ID: 954440112

View in Genome Browser
Species Human (GRCh38)
Location 3:50517085-50517107
Sequence TGGGGGACCCAGCACCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954440112_954440123 23 Left 954440112 3:50517085-50517107 CCCCCATGGTGCTGGGTCCCCCA No data
Right 954440123 3:50517131-50517153 TGATGTTTGAACAACTTTCAGGG No data
954440112_954440122 22 Left 954440112 3:50517085-50517107 CCCCCATGGTGCTGGGTCCCCCA No data
Right 954440122 3:50517130-50517152 ATGATGTTTGAACAACTTTCAGG No data
954440112_954440124 27 Left 954440112 3:50517085-50517107 CCCCCATGGTGCTGGGTCCCCCA No data
Right 954440124 3:50517135-50517157 GTTTGAACAACTTTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954440112 Original CRISPR TGGGGGACCCAGCACCATGG GGG (reversed) Intergenic
No off target data available for this crispr