ID: 954442393

View in Genome Browser
Species Human (GRCh38)
Location 3:50528834-50528856
Sequence GAGGTCACACAGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954442393_954442398 26 Left 954442393 3:50528834-50528856 CCAAGCTCCAGCTGTGTGACCTC No data
Right 954442398 3:50528883-50528905 GTTCATTTCCTCAGCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954442393 Original CRISPR GAGGTCACACAGCTGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr