ID: 954438941

View in Genome Browser
Species Human (GRCh38)
Location 3:50511123-50511145
Sequence CAATAGATCCAGACTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954438941_954438952 22 Left 954438941 3:50511123-50511145 CCCCTCTCAGTCTGGATCTATTG No data
Right 954438952 3:50511168-50511190 CTTGAACATACTCCAAATGGAGG No data
954438941_954438944 -9 Left 954438941 3:50511123-50511145 CCCCTCTCAGTCTGGATCTATTG No data
Right 954438944 3:50511137-50511159 GATCTATTGCCCCAGAAGCCAGG No data
954438941_954438953 25 Left 954438941 3:50511123-50511145 CCCCTCTCAGTCTGGATCTATTG No data
Right 954438953 3:50511171-50511193 GAACATACTCCAAATGGAGGAGG No data
954438941_954438950 19 Left 954438941 3:50511123-50511145 CCCCTCTCAGTCTGGATCTATTG No data
Right 954438950 3:50511165-50511187 AGCCTTGAACATACTCCAAATGG No data
954438941_954438954 26 Left 954438941 3:50511123-50511145 CCCCTCTCAGTCTGGATCTATTG No data
Right 954438954 3:50511172-50511194 AACATACTCCAAATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954438941 Original CRISPR CAATAGATCCAGACTGAGAG GGG (reversed) Intergenic
No off target data available for this crispr