACACTGG + Intergenic
972930721 4:44068713-44068735 GAACACTGCCACTATGGCAAGGG - Intergenic
973791383 4:54381115-54381137 AGCCACTGCATCTGTGGTACTGG + Intergenic
973890330 4:55361776-55361798 GGAGTCTCACTCTGTGGCACAGG - Intronic
979764821 4:124451889-124451911 GGAGACTTCCTCTGTGACTCTGG - Intergenic
981090617 4:140728686-140728708 GGAGACTGGCTCTGTCGCCCAGG + Intronic
981799955 4:148644554-148644576 AGACAGGGCCTCTGTGGCCCAGG + Intergenic
981954204 4:150449554-150449576 AAAAAATGCCTCTGTGGCACAGG + Intronic
982240544 4:153295575-153295597 GGCCACTGTCTCTGAGGCAACGG - Exonic
983306538 4:165996571-165996593 GGAGTCTTCCTCTGTTGCACAGG - Intronic
984069745 4:175095362-175095384 GGATTCTGACTCTGAGGCACAGG - Intergenic
985071826 4:186173376-186173398 GGAGTCTGGCTCTGTGGCCCCGG + Intergenic
987333689 5:16879586-16879608 GGTCACTAGCTGTGTGGCACTGG - Intronic
987648655 5:20710796-20710818 GGAGTCTCCCTCTGTCGCACAGG - Intergenic
987917120 5:24228616-24228638 GGCAACTGCATCTGTTGCACAGG + Intergenic
988982697 5:36587340-36587362 GAACAATCTCTCTGTGGCACTGG + Intergenic
989393780 5:40930586-40930608 GGAGACTCCCTCTGTTGCCCAGG + Intronic
990526416 5:56632272-56632294 GGAAACTGTCTCTGAAGCACAGG + Intergenic
991269059 5:64757893-64757915 GGAGTCTGCCTCTGTCGCCCAGG + Intronic
991598874 5:68332986-68333008 TGACACTAGCTCTGTGGCCCTGG - Intergenic
991685951 5:69182697-69182719 GGAGACTCCCTCTGTCGCCCAGG - Intergenic
992693428 5:79260908-79260930 TGATACTGCATCTGTGGCCCTGG - Intronic
995576479 5:113541215-113541237 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
997148939 5:131470728-131470750 AGAGACTGACTCTGTGGCAGAGG + Intronic
997304703 5:132829001-132829023 GGTCCCTGCCTCAGTGGCAGTGG + Intronic
997590807 5:135071078-135071100 GCACACTCCCTCTGTGGCTCTGG - Intronic
998460172 5:142304197-142304219 GGAAACTGCATCTGAGTCACAGG + Intergenic
998469272 5:142370630-142370652 TCACACTGCCAATGTGGCACAGG - Intergenic
999865417 5:155695450-155695472 TGACTCTGCCTGTGTTGCACTGG - Intergenic
1002122824 5:177018763-177018785 GGACTCTGCCTCCATGGCACAGG + Intronic
1002270652 5:178069758-178069780 GGAGTCTGCCTCTGTCACACAGG - Intergenic
1002320974 5:178375731-178375753 GGAGTCTGCCTCTGTTGCCCAGG + Intronic
1002497474 5:179624868-179624890 GGATTCGGACTCTGTGGCACTGG - Intronic
1003135296 6:3430507-3430529 GAACACTGAGACTGTGGCACTGG - Intronic
1003275497 6:4647236-4647258 GGACTCTGACTCTGTTGCCCAGG - Intergenic
1003494448 6:6652028-6652050 GGAGTCTTCCTCTGTTGCACAGG - Intronic
1003577081 6:7307066-7307088 GGACACTGGCCCAGTGGCAAAGG + Intronic
1004125067 6:12865176-12865198 AGGCACAGCTTCTGTGGCACTGG + Intronic
1004862446 6:19818967-19818989 GGACACTGCCTGCCTGGTACAGG - Intergenic
1005545175 6:26860487-26860509 GGAGTCTCCCTCTGTCGCACAGG + Intergenic
1005687523 6:28269085-28269107 GGAGTCTGCCTCTGTTGCCCAGG - Intronic
1005709551 6:28490089-28490111 GGACACAGCCTCTCTGGGCCCGG + Intergenic
1007380817 6:41488938-41488960 GGACACAGCTTCTGGGGCCCGGG + Intergenic
1007464693 6:42043727-42043749 GGGCTCTGCCTCTGTGTCCCTGG + Intronic
1007745635 6:44041411-44041433 GGACCCAGCCTCTGTGGCCCAGG + Intergenic
1009015968 6:57902107-57902129 GGAGTCTCCCTCTGTCGCACAGG + Intergenic
1010237969 6:73590711-73590733 GGACACTTGCTCTGTTGCCCAGG - Intergenic
1011652157 6:89516498-89516520 AGACACAGCCTCTGTTGCCCAGG + Intronic
1012077180 6:94704196-94704218 GGAGTCTCCCTCTGTCGCACAGG + Intergenic
1012266678 6:97153395-97153417 GGACTCTCCCTCTGTTGCCCAGG + Intronic
1012698445 6:102419974-102419996 GGAGTCTTCCTCTGTCGCACAGG - Intergenic
1012889566 6:104883077-104883099 GGAGACTCCCTCTGTTGCCCAGG + Intergenic
1013003497 6:106048359-106048381 AGACACTGTCTCTGTTGCCCAGG - Intergenic
1016541125 6:145165995-145166017 GGAGTCTGGCTCTGTCGCACAGG - Intergenic
1017125098 6:151057802-151057824 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1017688770 6:156942436-156942458 CCACGCTGCCTCTGTGGCCCAGG - Intronic
1018255155 6:161911217-161911239 GACCACTTCCTCTTTGGCACTGG - Intronic
1018317699 6:162573310-162573332 GGACACTGCCTCTCGTGCACAGG + Intronic
1018721176 6:166573619-166573641 TCACACTGACTCTGTGGCTCCGG + Intronic
1019228621 6:170537470-170537492 GAACACAGCCACTGTTGCACTGG + Intronic
1020703222 7:11509794-11509816 GGACTCTGGCTCTGTCGCCCAGG - Intronic
1021454672 7:20816785-20816807 CAACACTTCCTCTGTGTCACTGG - Intergenic
1021636611 7:22700126-22700148 AGACACAGGCTCTGTCGCACAGG - Intergenic
1021729120 7:23579356-23579378 AGACAGTGTCTCTGTGGCCCAGG + Intergenic
1021931832 7:25588705-25588727 TGACACTGCCTCTCTGGAAGTGG + Intergenic
1022107223 7:27205212-27205234 GGTCACTTCCTGGGTGGCACGGG - Intergenic
1023009997 7:35917850-35917872 GGACAGAGCCTCTGTGCCATGGG + Intergenic
1023887791 7:44373587-44373609 GGATACTGCCTCTAGGGCAGTGG + Intergenic
1024080836 7:45853729-45853751 GGACAGAGCCTCTGTGCCATGGG - Intergenic
1024606551 7:51026870-51026892 GGAGACTCACTCTGTGGCCCAGG - Intronic
1026017289 7:66681593-66681615 GGGCTCTCCCTCTGTGGCCCAGG + Intronic
1026219687 7:68382911-68382933 GGAAACACCCACTGTGGCACTGG + Intergenic
1026659877 7:72291506-72291528 GTACACTGCCTGTGTGGTGCAGG - Intronic
1027002622 7:74664457-74664479 GGAGTCTCCCTCTGTCGCACAGG + Intronic
1027965747 7:85004616-85004638 GGTGACAGCCTCTGTGCCACAGG + Intronic
1029144180 7:98434177-98434199 GGACAGAGCCTCTGTGCCATGGG + Intergenic
1029646771 7:101861858-101861880 GGAGTCTCCCTCTGTGGCCCAGG + Intronic
1030563593 7:111122596-111122618 GGACAATGCAATTGTGGCACTGG + Exonic
1031329687 7:120449301-120449323 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1032285654 7:130536847-130536869 GCCCACTTCCTCTGTGTCACTGG - Intronic
1034186746 7:149183873-149183895 GGAGTCTGGCTCTGTGGCCCAGG + Intergenic
1034317080 7:150142858-150142880 GGACTCTCCCTCTGTTGCCCAGG + Intergenic
1034380500 7:150688154-150688176 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1035384230 7:158459605-158459627 GGCCACAGCCTGTGTGTCACAGG + Intronic
1035897193 8:3416275-3416297 GGAGTCTGGCTCTGTGGCTCAGG - Intronic
1036509450 8:9387052-9387074 GGACACTGTCCCTCTGGCATAGG - Intergenic
1037763202 8:21755943-21755965 GGACACTGCCTCTAAGGGACAGG + Intronic
1037816672 8:22116224-22116246 GTCCACTGCAGCTGTGGCACAGG + Intronic
1038023411 8:23568915-23568937 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1038044561 8:23755149-23755171 GAAAACTGCCTTTCTGGCACTGG - Intergenic
1038122023 8:24628104-24628126 GGAGTCTCGCTCTGTGGCACAGG + Intergenic
1038395966 8:27245674-27245696 GGCCACTGCCACTCTGGCAAGGG - Intronic
1039210382 8:35206375-35206397 GGACTCTGGCTCTGTCGCCCGGG + Intergenic
1039948112 8:42147316-42147338 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1039972787 8:42334579-42334601 GGCCTCTGCCTCTGTGCCCCTGG + Intergenic
1039980982 8:42409840-42409862 GGACCCTGGCTCTGTGTCAGAGG + Intergenic
1040372604 8:46792335-46792357 GGACACTCCCTCTGCTGCCCAGG + Intergenic
1041319641 8:56599881-56599903 GGAGACTCCCTCTGTTGCCCAGG - Intergenic
1041530252 8:58857793-58857815 GGACTCTTACTCTGTCGCACAGG + Intronic
1043746090 8:83875199-83875221 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1044413411 8:91909967-91909989 GGATACTGTGGCTGTGGCACAGG + Intergenic
1044582451 8:93835661-93835683 AGTCACTGACTCTGTGGGACAGG + Intergenic
1045752853 8:105506960-105506982 GGAGTCTGGCTCTGTGGCCCAGG - Intronic
1046076524 8:109318981-109319003 GGACTCTTGCTCTGTGGCCCAGG + Intronic
1047203288 8:122783305-122783327 GGACACTGCCTTTTAGGCCCTGG + Intronic
1047226240 8:122957491-122957513 GGAGTCTTCCTCTGTGGCCCAGG + Intronic
1047494134 8:125397673-125397695 GGACTCTTGCTCTGTGGCCCAGG + Intergenic
1048208634 8:132435965-132435987 GGACACTGCCTCTCTTTCAGGGG - Intronic
1049144905 8:140992442-140992464 GGAGTCTTGCTCTGTGGCACAGG - Intronic
1049591855 8:143466312-143466334 GGACACTGCCTGTGGCCCACGGG - Intronic
1049667753 8:143854721-143854743 GGACACTCACTCTGTTGCTCAGG + Intergenic
1049830086 8:144695098-144695120 GGAGTCTCCCTCTGTGGCCCAGG + Intergenic
1050336374 9:4593869-4593891 GGACCCTGTGTGTGTGGCACAGG - Intronic
1050341381 9:4643031-4643053 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1051565257 9:18490155-18490177 GGCCAGTTCCTCTGTGGCATGGG - Intronic
1053530305 9:38874719-38874741 GGACACTTACTCTGTTGCCCAGG + Intergenic
1054202531 9:62099149-62099171 GGACACTTACTCTGTTGCCCAGG + Intergenic
1054635829 9:67489216-67489238 GGACACTTACTCTGTTGCCCAGG - Intergenic
1055529667 9:77171428-77171450 GCCCACTGCCCCTGTGCCACAGG + Intergenic
1057276266 9:93677377-93677399 GGACACGGCCTCTGAGGCGGAGG + Intronic
1057595422 9:96411851-96411873 GGACTCTGGCTCTGTCGCCCAGG + Intronic
1057724658 9:97559737-97559759 GGAGTCTCGCTCTGTGGCACAGG - Intronic
1059283626 9:113154693-113154715 TGACTCTGCCTCTGTGGATCCGG + Intronic
1060797029 9:126519642-126519664 TGCCACTGCCTCTGTGACCCTGG + Intergenic
1061393302 9:130329806-130329828 GGACACTGCCAGTGTGGGGCAGG - Intronic
1061696678 9:132381217-132381239 GGAGTCTGGCTCTGTGGCCCAGG + Intronic
1061818462 9:133209524-133209546 GGGCCCTGCCTCTGTGGCTTGGG - Intergenic
1061906332 9:133701233-133701255 GGAAGCTGGCTCTGTAGCACCGG - Intronic
1062241988 9:135545837-135545859 GGGCCCTCCCTCTGTGGCTCGGG + Intergenic
1185659433 X:1715021-1715043 GGAGTCTCCCTCTGTGGCCCAGG - Intergenic
1186363811 X:8871078-8871100 GGAGACTGCCTTTGGGACACAGG - Intergenic
1187179428 X:16929601-16929623 GGAGTCTCACTCTGTGGCACAGG + Intergenic
1187286718 X:17912371-17912393 TGACACTGCCTGGATGGCACAGG - Intergenic
1187426908 X:19186095-19186117 GGGCACTTCCTCTGTGCCAGGGG - Intergenic
1187456105 X:19442746-19442768 GGACTCTGACTCTGTTGCCCAGG + Intronic
1187457119 X:19451257-19451279 GGAAACTGACTCTGTTGCCCAGG - Intronic
1189309221 X:40008403-40008425 GTTCTCTGCCTCTGTGGCCCAGG - Intergenic
1189984065 X:46538061-46538083 GGAGTCTCCCTCTGTGGCCCAGG - Intronic
1192365714 X:70471353-70471375 GGAGTCTCCCTCTGTTGCACAGG + Intronic
1193364848 X:80620107-80620129 GGACTCTCCCTCTGTTGCCCAGG + Intergenic
1193638777 X:83985446-83985468 GAACTCTAACTCTGTGGCACTGG - Intergenic
1197654532 X:129102255-129102277 GGGGTCTCCCTCTGTGGCACAGG - Intergenic
1198105310 X:133456004-133456026 GGAGTCTGGCTCTGTGGCCCAGG + Intergenic
1200285516 X:154818507-154818529 GGAGTCTGCCTCTGTCGCCCAGG - Intronic
1200611807 Y:5333864-5333886 GGAATCTGCCTCTGTTGCCCAGG - Intronic
1201782537 Y:17739439-17739461 GGAGTCTTGCTCTGTGGCACAGG - Intergenic
1201819016 Y:18166549-18166571 GGAGTCTTGCTCTGTGGCACAGG + Intergenic
1202190276 Y:22235217-22235239 GGAGACTTGCTCTGTGGCCCAGG - Intergenic
1202578839 Y:26357229-26357251 AGACACAGTCTCTGTGGCCCAGG - Intergenic
1202593010 Y:26507192-26507214 GGAGTCTGCCTCTGTTGCCCAGG - Intergenic